CN107715117A - The medicine-carried system and pharmaceutical applications of a kind of tetrahedral structure - Google Patents
The medicine-carried system and pharmaceutical applications of a kind of tetrahedral structure Download PDFInfo
- Publication number
- CN107715117A CN107715117A CN201711157041.1A CN201711157041A CN107715117A CN 107715117 A CN107715117 A CN 107715117A CN 201711157041 A CN201711157041 A CN 201711157041A CN 107715117 A CN107715117 A CN 107715117A
- Authority
- CN
- China
- Prior art keywords
- dna
- medicine
- cell
- carried system
- aptamer1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
Abstract
The present invention provides the medicine-carried system of tetrahedral structure, and the structure of the medicine-carried system is Aptamer AS1411 DNA.The structure of the medicine-carried system is Aptamer1 AS1411 DNA, and the structure of the medicine-carried system is specifically connected on DNA tetrahedrons simultaneously for Aptamer1 AS1411 DNA by Aptamer1 and three AS1411 in a manner of base pair complementarity.The present invention is applied on medicine for nasopharyngeal, and specifically targets CD44+On the medicine of nasopharyngeal carcinoma cell, while to suppress the medicine of the propagation of the 8F cells of nasopharyngeal carcinoma 5.
Description
Technical field
The present invention provides a kind of design, preparation and the pharmaceutical applications of the medicine-carried system with tetrahedral structure, belongs to biology
Pharmaceutical technology field.
Background technology
Nasopharyngeal carcinoma (nasopharyngeal carcinoma, NPC) is current incidence of disease highest head-neck malignant tumor.
Worldwide, its principal pathogenetic area is SOUTHERN CHINA, Southeast Asia and the central and east in Africa and south, especially with China
Southern Guangdong language crowd incidence of disease highest, up to 25-30/10 ten thousand；And the most of western countries NPC incidence of disease is relatively low.NPC is to ray
Rdativery sensitive, part early stage NPC patient can cure after radiotherapy alone；But late period, (III, IV) was even if NPC chemicotherapies
Combined treatment, its 5 years survival rates are still hovered 10%~40% or so, and therapeutic effect is not improved fundamentally.It is intractable
NPC and metastatic NPC treatment still has huge challenge.Therefore, the exploration of the treatment method new to nasopharyngeal carcinoma is particularly heavy
Will.Relative to nasopharyngeal mucosa normal epithelium cell, often specific height expresses some molecular labelings to nasopharyngeal carcinoma tumor cell.
This otherness expressed using surface molecular between tumour cell and normal cell, can design specific recognition tumour cell
Targeted therapy strategy, so as to improve the selectivity of antineoplastic in vivo, realize the targeted therapy of nasopharyngeal carcinoma.
CD44 albumen is the main component of extracellular matrix, is a kind of cross-film single chain glycoprotein, participates in cell-ECM/base
Adhesion between matter, activated lymphocyte is gone back to the nest and cell migration.Research finds that CD44 is overexpressed simultaneously on kinds of tumor cells surface
It is closely related with tumor development and invasion and attack transfer, it is potential oncotherapy molecular target.Studies have shown that CD44 is in NPC
It is high in cell to express and played a significant role during NPC occurrence and development, it can be used as independent tumour poor prognosis index.
In the early-stage Study of this seminar, found by laser scanning co-focusing technical research, it is thin in human nasopharyngeal carcinoma SUNE-1 5-8F
Cellular surface CD44 is overexpressed.Experiment in vitro confirms, with CD44-Cell is compared, CD44+Cell has stronger propagation, invasion and attack and turned
Shifting ability, and the repellence to chemicotherapy.These research promptings：CD44+ nasopharyngeal carcinoma cells show class tumor stem cell thing
Property, target CD44+The antineoplaston of tumour cell is the accurate therapeutic strategy of nasopharyngeal carcinoma for the prospect that has much.
At present, maximally effective targeting CD44 antitumor strategy is using anti-CD44 monoclonal antibody as target head molecule, by it with resisting
Tumour medicine couples, so as to which drug targeting is sent in the tumour cell of the high expression of CD44.However, due to I clinical trial phase
The various strong toxic side effects of middle appearance, related clinical test are halted.To find out its cause, although CD44 molecules are swollen
High expression in oncocyte, but also have expression in normal human tissue cell, due to the high specificity of anti-CD44 monoclonal antibody, cause
The non-specific killing side effect for aligning normal cell is produced based on the tactful targeted drug with being difficult to avoid that.It is reported that CD44
In the presence of two kinds of different states：Normal cell surface C D44 is in tranquillization state more, and the CD44 of tumor cell surface due to by
The influence of many factors and be in the state of activation.Therefore, if realizing that specific recognition tumor cell surface is in the state of activation
CD44, the targeted therapy for nasopharyngeal carcinoma is provided to new opportunity.
Aptamer is that the one section of single-stranded/double-strand obtained by index concentration aglucon evolutionary system (SELEX) screening is few
Polynucleotide, it can be with high-affinity, be with high specificity combined with target protein, therefore can be connected as target head molecule with pharmaceutical carrier
Connect, and promote these drug targetings to enter among tumor tissues and tumour cell.At present, target head molecule is used as using aptamer
The drug delivery system for building high targeting is one of hot fields of antitumor research.There are some researches show SELEX experiment screenings
The DNA aptamers of the thio-modification of acquisition can specific recognition tumor cell surface CD44 molecules, such as target
Head molecule will have following advantage：(1) obtained by model discrimination of tumour cell, therefore only activated state CD44 could tie with it
Close, and tranquillization state then can not, thus avoid the toxic side effect to normal cell；(2) compared with native ligand, have higher
Target affinity and specificity；(3) aptamer molecule very little, it interior under CD44 mediations can swallow into the cell, will carry
Drug targeting be delivered in tumour cell；(4) nucleic acid is human body naturally occurring material, will not be caused into human body strong
Immune response.Therefore, compared with the antibody strategies for CD44 targeted therapies of current main-stream, the targeting based on aptamer
Therapeutic strategy has more wide application prospect.
The drug delivery vehicle for being usually used in targeted therapy at present is mainly viral vector and non-virus carrier.Viral vector by
In its potential pathogenic, immunogenicity the shortcomings of, limited to its application；Biocompatibility then be present in non-virus carrier
Difference, it is not easy to be metabolized, easily accumulates the problems such as producing toxicity in vivo.Therefore, safely and effectively targeted delivery vector system is still for research and development
It is one of significant problem of current targeted therapy urgent need to resolve.DNA is not only the inhereditary material of life entity, or composition biology is received
The ideal element of rice structure function material.DNA nano materials have a good mechanical performance, and rich in programmability and controllable
Property.What is more important, the material have good biocompatibility and degraded energy using the intrinsic DNA of human body as raw material
Power is small to organism toxic action；The DNA tetrahedrons have been shown as drug delivery carrier in terms of drug delivery at present
Very big application potential.Therefore, the appearance of DNA nano-medicament carriers provides new means and approach for drug targeting treatment.
AS1411 is a kind of antitumor aptamer researched and developed, by 26 base compositions.Oneself is verified,
AS1411 is equal to kinds of tumor cells to play obvious inhibited proliferation.Further study showed that paranuclein is AS1411
Molecular target.Paranuclein is the phosphorylated protein that content is most abundant in kernel, has various biological function：Cell is participated in increase
Grow, grow and anti-apoptotic effect.There are some researches show：AS1411 Anticancer Effect and Mechanism is targeted inhibition tumour cell
The function of middle paranuclein and prevent DNA damage reparation, then induce Apoptosis and reach suppress tumour purpose.At present,
AS1411 comes into phase ii clinical trial as a kind of new cancer therapy drug, result of the test show AS1411 security and
There is good anticancer effect to various solid carcinomas.
In summary, relative to normal cell, the specific high expression CD44 molecular labelings of nasopharyngeal carcinoma tumor cell surface
This feature, the design for nasopharyngeal carcinoma targeted therapy strategy provide condition.The general thought of this research work is, with DNA tetra-
Agent structure of the face body structure as pharmaceutical carrier, research and develop new antitumoral target drug-carrying system.The medicine-carried system passes through DNA tetra-
The arm chain stretched out in the body each edge of face, by the aptamer of energy targets identification CD44 molecules in a manner of base pair complementarity
Aptamer AS1411 combinations with energy targeted inhibition paranuclein are modified onto DNA tetrahedrons, and thus structure one kind is new resists
Medicine for nasopharyngeal targeted delivery system.The medicine-carried system by the efficient targeted deliveries of drug molecule AS1411 into nasopharyngeal carcinoma cell,
And then play GVT.This item purpose successful implementation, a kind of intelligence of the selectively targeted nasopharyngeal carcinoma cell of energy will be developed
The new drug delivery systems of type, high-efficiency low-toxicity, new technology and new way are provided for the targeted therapy of nasopharyngeal carcinoma, had important
Potential applicability in clinical practice.
The content of the invention
Based on above-mentioned purpose, the present invention provides a kind of targeted drug, specially the load medicine compound of tetrahedral structure, specifically
For Aptamer-AS1411-DNA.
Preferably the structure of the medicine-carried system is Aptamer1-AS1411-DNA, and the structure of the medicine-carried system is
Aptamer1-AS1411-DNA is specifically to be connected simultaneously in a manner of base pair complementarity by Aptamer1 and three AS1411
It is connected on DNA tetrahedrons.
Described Aptamer1 is
TGC*AG*ATGC*A*AGGT*A*ACC*AT*ATCC*A*A*AGC*A*AATTGATCTATG ATCGTACGAT；Three
Bar AS1411 is AS1411 (1), AS1411 (2), AS1411 (3), wherein,
AS1411 (1) is specially
GGTGGTGGTGGTTGTGGTGGTGGTGGTCGGAATGCAATACGACTGTA；
AS1411 (2) is specially
GGTGGTGGTGGTTGTGGTGGTGGTGGGAAAGCTTGTAGCTATAGTTA；
AS1411 (3) is specially
GGTGGTGGTGGTTGTGGTGGTGGTGGAGTTAAACATCGCATGTGCTT。
Or preferably the structure of medicine-carried system is Aptamer2-AS1411-DNA, the structure of the medicine-carried system is Aptamer2-
AS1411-DNA is specifically to be connected to DNA tetra- simultaneously in a manner of base pair complementarity by Aptamer2 and three AS1411
On the body of face
Described Aptamer2 is
TTGGG*ACGGTGTT*A*A*ACG*A*A*AGGGG*ACG*ACATTGATCTATGATC GTACGAT；Three
AS1411 is AS1411 (1), AS1411 (2), AS1411 (3), wherein, AS1411 (1) is specially
GGTGGTGGTGGTTGTGGTGGTGGTGGTCGGAATGCAATACGACTGTA；
AS1411 (2) is specially
GGTGGTGGTGGTTGTGGTGGTGGTGGGAAAGCTTGTAGCTATAGTTA；
AS1411 (3) is specially
GGTGGTGGTGGTTGTGGTGGTGGTGGAGTTAAACATCGCATGTGCTT。
Or more preferably the structure of medicine-carried system is Aptamer3-AS1411-DNA, the structure of the medicine-carried system is
Aptamer3-AS1411-DNA is specifically to be connected simultaneously in a manner of base pair complementarity by Aptamer3 and three AS1411
It is connected on DNA tetrahedrons.
Described Aptamer3 is
GTCCC*A*AGGCCTGC*A*AGGG*A*ACC*A*AGG*AC*AC*AGGACATTGAT
CTATGATCGTACGAT；Three AS1411 are AS1411 (1), AS1411 (2), AS1411 (3), wherein, AS1411 (1) is specific
For
GGTGGTGGTGGTTGTGGTGGTGGTGGTCGGAATGCAATACGACTGTA；
AS1411 (2) is specially
GGTGGTGGTGGTTGTGGTGGTGGTGGGAAAGCTTGTAGCTATAGTTA；
AS1411 (3) is specially
GGTGGTGGTGGTTGTGGTGGTGGTGGAGTTAAACATCGCATGTGCTT。
Application of the present invention by the medicine-carried system of described tetrahedral structure on the medicine for treating nasopharyngeal carcinoma is prepared.
Described nasopharyngeal carcinoma is to be directed to CD44+Nasopharyngeal carcinoma 5-8F cells.
The concentration of the medicine-carried system of described tetrahedral structure is 0.1 μM -1.0 μM.
Brief description of the drawings
The average structure (a) of Aptamer1-CD44 compounds and RMSD curves (b) after Fig. 1 molecular dynamics simulations.
The average structure (a) of Aptamer2-CD44 compounds and RMSD curves (b) after Fig. 2 molecular dynamics simulations.
The average structure (a) of Aptamer3-CD44 compounds and RMSD curves (b) after Fig. 3 molecular dynamics simulations.
The tetrahedral PAGE phenograms of Fig. 4 DNA.1 to 6 refer to S1+S2, S1, S1+S2+S3, S1+S2+S3+S4, S1 respectively
+ S2+S3+S4+S5 and S1+S2+S3+S4+S5+S6.
Tri- kinds of tetrahedral PAGE phenograms of the aptamer modified DNA of DNA of Fig. 5.1 to 4 refer to DNA four sides respectively
Body, Aptamer1-DNA tetrahedrons, Aptamer2-DNA tetrahedrons and Aptamer3-DNA tetrahedrons.
Fig. 6 is the tetrahedral PAGE phenograms of Aptamer1-AS1411-DNA.1 refers to DNA tetrahedrons, and 2 refer to
Aptamer1-DNA tetrahedrons, 3, which refer to Aptamer1-DNA tetrahedrons, connects an AS1411, and 4 refer to Aptamer1-DNA tetra-
Face body connects two AS1411, and 5, which refer to Aptamer1-DNA tetrahedrons, connects three AS1411.
Fig. 7 is the tetrahedral PAGE phenograms of Aptamer2-AS1411-DNA.5 refer to DNA tetrahedrons, and 4 refer to
Aptamer1-DNA tetrahedrons, 3, which refer to Aptamer1-DNA tetrahedrons, connects an AS1411, and 2 refer to Aptamer1-DNA tetra-
Face body connects two AS1411, and 1, which refers to Aptamer1-DNA tetrahedrons, connects three AS1411.
Fig. 8 is the tetrahedral PAGE phenograms of Aptamer3-AS1411-DNA.5 refer to DNA tetrahedrons, and 4 refer to
Aptamer1-DNA tetrahedrons, 3, which refer to Aptamer1-DNA tetrahedrons, connects an AS1411, and 2 refer to Aptamer1-DNA tetra-
Face body connects two AS1411, and 1, which refers to Aptamer1-DNA tetrahedrons, connects three AS1411.
Fig. 9 is serum stability evaluation result.
Intake of Figure 10 nasopharyngeal carcinoma 5-8F cells to medicine-carried system.
Figure 11 Flow cytometries enter born of the same parents' efficiency (Aptamer2-AS1411-DNA tetrahedrons medicine-carried system).
Figure 12 Flow cytometries enter born of the same parents' efficiency (Aptamer3-AS1411-DNA tetrahedrons medicine-carried system).
(Aptamer1-AS1411-DNA tetrahedrons carry medicine to the born of the same parents' efficiency that enters of Figure 13 Flow cytometry NIH3T3 cells
System.
(Aptamer2-AS1411-DNA tetrahedrons carry medicine to the born of the same parents' efficiency that enters of Figure 14 Flow cytometry NIH3T3 cells
System).
(Aptamer3-AS1411-DNA tetrahedrons carry medicine to the born of the same parents' efficiency that enters of Figure 15 Flow cytometry NIH3T3 cells
System).
Figure 16 fluorescence microscopes are detected into born of the same parents' efficiency (Aptamer1-AS1411-DNA tetrahedrons medicine-carried system).
Figure 17 fluorescence microscopes are detected into born of the same parents' efficiency (Aptamer2-AS1411-DNA tetrahedrons medicine-carried system).
Figure 18 fluorescence microscopes are detected into born of the same parents' efficiency (Aptamer3-AS1411-DNA tetrahedrons medicine-carried system).
Figure 19 .CCK8 experiment detection cell propagation (Aptamer1-AS1411-DNA tetrahedrons medicine-carried system).
Figure 20 .CCK8 experiment detection cell propagation (Aptamer2-AS1411-DNA tetrahedrons medicine-carried system).
Figure 21 .CCK8 experiment detection cell propagation (Aptamer3-AS1411-DNA tetrahedrons medicine-carried system).
Embodiment
Embodiment 1
Instrument and equipment
Cell line
Human nasopharyngeal carcinoma cell line SUNE-1 5-8F, are purchased from Zhongshan University's cell bank.
Main agents
DNA sequence dna is purchased from Shanghai Sheng Gong biotinylated biomolecules Engineering Co., Ltd, and purifying rank is ULTRAPAGE or HPLC,
DNA sequence dna is shown in Table 1.
Table 1DNA sequences
Note：* decorating site is referred to
1) the liquid medium Gibco of RPMI 1640, the U.S.
2) hyclone Gibco, the U.S.
3) pancreatin Gibco, the U.S.
4) CCK-8 kits Suo Laibao (Solarbio), China
5) PBS pulvis Google biology, China
6) sough (DMSO) Sigma for dimethyl Asia, the U.S.
7) the green skies of Ripa lysates, China
8) Tris-base Suo Laibao (Solarbio), China
9)MgCl2·5H2O Biosharp, China
10) benzyl penicillin ibco, the U.S.
11) streptomysin Gibco, the U.S.
12) gel reagent preparation box doctor's moral, China
13) TEMED Sigma, the U.S.
14) acrylamide Biosharp, China
15) methylene diacrylamide Biosharp, China
16) ethidium bromide (EB) Google biology, China
17) glycine Biosharp, China
18) boric acid Suo Laibao (Solarbio), China
19) paranuclein antibody (Western Blot) Abcam, Britain
20) paranuclein antibody (streaming) Abcam, Britain
21) the goat anti-rabbit igg Google biology of HRP marks, China
22) EDTA Biosharp, China
23) formaldehyde Chemical Reagent Co., Ltd., Sinopharm Group, China
24) pvdf membrane Google biology, China
The preparation of reagent
1) complete culture solutions of RPMI 1640：Dual anti-(the penicillin of culture medium+10%FBS+ of 90%RPMI 1640
100units/ml, the μ g/ml of streptomysin 100)
2) 1640 endless full nutrient solutions of RPMI：100%DMEM/F12 (1:1) culture medium+10ng/ml bFGF+20ng/ml
EGF+5 μ g/ml Isulin+ dual anti-(penicillin 200units/ml, the μ g/ml of streptomysin 200)
3) phosphate buffer (PBS, pH7.4)
PBS powder being placed in the beaker for filling 200m cell water, magnetic bead stirring is completely dissolved it, obtain 10 ×
Storing liquid, 10 times are diluted with water with cell again using preceding, obtain working solution (1x), autoclave sterilization sterilizing, be positioned over 4 DEG C of refrigerators
In, save backup；
4) cells frozen storing liquid：DMSO：FBS：Liquid medium=1 of RPMI 1640：2：7, i.e., with i.e. use.
5) cell washing lotion：Liquid medium+the 2%FBS+ of 98%RPMI 1640 dual anti-(penicillin 100units/ml, streptomysin
100μg/ml)
6) cell collection liquid：Liquid medium+the 20%FBS+ of 80%RPMI 1640 dual anti-(penicillin 100units/ml, chain
The μ g/ml of mycin 100)
7) TM buffer solutions
The Tris-Base powder and MgCl purchased2·5H2O powder is dissolved in the clean beaker for filling 10mL cell water
In, after it is completely dissolved, it is placed in 4 DEG C of refrigerators and saves backup.
8) TBE (5 ×) solution
The Tris-Base powder (54g), boric acid (27.5g) and the EDTA (3.72g) that purchase are dissolved in 1L deionized water
In, after it is completely dissolved, room temperature preservation is standby.
9) electrophoresis liquid buffer solution：Tris-base 1.515g
Glycine 9.385g
SDS 0.5g
Add distilled water to 500ml, room temperature preservation after dissolving；
10) transferring film buffer solution：Tris-base 1.5g
Glycine 7.2g
Methanol 100ml
Add distilled water to 500ml, room temperature preservation after dissolving；
11) TBS (Tris-HCl buffer salt solutions) buffer solution：The TBS powder purchased is placed in clean beaker, magnetic bead stirs
Mixing makes it be dissolved in 200ml distilled water, obtains storing liquid (10 ×), room temperature preservation.Use 10 times of distilled water diluting again before use,
Obtain working solution (1 ×)；
12)TBST：0.5ml polysorbas20 is added in 0.5L TBS buffer solutions (1 ×), shaken up.I.e. with i.e. use.
13) 30%N, N- methylene-bisacrylamide (37.5:1):Electronic balance weighs the double acryloyls of acrylamide, methene
Amine each 29.221g and 0.779g, add in the beaker for filling 90mL deionized waters.Magnetic stirrer about 30min (lucifuge),
After its mixing, deionized water is settled to 100mL.And continue magnetic stirrer and stay overnight, until liquid is clarified.4 DEG C of lucifuge
Refrigerator preserves.
14) Native-PAGE non-denaturing polyacrylamide gels：It will be cleaned with the glass plate clear water needed for glue, distilled water punching
Wash for several times.After hair dryer drying, installation.It is formulated with glue as follows：Distilled water 4.7mL, 30%N, N- methylene-bisacrylamides
(37.5：1) 1.25mL, TBE (5 ×) 1.5mL, ammonium persulfate (AP) 55uL and TEMED 5uL are added in 50mL centrifuge tubes, whirlpool
Rotation vibration is until fully mix.Liquid glue is slowly added to (avoid gas as far as possible from glass plate side using sample injector
Bubble) until fill it up with, insert comb.Treat that 30min or so solidifies completely, can proper extension setting time as room temperature is relatively low.
15) separation gel formula：Water 4.6mL, 30% acrylamide 2.7mL, 1.5mol/L Tris (pH8.8) 2.5mL,
10%SDS 100uL, 10% ammonium persulfate 100uL and TEMED 6uL.
16) glue formula is concentrated：Water 2.1mL, 30% acrylamide 500uL, 1.5mol/L Tris (pH6.8) 380mL,
10%SDS 30uL, 10% ammonium persulfate 30uL and TEMED3uL.
The structure and molecular dynamics simulation of computation model
The molecular model of three aptamers with complementary arm chain of manual construction, and using Z-DOCK method
By itself and CD44 albumen (PDB ID：Molecular docking 2JCQ.pdb) is carried out, finally obtains three aptamer-CD44 compounds
Molecular model.Then, molecular dynamics simulation is carried out to three complex models of structure.Idiographic flow is as follows：
First, using above-mentioned three initial configurations built of the software processings of Discovery Studio 2.5, by albumen
The amino acid lacked in structure and atom completion, then using the structure evaluation module in software to the albumen and core in compound
Sour structure is checked, it is ensured that the correctness of composite structure, finally using the leap module constructions three in AMBER11 software kits
The individual initial configuration for molecular dynamics simulation.
Molecular dynamics simulation is using the Sander programs in AMBER11.The initial configuration handled well is immersedIn the periodicity octahedron water tank of thickness-and TIP3P moisture submodels are used, then add counter ion counterionsl gegenions (K+), with
Make whole system in neutrality.Use firstForce constant limits the molecular position of initial model, to counter ion counterionsl gegenions
Geometric hash (500 step) is carried out with steepest descent method and conjugate gradient method respectively with hydrone, to eliminate irrational original
Subspace arranges；Then force constant limitation is cancelled, to whole composite structure, hydrone and K+It is excellent that system carries out structure respectively
Change：Steepest descent method (1000 step) and conjugate gradient method (1500 step)；Next useForce constant limitation is just
Beginning structure, the Molecular Dynamics Calculation (20ps) that solvent molecule is carried out is decontroled completely, including (100K delays 1.0ps temperature-rise period
Slowly rise to 300K) and 19.0ps thermostatic process (300K)；Finally we carry out constant temperature (300K) constant pressure to whole system
(1atm) molecular dynamics simulation, the simulated time of all compounds is 10.0ns.In all simulation processes, use
PME methods handle long-range electrostatic interaction, and Van der Waals interaction cutoff value is arranged toThe processing of hydrogen atom key is adopted
With SHAKE algorithms, integration step 2.0fs.A data acquisition is carried out per 2.0ps, is analyzed for subsequent result.
5-8F cell culture, passage, freezing and recovery
1) cell culture：Human nasopharyngeal carcinoma cell line SUNE-1 5-8F are cultivated containing the dual anti-(penicillin of 10%FBS+
100units/ml, the μ g/ml of streptomysin 100) RPMI1640 complete mediums in.After sorting, part CD44+Cell culture exists
The EGF+5 μ g/ml of bFGF+20ng/ml containing 10ng/ml insulin+ dual anti-(penicillin 200units/ml, the μ g/ of streptomysin 100
Ml) in the culture mediums of RPMI 1640.It is placed in and contains 5%CO2, temperature is 37 DEG C of incubator, changes a subculture within every 1~2 day；
Passed on according to cell density accutase enzymic digestions, passed on 1 time every 1~2 day.Experiment is using thin in exponential phase
Born of the same parents.
2) passage of cell：SUNE-1 5-8F cells are adherent growth type, when cell density reaches 85% or so degrees of fusion
When, old culture medium is discarded, PBS liquid washing cell 1~2 time, the 0.25% trypsase -0.02%EDTA for adding 37 DEG C of preheatings disappears
Change liquid 1.0ml, gently rotate blake bottle, make digestive juice confluent cultures bottom of bottle.In micro- Microscopic observation cellular morphology, when cell is received
Contracting becomes bowlder and suctions out digestive juice, adds 4~5ml fresh cultures and stops digestion, blows and beats 10~20 times repeatedly, form it into list
Cell suspension, it is evenly distributed in 2~3 blake bottles and completes passage.
3) cell freezes：The cell that state is good is taken, in changing liquid in 24h.Vitellophag, 1500rpm, centrifugation 5min are collected
Cell, the cells frozen storing liquid now matched somebody with somebody is added, cell is resuspended.The suspension for drawing 1ml is dispensed to 1.5ml through autoclaved cryopreservation tube
In, seal and record (Cell Name and freeze the time).4 DEG C of 30min, -20 DEG C of 60min are placed in, then are transferred to -80 DEG C, are finally moved
Enter in liquid nitrogen container and preserve for a long time.
4) recovery of cell：Thermostat water bath is preheated to 37 DEG C, cell cryopreservation tube is taken from -80 DEG C of refrigerators or liquid nitrogen
Go out, insert in water-bath rapidly, melt its quick-thawing in 1min.Centrifuge (1800rpm, 5min), careful inhale abandons supernatant
Liquid, the nutrient solution of 37 DEG C of pre-temperatures of 1ml is added dropwise and blows and beats into being transferred in blake bottle after suspension, supplemented medium to 5~6ml, and
Blown with dropper even, be placed in 37 DEG C, 5%CO2Cultivated in saturated humidity incubator.Cell state is observed, in 24h after cell attachment
Give and change liquid, hereafter cultivate according to a conventional method.
The culture of NIH/3T3 mouse embryo cells, passage
Culture
By the NIH/3T3 cell culture purchased containing 10%FBS+ dual anti-(penicillin 100units/mL, streptomysin
In DMEM complete mediums 100ug/mL).Using disposable Tissue Culture Flask (specification：25cm2) incubated to be placed in
Case (37 DEG C, 5% concentration C O2) in cultivate.In cell cultivation process, liquid is changed once every 24h.If cell fusion degree is more than 85%
When, passed on after should being digested in time using the pancreatin of 0.25% concentration.
Passage
1) inhale and abandon culture medium, and reshuffled using PBS.
2) 1mL pancreatin digestive juices are added, is placed in after being incubated about 1 minute in constant incubator and is inverted fiber Microscopic observation.If
Cell retraction be rounded, pat side blake bottle bottle wall it is tear-away when, i.e., digestion complete.Now trained completely because adding 5mL in time
Support base and terminate digestion.
3) cell suspension is collected into centrifugation (1000rpm/5min) in centrifuge tube, supernatant is abandoned after centrifugation.It is and complete with 1mL
Cell is resuspended in full culture medium.
4) cell suspension being resuspended, which can be sub-packed in 2 blake bottles, is passed on, and can be used for freezing.
The tetrahedral synthesis of DNA
S1, S2, S3, S4, S5 and S6 of equimolar concentration are mixed in TM buffer solutions, is placed in PCR instrument and is heated to 95 DEG C
10min is denatured, then drops to 4 DEG C rapidly, you can obtains DNA tetrahedral structures.
The tetrahedral synthesis of Aptamer-DNA
Aptamer, S1, S2, S3, S4, S5 and S6 of equimolar concentration are mixed in TM buffer solutions, is placed in PCR instrument
95 DEG C of denaturation 10min are heated to, then drop to 4 DEG C rapidly, you can obtain three kinds of aptamer-DNA tetrahedral structures
(Aptamer1-DNA tetrahedrons, Aptamer2-DNA tetrahedrons and Aptamer3-DNA tetrahedrons).
The tetrahedral synthesis of Aptamer-AS1411-DNA
The aptamer of mixing equimolar concentration, S1, S2, S3, S4, S5, S6 and three in TM buffer solutions
AS1411 molecules, it is placed in PCR instrument and is heated to 95 DEG C of denaturation 10min, then drop to 4 DEG C rapidly, you can obtains three kinds while carry
The DNA tetrahedral structures of aptamer and AS1411
(Aptamer1-AS1411-DNA tetrahedrons, Aptamer2-AS1411-DNA tetrahedrons and Aptamer3-
AS1411-DNA tetrahedrons).
Structural characterization
The various structures of above-mentioned synthesis are identified using 5% native polyacrylamide gel electrophoresis (PAGE).
Prepare 5% PAGE separation gels (30%Acr-Bis, 1.25mL；Ultra-pure water 4.7mL；5 × tbe buffer liquid, 1.5mL；10%
APS, 55uL；TEMED, 5 μ L), it is placed in after gelling is good in 1 × tbe buffer liquid, the sample of above-mentioned synthesis is delayed with 6 × loading
Fliud flushing presses volume 5:1 is well mixed, loading, 100V electrophoresis 90min, adds EB dyeing 30min, be placed in gel imager into
Picture.
Serum stability experiment
By AS1411, DNA tetrahedron and the DNA tetrahedral structures and hyclone of various modifications by volume 9:1
Ratio mixes, and is incubated 0h, 2h, 4h, 6h, 8h and 24h respectively in 37 DEG C of incubators, and pass through non-denaturing polyacrylamide gel electricity
Swim and Structural Identification is carried out to the degraded situation of the various structures after incubation.
Fluorescence microscope is detected into born of the same parents' efficiency
1) plate is planted：Selection form is preferable, the 5-8F cells in exponential phase, after being digested using pancreatin digestive juice
The suspension of individual cells is made.With 1 × 104/ hole is planted in 24 orifice plates, and addition 2mL RPMI 1640 is complete in every hole
Culture medium.It is placed in 5%CO212h is cultivated in concentration, 37 DEG C of constant incubator.
2) synthesize：Take out DNA dry powder S1 (FITC), S2, S3, S4, S5, S6, Aptamer1, Aptamer2, Aptamer3,
AS1411 (1), AS1411 (2) and each one of AS1411 (3).Working solution is prepared according to above method and is closed using round pcr
Into Aptamer1-AS1411-DNA tetrahedrons, Aptamer2-AS1411-DNA tetrahedrons (FITC), Aptamer3-AS1411-
DNA tetrahedrons, AS1411+DNA tetrahedrons.After the completion of to be synthesized, with the blank cultures without serum by each group concentration dilution
For 0.5uM.
3) it is incubated：24 orifice plates are taken out, after culture medium is abandoned in suction, PBS flushes three times.The fluorescence medicine of synthesis by more than
Thing is made an addition in corresponding hole, is placed in 5%CO22h is incubated in concentration, 37 DEG C of constant incubator.
4) image is gathered：After the completion of being incubated after the completion of incubation, Tissue Culture Plate is taken out.Vacuum extractor in superclean bench
Liquid is abandoned in suction, after PBS is flushed three times, is moved under fluorescence inverted microscope and is observed.The visual field of target is found in light field first, will
Focus adjustment is to clear, and picture when gathering light field this moment.Light is then turned off, excitation source is opened, is seen in details in a play not acted out on stage, but told through dialogues
The green fluorescence in the same visual field is examined, and gathers the details in a play not acted out on stage, but told through dialogues picture being collected into.According to above method, each group light field figure is gathered respectively
Piece and details in a play not acted out on stage, but told through dialogues picture.
Flow cytometry target drug-carrying system enters born of the same parents' efficiency
Prime minister, the cell in logarithmic phase is digested with 0.25% pancreatin, single cell suspension is made,
With every hole 1 × 105Individual cell is inoculated in 24 well culture plates, after inoculation, by 24 well culture plates be placed in 37 DEG C,
5%CO2Constant incubator in cultivate 24h.After cultivating 24h, the old culture medium in culture plate is discarded, is washed 3 times with PBS, by S1
The each group composite structure marked on chain is incubated 2h altogether with 0.5 μM of final concentration and cell.Culture is terminated, discards culture medium,
Cleaned 3 times using PBS solution, the digestion of 0.25% pancreatin, collect cell, analyzed with flow cytometer.
CCK8 experiment detection cell propagation
First, the nasopharyngeal carcinoma 5-8F cells in exponential phase are chosen, by cell with 1 × 104Individual/hole is layered on 96 orifice plates
In, after culture 24 hours, old culture medium is removed, with PBS 3 times.By each group by 0.75 μM, 0.5 μM, 0.1 μM and 0 μM
Final concentration co-cultures 72h with cell in 96 orifice plates respectively.It is placed in and contains 5%CO2, temperature be to be cultivated in 37 DEG C of culture, according to
The color of culture medium changes liquid in good time.After cultivating 72h, 100 μ l CCK-8 are added respectively at every hole, and 2h is incubated in incubator,
The absorbance A value at 450nm finally is detected with ELIASA, to observe the survival rate of cell.
Statistical analysis
The statistics of data is carried out using statistics software GraphPad Prism 5, two sample datas use two independent samples
T is examined, and the multigroup variance analysis compared using single factor test repeated measurement data, measurement data uses mean (mean) ± standard
Poor (standard deviation, SD) is represented, inspection level α=0.05, P<0.05 is with significant difference.
The design, preparation and sign " Aptamer-AS1411- of " Aptamer-AS1411-DNA tetrahedrons " medicine-carried system
The design of DNA tetrahedrons " medicine-carried system
Aptamer1-CD44 molecular complex structural models
In this research work, our models of the Aptamer1-CD44 complex molecules to structure have carried out 10ns point
Subdynamics is simulated.The RMSD values of compound and the relation curve of simulated time is shown in Fig. 1.As seen from the figure：In beginning
Slowly rise in 5ns simulated times, after 5ns, system enters balance, and RMSD is maintainedIn addition, average structure is analyzed
Also indicate that Aptamer1 and CD44 molecules can form stable composite structure.
Aptamer2-CD44 molecular complex structural models
In this research work, our models of the Aptamer2-CD44 complex molecules to structure have carried out 10ns point
Subdynamics is simulated.The RMSD values of compound and the relation curve of simulated time is shown in Fig. 2.As seen from the figure：In beginning
Slowly rise in 7ns simulated times, after 7ns, system enters balance, and RMSD is maintainedIn addition, average structure is analyzed
Also indicate that Aptamer2 and CD44 molecules can form stable composite structure.
Aptamer3-CD44 molecular complex structural models
In this research work, our models of the Aptamer3-CD44 complex molecules to structure have carried out 10ns point
Subdynamics is simulated.The RMSD values of compound and the relation curve of simulated time is shown in Fig. 3.As shown in Figure 4：In beginning
Rise rapidly in 2ns simulated times, after 2ns, system enters balance, and RMSD is maintainedIn addition, average structure is analyzed
Also indicate that Aptamer3 and CD44 molecules can form stable composite structure.
The synthesis identification of " Aptamer-AS1411-DNA tetrahedrons " medicine-carried system
DNA tetrahedrons synthesize
Using PCR method by 6 single-stranded DNAs, DNA tetrahedron knots are assembled into a manner of base pair complementarity
Structure.By the tetrahedral structures of the DNA formed are more special, conventional Marker can not be marked accurately, so we take
Nucleic acid chains are incremented by one by one, the mode that is mutually authenticated.PAGE qualification results are as shown in Figure 4：With the increase of nucleic acid chains number, divide
Son amount significantly increases, and band is single, and these results show that we have successfully synthesized DNA tetrahedral structures.
The synthesis identification of Aptamer-DNA tetrahedrons
Aptamer modification the tetrahedral building-up processes of DNA in we by three kinds of Aptamer respectively with base pair complementarity
Mode be connected on DNA tetrahedrons.PAGE qualification results are as shown in Figure 5：For DNA tetrahedrons, 2-4 is represented respectively 1 Dow Jones index respectively
The structure of an aptamer is connected to, relative with 1, molecular weight significantly increases, and band is single, and these results show me
Successfully synthesized three kinds of DNA tetrahedral structures for being respectively provided with an aptamer.
The synthesis identification of Aptamer-AS1411-DNA tetrahedrons
The synthesis identification of Aptamer1-AS1411-DNA tetrahedrons
On the basis of previous experiments, we are by Aptamer1 and three AS1411 in a manner of base pair complementarity
It is connected on DNA tetrahedrons, is identified with PAGE simultaneously.As a result it is as shown in Figure 6：3rd, 4 and 5 represent respectively be connected with one,
Two and three AS1411 Aptamer1-DNA tetrahedrons, with 1 DNA tetrahedrons and 2 Aptamer1-DNA tetrahedrons
Compare, molecular weight is different incremented by successively with connection AS1411 numbers, and band is single, it was demonstrated that we have successfully been obtained
Aptamer1 and three AS1411 medicine-carried system is connected with simultaneously.
The synthesis identification of Aptamer2-AS1411-DNA tetrahedrons
On the basis of previous experiments, we are by Aptamer2 and three AS1411 in a manner of base pair complementarity
It is connected on DNA tetrahedrons, is identified with PAGE simultaneously.As a result it is as shown in Figure 7：3rd, 2 and 1 represent respectively be connected with one,
Two and three AS1411 Aptamer2-DNA tetrahedrons, with 5 DNA tetrahedrons and 4 Aptamer2-DNA tetrahedrons
Compare, molecular weight is different incremented by successively with connection AS1411 numbers, and band is single, it was demonstrated that we have successfully been obtained
Aptamer2 and three AS1411 medicine-carried system is connected with simultaneously.
The synthesis identification of Aptamer3-AS1411-DNA tetrahedrons
On the basis of previous experiments, we are by Aptamer3 and three AS1411 in a manner of base pair complementarity
It is connected on DNA tetrahedrons, is identified with PAGE simultaneously.As a result it is as shown in Figure 8：3rd, 2 and 1 represent respectively be connected with one,
Two and three AS1411 Aptamer3-DNA tetrahedrons, with 5 DNA tetrahedrons and 4 Aptamer3-DNA tetrahedrons
Compare, molecular weight is different incremented by successively with connection AS1411 numbers, and band is single, it was demonstrated that we have successfully been obtained
Aptamer3 and three AS1411 medicine-carried system is connected with simultaneously.
The application study serum in nasopharyngeal carcinoma targeted therapy of " Aptamer-AS1411-DNA tetrahedrons " medicine-carried system
Estimation of stability
Nucleic acid class formation is easy to be degraded by internal nuclease, in order to investigate the target drug-carrying system in this research work
Structural stability in physiological environment, it is total to by we in testing in vitro with 10% serum in the environment of 37 DEG C
It is incubated, and the stability of these structures is identified by PAGE respectively at different time points.Test result indicates that containing 10% blood
In clear solution, three kinds of medicine-carried systems can be stabilized 8 hours；DNA tetrahedrons can be stabilized 4 hours；Individually
AS1411 molecules are only capable of being stabilized 2 hours, and after AS1411 and 10% serum act on 6 hours altogether, structure is all degraded；24 is small
The structure of Shi Hou, DNA tetrahedron and three kinds of medicine-carried systems is substantially all to be degraded (Fig. 9).
Flow cytometry enters born of the same parents' efficiency
In order to verify whether the target drug-carrying system designed in this research work has targeting, we are carried out in vitro
Intake experiment of the nasopharyngeal carcinoma cell to target drug-carrying system.First, we will be marked with the Aptamer1- of Cy5 fluorescence molecules
AS1411-DNA tetrahedrons carry out common incubation with 5-8F cells, and flow cytomery intracellular Fluorescence amount is used after being incubated 2 hours.
Testing result shows, after being incubated 2h altogether, is modified with Aptamer1 medicine-carried system and unmodified Aptamer1 AS1411-DNA
Tetrahedron is compared, and fluorescence volume dramatically increases, (Figure 10).
In order to verify whether the target drug-carrying system designed in this research work has targeting, we are carried out in vitro
Intake experiment of the nasopharyngeal carcinoma cell to target drug-carrying system.First, we will be marked with the Aptamer2- of Cy5 fluorescence molecules
AS1411-DNA tetrahedrons carry out common incubation with 5-8F cells, and flow cytomery intracellular Fluorescence amount is used after being incubated 2 hours.
Testing result shows, after being incubated 2h altogether, is modified with Aptamer2 medicine-carried system and unmodified Aptamer2 AS1411-DNA
Tetrahedron is compared, and fluorescence volume dramatically increases, (Figure 11).
In order to verify whether the target drug-carrying system designed in this research work has targeting, we are carried out in vitro
Intake experiment of the nasopharyngeal carcinoma cell to target drug-carrying system.First, we will be marked with the Aptamer3- of Cy5 fluorescence molecules
AS1411-DNA tetrahedrons carry out common incubation with 5-8F cells, and flow cytomery intracellular Fluorescence amount is used after being incubated 2 hours.
Testing result shows, after being incubated 2h altogether, is modified with Aptamer3 medicine-carried system and unmodified Aptamer3 AS1411-DNA
Tetrahedron is compared, and fluorescence volume dramatically increases, (Figure 12).
The purpose of target drug-carrying system designed in this research work, being capable of specific tumor cell surface
CD44 molecules, so as to avoid to the toxic side effect caused by the identification of normal cell.In order to verify designed target drug-carrying body
System is to CD44-Whether cell has certain targeting, and we have carried out NIH3T3 cells to target drug-carrying system in vitro
Intake experiment.First, we will be marked with the Aptamer1-AS1411-DNA tetrahedrons and NIH3T3 cells of Cy5 fluorescence molecules
Common incubation is carried out, flow cytomery intracellular Fluorescence amount is used after being incubated 2 hours.Testing result shows, after being incubated 2h altogether, repaiies
Aptamer1 medicine-carried system is decorated with compared with unmodified Aptamer1 AS1411-DNA tetrahedrons, fluorescence volume has no obvious poor
Different (Figure 13).
In order to verify Aptamer2-AS1411-DNA tetrahedrons to CD44-Whether cell has certain targeting, we
Intake experiment of the NIH3T3 cells to target drug-carrying system has been carried out in vitro.First, we will be marked with Cy5 fluorescence molecules
Aptamer2-AS1411-DNA tetrahedrons carry out common incubation with NIH3T3 cells, thin with flow cytomery after being incubated 2 hours
Intracellular fluorescence volume.Testing result shows, after being incubated 2h altogether, is modified with Aptamer2 medicine-carried system with unmodified Aptamer2's
AS1411-DNA tetrahedrons are compared, fluorescence volume and no significant difference (Figure 14).
In order to verify Aptamer3-AS1411-DNA tetrahedrons to CD44-Whether cell has certain targeting, we
Intake experiment of the NIH3T3 cells to target drug-carrying system has been carried out in vitro.First, we will be marked with Cy5 fluorescence molecules
Aptamer3-AS1411-DNA tetrahedrons carry out common incubation with NIH3T3 cells, thin with flow cytomery after being incubated 2 hours
Intracellular fluorescence volume.Testing result shows, after being incubated 2h altogether, is modified with Aptamer2 medicine-carried system with unmodified Aptamer3's
AS1411-DNA tetrahedrons are compared, fluorescence volume and no significant difference (Figure 15).
Fluorescence microscope is detected into born of the same parents' efficiency
In order to more intuitively observe 5-8F cells to the tetrahedral intake situations of Aptamer1-AS1411-DNA, Wo Menyong
Inverted fluorescence microscope observes Aptamer1-AS1411-DNA tetrahedrons and is incubated cell pair after 2 hours altogether with cell
The tetrahedral intake situations of Aptamer1-AS1411-DNA.As a result show：Unmodified Aptamer1 medicine-carried system enters 5-8F
Intracellular amount is considerably less, and Aptamer1-AS1411-DNA tetrahedrons enter the amount showed increased of 5-8F cells, these results
Show that Aptamer1-AS1411-DNA tetrahedrons can be intracellular into 5-8F with the help of Aptamer1, from cell aspect
On demonstrate Aptamer1-AS1411-DNA tetrahedrons and can target CD44+Nasopharyngeal carcinoma cell (Figure 16).
In order to more intuitively observe 5-8F cells to the tetrahedral intake situations of Aptamer2-AS1411-DNA, Wo Menyong
Inverted fluorescence microscope observes Aptamer2-AS1411-DNA tetrahedrons and is incubated cell pair after 2 hours altogether with cell
The tetrahedral intake situations of Aptamer2-AS1411-DNA.As a result show：Unmodified Aptamer2 medicine-carried system enters 5-8F
Intracellular amount is considerably less, and Aptamer2-AS1411-DNA tetrahedrons enter the amount showed increased of 5-8F cells, these results
Show that Aptamer2-AS1411-DNA tetrahedrons can be intracellular into 5-8F with the help of Aptamer2, from cell aspect
On demonstrate Aptamer2-AS1411-DNA tetrahedrons and can target CD44+Nasopharyngeal carcinoma cell (Figure 17).
In order to more intuitively observe 5-8F cells to the tetrahedral intake situations of Aptamer3-AS1411-DNA, Wo Menyong
Inverted fluorescence microscope observes Aptamer3-AS1411-DNA tetrahedrons and is incubated cell pair after 2 hours altogether with cell
The tetrahedral intake situations of Aptamer3-AS1411-DNA.As a result show：Unmodified Aptamer3 medicine-carried system enters 5-8F
Intracellular amount is considerably less, and Aptamer1-AS1411-DNA tetrahedrons enter the amount showed increased of 5-8F cells, these results
Show that Aptamer3-AS1411-DNA tetrahedrons can be intracellular into 5-8F with the help of Aptamer3, from cell aspect
On demonstrate Aptamer3-AS1411-DNA tetrahedrons and can target CD44+Nasopharyngeal carcinoma cell (Figure 18).
CCK8 experiment detection cell propagation
In order to verify that the Aptamer1-AS1411-DNA tetrahedrons designed and synthesized in this research work enter tumour cell
Afterwards, antitumor proliferation activity can be played, we are detected using CCK8 methods.Cell proliferation experiment result shows：Same
Deng under dosage, Aptamer1-AS1411-DNA tetrahedrons have the ability of certain killing tumor cell, and are in concentration
It is most obvious to the inhibitory action of tumour cell at 0.75 μM, there is certain dose dependent.DNA tetrahedrons group and
The multiplied ratio of Aptamer1-DNA tetrahedron groups is consistent with control group, and this shows for the material for carrying medicine in itself to cell
Propagation does not influence.Moreover, in independent AS1411 groups and AS1411-DNA tetrahedron groups, the ratio and control group of cell growth
Also there was no significant difference, and these results show Aptamer1-AS1411-DNA four sides physical efficiency by AS1411 targeted deliveries to tumour
In cell, so as to play antitumor activity (Figure 19).
In order to verify that the Aptamer2-AS1411-DNA tetrahedrons designed and synthesized in this research work enter tumour cell
Afterwards, antitumor proliferation activity can be played, we are detected using CCK8 methods.Cell proliferation experiment result shows：Same
Deng under dosage, Aptamer2-AS1411-DNA tetrahedrons have the ability of certain killing tumor cell, and are in concentration
It is most obvious to the inhibitory action of tumour cell at 0.75 μM, there is certain dose dependent.DNA tetrahedrons group and
The multiplied ratio of Aptamer2-DNA tetrahedron groups is consistent with control group, and this shows for the material for carrying medicine in itself to cell
Propagation does not influence.Moreover, in independent AS1411 groups and AS1411-DNA tetrahedron groups, the ratio and control group of cell growth
Also there was no significant difference, and these results show Aptamer2-AS1411-DNA four sides physical efficiency by AS1411 targeted deliveries to tumour
In cell, so as to play antitumor activity (Figure 20).
In order to verify that the Aptamer3-AS1411-DNA tetrahedrons designed and synthesized in this research work enter tumour cell
Afterwards, antitumor proliferation activity can be played, we are detected using CCK8 methods.Cell proliferation experiment result shows：Same
Deng under dosage, Aptamer3-AS1411-DNA tetrahedrons have the ability of certain killing tumor cell, and are in concentration
It is most obvious to the inhibitory action of tumour cell at 0.75 μM, there is certain dose dependent.DNA tetrahedrons group and
The multiplied ratio of Aptamer3-DNA tetrahedron groups is consistent with control group, and this shows for the material for carrying medicine in itself to cell
Propagation does not influence.Moreover, in independent AS1411 groups and AS1411-DNA tetrahedron groups, the ratio and control group of cell growth
Also there was no significant difference, and these results show Aptamer3-AS1411-DNA four sides physical efficiency by AS1411 targeted deliveries to tumour
In cell, so as to play antitumor activity (Figure 21).
In order to increase the targeting of medicine-carried system, it is that nano medicament carrying system is modified into target head to study maximally effective strategy at present
Molecule, the acceptor molecule of specific recognition tumor cell surface, by receptor-mediated endocytic pathway by drug molecule transport into
Born of the same parents.Come in this research from the aptamer modified DNA tetrahedrons for being capable of specific recognition tumor cell surface CD44 molecules
That improves target drug-carrying system enters born of the same parents' efficiency.In this paper, we will be marked with fluorescence molecule Cy5 three kinds of target drug-carrying systems
With CD44+Nasopharyngeal carcinoma 5-8F cells carry out common incubation, are incubated after 2h and detect intracellular Fluorescence amount with Flow cytometry.Experimental result
Show, the medicine-carried system for being modified with three kinds of aptamers is glimmering compared with the AS1411-DNA tetrahedrons of unmodified aptamer
Light quantity has conspicuousness increase, but cell is different to the intake of three kinds of medicine-carried systems, Aptamer1-AS1411-DNA tetrahedrons
Increased is most obvious.Our research finds that DNA tetrahedral structures can also enter cell, and closely three-dimensional is tied with it for this
Structure and special nano-scale have relation, and the mechanism that born of the same parents are entered now for it is not clear, but be connected to AS1411 molecules with
Afterwards, it enters born of the same parents' efficiency and significantly reduced, and this is probably because on the one hand three AS1411 of connection add the volume of molecule, is increased in addition
The negative electrical charge of system is added, has been unfavorable for into born of the same parents, and after connecting aptamer, then significantly increases into born of the same parents' efficiency.These experiments
As a result it is the aptamer specific recognition by CD44 also further to confirm target drug-carrying system designed in this research
CD44 molecules, and CD44 it is numerator mediated it is lower in swallow born of the same parents.And, it has been found that the intake of cell and core reported in the literature
The order of sour aptamers and CD44 affinity is consistent, accordingly it is concluded that the high aptamer of affinity is easier to exist
The mediation tripping in born of the same parents of CD44 molecules, conversely, entering the efficiency of born of the same parents can decrease.
Claims (10)
1. a kind of medicine-carried system of tetrahedral structure, it is characterised in that the structure of the medicine-carried system is Aptamer-AS1411-
DNA。
2. the medicine-carried system of the tetrahedral structure described in claim 1, it is characterised in that the structure of the medicine-carried system is
Aptamer1-AS1411-DNA, the structure of the medicine-carried system is that Aptamer1-AS1411-DNA is specifically with an Aptamer1
It is connected to simultaneously on DNA tetrahedrons in a manner of base pair complementarity with three AS1411.
3. the medicine-carried system of the tetrahedral structure described in claim 2, it is characterised in that described Aptamer1 is TGC*AG*
ATGC*A*AGGT*A*ACC*AT*ATCC*A*A*AGC*A*AATTGATCTATGATCGTACGAT；Three AS1411 are AS1411
(1), AS1411 (2), AS1411 (3), wherein, AS1411 (1) is specially
GGTGGTGGTGGTTGTGGTGGTGGTGGTCGGAATGCAATACGACTGTA；AS1411 (2) is specially
GGTGGTGGTGGTTGTGGTGGTGGTGGGAAAGCTTGTAGCTATAGTTA；AS1411 (3) is specially
GGTGGTGGTGGTTGTGGTGGTGGTGGAGTTAAACATCGCATGTGCTT。
4. the medicine-carried system of the tetrahedral structure described in claim 1, it is characterised in that the structure of the medicine-carried system is
Aptamer2-AS1411-DNA, the structure of the medicine-carried system is that Aptamer2-AS1411-DNA is specifically with an Aptamer2
It is connected to simultaneously on DNA tetrahedrons in a manner of base pair complementarity with three AS1411.
5. the medicine-carried system of the tetrahedral structure described in claim 4, it is characterised in that Aptamer2 TTGGG*ACGGTGTT*
A*A*ACG*A*A*AGGGG*ACG*ACATTGATCTATGATCGTACGAT；Three AS1411 are AS1411 (1), AS1411
(2), AS1411 (3), wherein, AS1411 (1) is specially
GGTGGTGGTGGTTGTGGTGGTGGTGGTCGGAATGCAATACGACTGTA；AS1411 (2) is specially
GGTGGTGGTGGTTGTGGTGGTGGTGGGAAAGCTTGTAGCTATAGTTA；AS1411 (3) is specially
GGTGGTGGTGGTTGTGGTGGTGGTGGAGTTAAACATCGCATGTGCTT。
6. the medicine-carried system of the tetrahedral structure described in claim 1, it is characterised in that the structure of the medicine-carried system is
Aptamer3-AS1411-DNA, the structure of the medicine-carried system is that Aptamer3-AS1411-DNA is specifically with an Aptamer3
It is connected to simultaneously on DNA tetrahedrons in a manner of base pair complementarity with three AS1411.
7. the medicine-carried system of the tetrahedral structure described in claim 6, it is characterised in that Aptamer3 GTCCC*A*
AGGCCTGC*A*AGGG*A*ACC*A*AGG*AC*AC*AGGACATTGATCTATGATCGTACGAT；Three AS1411 is
AS1411 (1), AS1411 (2), AS1411 (3), wherein, AS1411 (1) is specially
GGTGGTGGTGGTTGTGGTGGTGGTGGTCGGAATGCAATACGACTGTA；AS1411 (2) is specially
GGTGGTGGTGGTTGTGGTGGTGGTGGGAAAGCTTGTAGCTATAGTTA；AS1411 (3) is specially
GGTGGTGGTGGTTGTGGTGGTGGTGGAGTTAAACATCGCATGTGCTT。
8. the medicine-carried system of the tetrahedral structure described in claim any one of 1-7 answering on the medicine for preparing treatment nasopharyngeal carcinoma
With.
9. the application described in claim 8, it is characterised in that described nasopharyngeal carcinoma is to be directed to CD44+Nasopharyngeal carcinoma 5-8F cells.
10. the application described in claim 8, it is characterised in that the concentration of the medicine-carried system of described tetrahedral structure is 0.1 μ
M-1.0μM。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711157041.1A CN107715117B (en) | 2017-11-20 | 2017-11-20 | Medicine carrying system with tetrahedral structure and pharmaceutical application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711157041.1A CN107715117B (en) | 2017-11-20 | 2017-11-20 | Medicine carrying system with tetrahedral structure and pharmaceutical application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107715117A true CN107715117A (en) | 2018-02-23 |
| CN107715117B CN107715117B (en) | 2021-09-21 |
Family
ID=61217550
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711157041.1A Active CN107715117B (en) | 2017-11-20 | 2017-11-20 | Medicine carrying system with tetrahedral structure and pharmaceutical application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107715117B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112439078A (en) * | 2019-09-04 | 2021-03-05 | 四川大学 | Nano compound of DNA tetrahedron and temozolomide |
| CN113713118A (en) * | 2021-09-16 | 2021-11-30 | 泉州师范学院 | Establishment and synthesis method of double-targeting DNA nano drug-loaded complex |
| CN113730594A (en) * | 2021-09-16 | 2021-12-03 | 泉州师范学院 | Double-targeting DNA nano drug-loaded complex and pharmaceutical application thereof |
| CN113769107A (en) * | 2021-09-16 | 2021-12-10 | 泉州师范学院 | Preparation method and application of double-targeting DNA nano drug-loaded complex |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104711263A (en) * | 2015-01-09 | 2015-06-17 | 中南大学 | Sequence of aptamer used for targeting human nasopharyngeal carcinoma cell and application thereof |
-
2017
- 2017-11-20 CN CN201711157041.1A patent/CN107715117B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104711263A (en) * | 2015-01-09 | 2015-06-17 | 中南大学 | Sequence of aptamer used for targeting human nasopharyngeal carcinoma cell and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| ANOMA SOMASUNDERAM ET AL.: ""Combinatorial Selection of DNA Thioaptamers Targeted to the HA Binding Domain of Human CD44"", 《BIOCHEMISTRY》 * |
| PHAPANIN CHAROENPHOL ET AL.: ""Aptamer-Targeted DNA Nanostructures for Therapeutic Delivery"", 《MOLECULAR PHARMACEUTICS》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112439078A (en) * | 2019-09-04 | 2021-03-05 | 四川大学 | Nano compound of DNA tetrahedron and temozolomide |
| CN112439078B (en) * | 2019-09-04 | 2022-08-26 | 四川大学 | Nano compound of DNA tetrahedron and temozolomide |
| CN113713118A (en) * | 2021-09-16 | 2021-11-30 | 泉州师范学院 | Establishment and synthesis method of double-targeting DNA nano drug-loaded complex |
| CN113730594A (en) * | 2021-09-16 | 2021-12-03 | 泉州师范学院 | Double-targeting DNA nano drug-loaded complex and pharmaceutical application thereof |
| CN113769107A (en) * | 2021-09-16 | 2021-12-10 | 泉州师范学院 | Preparation method and application of double-targeting DNA nano drug-loaded complex |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107715117B (en) | 2021-09-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107929751A (en) | A kind of foundation of medicine-carried system and synthetic method | |
| CN107952078A (en) | The synthetic method and its new application of a kind of medicine-carried system | |
| CN107715117A (en) | The medicine-carried system and pharmaceutical applications of a kind of tetrahedral structure | |
| CN106177961A (en) | The application in preparing antitumor drug of VCP inhibitor and oncolytic virus | |
| US20210363529A1 (en) | RNAi nano-preparation, preparation method thereof and application thereof in TMV prevention and control | |
| CN104099301A (en) | Coxsackie virus A16 virus strain, uses of strain, vaccine and preparation method of vaccine | |
| CN106520764B (en) | A kind of nanometer-double-ring aptamers probe and its application | |
| US20190175499A1 (en) | Use of chlorogenic acid in preparing pharmaceuticals for treatment of lag-3-mediated disease | |
| CN102120768A (en) | Method for producing curative canine parvovirus virus monoclonal antibody by using bioreactor | |
| CN103436583A (en) | Method for producing therapeutic monoclonal antibody of canine distemper virus, product thereof and hybridoma cell | |
| CN104098652B (en) | A kind of polypeptide suppressing metastases and polypeptide complex, its preparation method and application thereof | |
| CN108277279A (en) | A kind of application of lncRNA in diagnosing and/or treating breast cancer | |
| CN103382460B (en) | Strain of Marek's disease virus vaccine strain, and separation and identification and application thereof | |
| CN103333858A (en) | Gleevec-resistant gastrointestinal stromal tumor cell line, method thereof, and nude mouse transplantation tumor model thereof | |
| CN102732484B (en) | Method for establishing human nasopharyngeal carcinoma tumor stem cell line | |
| CN106727623A (en) | Application of the Tang oligosaccharide in anti-avian leukosis virus preparation is prepared | |
| CN106029683A (en) | Polypeptide and polypeptide complex for suppressing tumor metastasis and treating leukemia as well as preparation method therefor and application thereof | |
| CN107281172A (en) | Application of the melbine in the medicine for preparing cervical carcinoma | |
| CN106282194B (en) | Breast cancer lines specific nucleic acid aptamers and its application in preparation detection, diagnosing and treating human breast carcinoma preparation | |
| CN103494803A (en) | New application of dehydrated andrographolide | |
| CN101928747A (en) | Application of E3 ubiquitin ligase CHIP in gliomatosis cerebri disease | |
| CN103160475B (en) | Enterovirus 71 type viral strain, its application, vaccine and preparation method | |
| CN110384680A (en) | A kind of temperature/pH responsiveness is double to carry medicine composite nanoparticle and its preparation method and application | |
| CN104606215B (en) | A kind of medicine for suppressing Enterovirus 71 | |
| CN107058213A (en) | A kind of rabbit normal cornea epithelial cell and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |