CN107699580A

CN107699580A - Application of the arabidopsis U1A genes in plant salt endurance is improved

Info

Publication number: CN107699580A
Application number: CN201711099442.6A
Authority: CN
Inventors: 郑军; 王振宇
Original assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2017-11-09
Filing date: 2017-11-09
Publication date: 2018-02-16
Anticipated expiration: 2037-11-09
Also published as: CN107699580B

Abstract

The invention provides application of the arabidopsis U1A genes in plant salt endurance is improved.The nucleotide sequence of the arabidopsis thaliana salt-tolerance gene U1A is as shown in SEQ ID NO.1, and the amino acid sequence of its encoding proteins is as shown in SEQ ID NO.2.First demonstration that arabidopsis U1A genes take part in the biological process of plant resistant salt stress, arabidopsis U1A genes are applied to cultivate salt-tolerant plant, and have a good application prospect as salt tolerant breeding technology field.

Description

Application of the arabidopsis U1A genes in plant salt endurance is improved

Technical field

The invention belongs to genetic engineering field, more particularly to a kind of arabidopsis U1A genes are in plant salt endurance is improved Using.

Background technology

The soil salinization is globalization problem, and substantial amounts of soil has occurred that salination, at present also more soils In saliferous process, salt stress oneself through turn into worldwide in influence agricultural production most important environment-stress because Son.Therefore, how to improve the salt tolerance of plant turns into the important research direction of researcher, therefore the resistance to alkali of clone plant Because, using these genes cultivate the important issue that new salt tolerant crop kind is current scientific research.

Scientists are ground to make internal disorder or usurp and have achieved larger progress in terms of carrying out plant salt tolerance using technique for gene engineering, gram Grand a large amount of salt-resistant related genes, and by these gene transferred plants, studied for Mechanisms of Salt Resistance.Experiment shows plant in itself Or the gene related to salt tolerant is transferred in crop in other biologies, can still be improved saline-alkaline tolerance.Therefore Land use models are planted Thing arabidopsis identification salt-resistant related gene is extremely important.At present, it is resistance to be found that some can significantly improve plant for oneself The gene of salt ability, but there is not been reported for the effect about U1A genes during plant salt tolerance.

The content of the invention

It is an object of the invention to provide a kind of arabidopsis U1A genes and its application in plant salt endurance is improved.

The present invention obtains the first chain cDNA by synthesizing arabidopsis cDNA, extraction Arabidopsis leaf total serum IgE, reverse transcription, with Arabidopsis leaf cDNA is template, and primer (shown in SEQ ID NO.3-4) is designed according to U1A gene orders, enters performing PCR amplification, Recovery and purifying pcr amplification product, and be sequenced.Obtain arabidopsis U1A genes.

Arabidopsis U1A genes provided by the invention have the nucleotide sequence shown in (1) or (2)：

(1) nucleotide sequence shown in SEQ ID NO.1；

(2) nucleotide sequence shown in SEQ ID No.1 is substituted, lacks or added one or several nucleotides and formed The nucleotide sequence with equal function.

The amino acid sequence of the gene coded protein is：

(1) amino acid sequence shown in SEQ ID NO.2；

(2) amino acid sequence shown in SEQ ID No.2 is substituted, lacks or added one or several amino acid and formed The amino acid sequence as derived from (1) with equal function.

Expression vector, cell line, Host Strains containing above-mentioned arabidopsis U1A genes belong to protection scope of the present invention.

The invention provides application of the above-mentioned arabidopsis U1A genes in plant salt endurance is improved.

The invention provides application of the above-mentioned arabidopsis U1A genes in prepare transgenosis plant.

The invention provides application of the above-mentioned arabidopsis U1A genes in plant germplasm resource improvement.

The invention provides the primer that above-mentioned arabidopsis U1A genes are expanded for PCR, its nucleotide sequence such as SEQ ID Shown in NO.3-4.

Further, the invention provides a kind of method for cloning above-mentioned arabidopsis U1A genes, drawing used in this method Thing sequence is as shown in SEQ ID NO.3-4.

PCR reaction systems and amplification condition are shown in Table 1.Recovery and the concrete operations of purifying pcr amplification product are as follows：Gel electricity After swimming, the glue with purpose fragment is cut down with clean blade, is put into centrifuge tube, glue not cut it is too much, with DNA fragmentation solution during recovery is avoided to contain substantial amounts of impurity；QG solution (the volume/colloid of 3 times of volumes is added into centrifuge tube Amount) after, the warm bath 10min under the conditions of 50 DEG C, until glue melts completely；Solution in centrifuge tube is moved on in 2ml adsorption column, 1min is centrifuged, discards liquid phase；0.5ml QG solution is added into adsorption column again, 1min is centrifuged, discards liquid phase；To adsorption column 0.75ml PE solution is added, 1min is centrifuged, discards liquid phase；After centrifuging 1min again, by adsorption column be placed on one it is new from On heart pipe, 50 μ l lysate is added, 1min is stood, finally centrifuges 1min, obtained liquid phase is the DNA solution reclaimed.

The method with salt resistance ability genetically modified plants is prepared the invention provides a kind of, is in transgenic plant cells It is overexpressed arabidopsis U1A genes of the present invention.

The above-mentioned plant salt tolerance gene U1A of overexpression can be by accomplished in many ways, such as plant viral vector mediated gene The method of overexpression, agrobacterium mediation converted over-express vector, gene code is rectified and optimizes modification, to the gene promoter Optimize and realized with reaching the methods of being overexpressed effect.The method of overexpression gene of the present invention is not limited to above-mentioned several sides Method, as long as can overexpression U1A.

Make plant performance using any gene overexpression or the genetic modification method U1A for salt tolerance increase；Using appoint A kind of what carrier that foreign gene can be guided to be expressed in plant, U1A provided by the present invention is transferred in plant, plant is just Show higher salt tolerance.

The U1A genes of the present invention can be added before its transcription initiation nucleotides and appointed when being building up in plant expression vector A kind of what enhancing promoter or inducible promoter.For the ease of transgenic plant cells or plant are identified and screened, Used carrier can be processed, such as add the alternative mark (gus gene, luciferase genes) of plant or have The antibiotic marker (gentamicin, kanamycins etc.) of resistance.The plant host being converted both can be monocotyledon, Can be dicotyledon, such as：Tobacco, rice, wheat, corn, cucumber, tomato, willow, turfgrass or lucerne place etc..From turning base Because of the security consideration of plant, any selected marker can be not added with, transformed plant is directly screened with plant salt tolerance degree. Carrying the expression vector of U1A genes of the present invention can be turned by using Ti-plasmids, Ri plasmids, plant viral vector, direct DNA The conventional biology methods such as change, microinjection, conductance, agriculture bacillus mediated convert plant cell or tissue, and by the plant of conversion Through tissue cultivating into plant.

The plant splice GAP-associated protein GAP and its encoding gene of the present invention provides gene for crops especially salt tolerance breeding With the support of technology.The albumen of U1A gene codes of the present invention is mRNA precursor shear factor, may participate in plant MRNA shearing.The gene is overexpressed in arabidopsis can increase the salt tolerance of arabidopsis.Therefore described plant salt tolerance base Because U1A has broad application prospects in plant salt endurance breeding field, its economic efficient latent is huge.

Brief description of the drawings

Fig. 1 is the PCR primer electrophoretogram of amplification U1A genes.

Fig. 2A-Fig. 2 D be respectively embodiment 3 U1A mutant and arabidopsis wild type growth in normal MS culture mediums and salt Growing state on coercing cultivation base.Fig. 2A, the 4 -day-old small seedling for being grown on MS culture mediums are transplanted seedlings to containing 175mM sodium chloride Growth figure on MS culture mediums；Fig. 2 B are the survival rate of Fig. 2A statistics；Fig. 2 C are the seedling cast that 2 weeks sizes are grown in soil The growing state figure of 300mM sodium chloride solutions；Fig. 2 D are the survival rate of Fig. 2 C statistics.

Fig. 3 is the U1A gene complementation atu1a mutant salt stress phenotypes of embodiment 4.1,2,3 and 4 be U1A genes in figure It is transferred to 4 independent mutant complementation plant of atu1a mutant.

Fig. 4 A- Fig. 4 B are respectively that the U1A genes of embodiment 5 are overexpressed salt-tolerant phenotype in arabidopsis.Fig. 4 A, 4 days sizes It is grown on the growth representative graph that the seedling of MS culture mediums is transplanted seedlings on containing 175mM sodium chloride MS culture mediums；Fig. 4 B unite for Fig. 4 A The survival rate of meter.

Embodiment

Following examples are used to illustrate the present invention, but are not limited to the scope of the present invention.Without departing substantially from spirit of the invention In the case of essence, the modifications or substitutions made to the inventive method, step or condition belong to the scope of the present invention.

Unless otherwise specified, experiment material, reagent and instrument used in the embodiment of the present invention etc. are commercially available, if Do not particularly point out, the conventional meanses that technological means used is well known to the skilled person in embodiment.

The clone of the arabidopsis U1A genes of embodiment 1

1st, Arabidopsis leaf cDNA synthesizes：Arabidopsis leaf total serum IgE is extracted, reverse transcription obtains the first chain cDNA；

2nd, the PCR amplifications of U1A genes：Using Arabidopsis leaf cDNA as template, primer is designed according to U1A gene orders, entered Performing PCR expands, recovery and purifying pcr amplification product, and is sequenced.Primer is：

Forward primer：

5’-AAAAAAGCAGGCTTCATGGAGATGCAAGAGGCT-3’(SEQ ID NO.3)

Reverse primer：

5’-CAAGAAAGCTGGGTCTTTCTTGGCATACGTGAT-3’(SEQ ID NO.4)

PCR reaction systems and amplification condition such as table 1.

Table 1

Sequencing is delivered invitrogen companies and is sequenced.Recovery and the concrete operations of purifying pcr amplification product are as follows：It is solidifying After gel electrophoresis (see Fig. 1), the glue with purpose fragment is cut down with clean blade, is put into centrifuge tube, glue should not Cut it is too much, with avoid recovery when DNA fragmentation solution contain substantial amounts of impurity.The QG solution of 3 times of volumes is added into centrifuge tube After (volume/colloid amount), the warm bath 10min under the conditions of 50 DEG C, until glue melts completely；Solution in centrifuge tube is moved on into 2ml Adsorption column in, centrifuge 1min, discard liquid phase；0.5ml QG solution is added into adsorption column again, 1min is centrifuged, discards liquid Phase；0.75ml PE solution is added to adsorption column, 1min is centrifuged, discards liquid phase；After centrifuging 1min again, adsorption column is placed on On one new centrifuge tube, 50 μ l lysate is added, 1min is stood, finally centrifuges 1min, obtained liquid phase is what is reclaimed DNA solution.

The structure and the preparation method of genetically modified plants of the recombinant expression carrier of embodiment 2

1st, the structure of recombinant expression carrier

Primer is designed according to arabidopsis U1A gene orders, and the BP reactions in Gateway systems require, above-mentioned 5 ' GGGGACAAGTTTGTACAAAAAAGCAGGCTGC3 ' sequences are added before the forward primer of embodiment 1, it is anti-in above-described embodiment 1 Add 5 ' GGGGACCACTTTGTACAAGAAAGCTGGGTC3 ' sequences before to primer.PCR reactions are gathered using Phusion high-fidelities Synthase enters performing PCR clone.These fragments are cloned into pDONR-207 carriers by BP reactions (has purchased from silent winged your science and technology of generation of match Limit company) in, then reacted by LR and these fragments are cloned into respective purpose carrier respectively.

UsingTechnique construction carrier, its principle can be summarized as follows：

BP reacts：

(1) 8 μ l reaction system is prepared in 200 μ l centrifuge tubes, including：1~7 μ l attB-PCR products (about 15~ 150ng, concentration >=10ng/ μ l), 1 μ l pDONR carriers (150ng/ μ l) and appropriate TE buffer solutions (pH8.0), at room temperature Mix；

(2) by BP Clonase^TMII enzymatic mixtures are standing 2min thawings on ice, gently shake 2 times, mix stand-by；

(3) 2 μ l BP Clonase are added in the sample prepared to (1)^TMII enzymatic mixtures, lightly mix system；

(4) by BP Clonase^TMII enzymatic mixtures are put back into -20 DEG C or -80 DEG C preservations；

(5) reaction system is placed on 25 DEG C of warm bath 1h；

(6) 1 μ l Proteinase K Solution is added into reaction system, is gently shaken, sample is then placed on 37 DEG C of warm bath 10min, to terminate BP reactions；

(7) after mixed liquor being converted into Escherichia coli, transformed bacteria solution is taken to be coated on the LB flat boards containing gentamicin resistance, picking Bacterium culture is shaken in bacterium colony to culture medium solution containing corresponding antibiotic, the plasmid that positive colony is extracted after confirmation is standby.

LR reacts：

(1) 8 μ l reactant is prepared in 200 μ l centrifuge tubes, including：The pDONR-207 introductions of 1~2 μ l acquisition carry Purpose carrier pGWB514 (Nakagawa, T., Suzuki, T., the et al.Improved of constitution grain (50~150ng), 1 μ l Gateway binary vectors:high-performance vectors for creation of fusion constructs in transgenic analysis of plants.Bioscience,biotechnology,and biochemistry 71,2007:2095-2100) (150ng/ μ l) and appropriate TE buffer solutions (pH8.0), are mixed at room temperature It is even；

(2) by LR Clonase^TMII enzymatic mixtures rest on 2min thawings on ice, gently shake 2 times to mix；

(3) 2 μ l LR Clonase are added^TMII enzymatic mixtures, gently shake and mix system；

(4) by LR Clonase^TMII enzymatic mixtures are put back into -20 DEG C or -80 DEG C of refrigerators preserve；

(5) reaction system is placed on 25 DEG C of warm bath reaction 1h；

(6) 1 μ l Proteinase K Solution is added into reaction system to terminate LR reactions, after gently shaking, sample is placed on 37 DEG C of standing 10min；

(7) by coated plate, screening positive clone, extraction plasmid after LR reaction products conversion Escherichia coli, agriculture bar is then carried out The experiments such as bacterium conversion.

2nd, Agrobacterium-mediated Transformation：

1 μ g (200ng/ μ l) purpose plasmid is added in 100 μ l competence Agrobacteriums, stood after mixing on ice 5min, it is put into liquid nitrogen and freezes 5min, then taken out from liquid nitrogen, is put into water-bath 5min in 37 DEG C of water-baths, then it is quiet on ice After putting 5min, 500 μ l LB solution are added, the renewal cultivation 4h under the conditions of 28 DEG C, fully shaking, are finally uniformly smeared bacterium solution In on selective plating medium, 48h is cultivated at 28 DEG C.

3rd, transfer-gen plant is cultivated

The positive monoclonal Agrobacterium bacterium colony that picking converts to obtain into 5ml selectivity LB fluid nutrient mediums, 28 DEG C, It is incubated overnight under 200rpm, bacterium solution and selective LB fluid nutrient mediums are pressed 1 by next day:100 ratio mixes, and is cultivated at 28 DEG C, Terminated when bacterium solution OD=0.5.

Above-mentioned Agrobacterium bacterium solution is centrifuged under 5000rmp, after supernatant discarding, with 100ml5% sucrose and 0.5%L-77 Precipitation is resuspended in mixed solution, obtains Agrobacterium-mediated Transformation solution；The inflorescence that arabidopsis is bloomed is immersed in Agrobacterium-mediated Transformation solution, quiet 30sec is put, treated plant is wrapped up with black plastic bag, lucifuge 24h, polybag is then removed, cultivates under normal operation To maturation, seed is harvested.

4th, genetically modified plants are screened

The arabidopsis T0 that transgenosis is obtained after bleaching agent sterilizes, is seeded into containing 50mg/L hygromycin for seed On plating medium, resistance screening culture is carried out under dark condition, hypocotyl elongation situation, hypocotyl elongation are observed after 1 week Plant be positive transformants seedling；These positive transformants seedlings are transplanted in soil and cultivated, for extracting DNA.

Compared with the growth characteristics of the salt stress mutant of embodiment 3 and wild type under different salinity

Under condition of salt stress, the arabidopsis T-DNA obtained from TAIR websites (www.arabidopsis.org) is inserted prominent Variant is screened, obtain the mutant Salk_074230 sensitive to salt stress (Alonso, J.M., Stepanova, A.N., et al.Genome-wide insertional mutagenesis of Arabidopsis thaliana.Science 301,653-657.) mutant, is named as atu1a.WT lines and the mutant plants growing way on normal MS culture mediums It is identical, see Fig. 2, illustrate that (T-DNA sequences insertion U1A the 3rd extron of gene causes U1A gene expressions to lack for the gene mutation Lose) do not interfere with the normal growth and development process of plant.Wild type is grown in the MS of sodium chloride containing 175mM cultures with mutant plants When on base, mutant plants growing way is smaller than WT lines, sees Fig. 2A and 2B, on 175mM sodium chloride MS culture mediums Mutant plants show chlorosis phenomenon.Arabidopsis thaliana Seedlings are planted in soil, in normal soil, wild type and mutant plants Growing way is identical, and in the soil of 300mM salt stress, the survival rate of mutant is less than WT lines, sees Fig. 2 C and 2D.These As a result illustrate that U1A genes participate in plant salt tolerance process.

The arabidopsis U1A gene pairs Arabidopsis Mutants complementary function checking tests of embodiment 4

Complementation test is carried out to mutant Salk_074230, U1A genes are gone in mutant Salk_074230 plant, Obtain 4 independent mutant complementation plant.As a result find, wild type and mutant plants and 4 independent mutant complementations Plant strain growth growing way when on normal MS culture mediums is identical, and when be grown on 125mM sodium chloride MS culture mediums, dash forward Variant plant growing way is smaller than WT lines, but 4 complementary plant are identical with WT lines growing way, see Fig. 3.The experiment knot Fruit illustrates that U1A is participated in plant salt tolerance stress procedure.

The compliance test result test that the arabidopsis U1A genes of embodiment 5 are overexpressed in wildtype Arabidopsis thaliana

U1A gene transgenics are overexpressed into WT lines.Wild type and the plant of two overexpression U1A genes It is almost identical that strain (AtU1A OX1 and AtU1A OX2) is grown in growing way when on normal MS culture mediums.It is grown in 175mM chlorine When change on sodium MS culture mediums, it is overexpressed plant growing way and is substantially better than WT lines, be overexpressed the fresh weight more repeated root of plant Long longer while survival rate is higher.As a result Fig. 4 A- Fig. 4 B are seen, experimental result explanation is overexpressed U1A gene meetings in arabidopsis Improve the salt tolerance of plant.

Although above the present invention is made to retouch in detail with general explanation, embodiment and experiment State, but on the basis of the present invention, it can be made some modifications or improvements, this is apparent to those skilled in the art 's.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, are belonged to claimed Scope.

Sequence table

<110>Institute of Crop Science, Chinese Academy of Agricultural Science

<120>Application of the arabidopsis U1A genes in plant salt endurance is improved

<130> KHP171117397.7

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 753

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 1

atggagatgc aagaggctaa tcaaggagga ggatcggagg tttctccgaa tcagacgatt 60

tacatcaaca atctcaacga aaaagtgaag cttgatgagc tgaagaaatc gctgaatgca 120

gtgttctctc agttcgggaa gatactggag atattggcgt ttaagacctt taagcacaaa 180

ggacaagctt gggtagtctt cgacaacacc gagtctgctt ccactgctat tgctaaaatg 240

aataattttc ctttctacga caaggagatg agaatacaat atgccaaaac aaaatcagat 300

gttgttgcca aggccgatgg tacatttgtt cctcgcgaga agagaaagag acatgaggag 360

aaaggaggcg gcaagaaaaa gaaagaccag caccatgatt ctacacagat gggcatgccc 420

atgaactcag catatccagg tgtctatgga gctgcacctc ctctatcgca agtaccatac 480

cctggtggta tgaaacccaa tatgcccgag gcaccagctc cgccaaataa tattctcttt 540

gtccaaaacc ttcctcacga gacaactcca atggtgcttc agatgttgtt ctgccagtac 600

caaggattta aggaagttag aatgattgaa gccaaaccgg gaatcgcctt tgtggagttt 660

gctgatgaga tgcagtcgac ggtcgcaatg cagggacttc aaggtttcaa gattcagcaa 720

aaccagatgc tcatcacgta tgccaagaaa tag 753

<210> 2

<211> 250

<212> PRT

<213>Artificial sequence (Artificial Sequence)

<400> 2

Met Glu Met Gln Glu Ala Asn Gln Gly Gly Gly Ser Glu Val Ser Pro

1 5 10 15

Asn Gln Thr Ile Tyr Ile Asn Asn Leu Asn Glu Lys Val Lys Leu Asp

20 25 30

Glu Leu Lys Lys Ser Leu Asn Ala Val Phe Ser Gln Phe Gly Lys Ile

35 40 45

Leu Glu Ile Leu Ala Phe Lys Thr Phe Lys His Lys Gly Gln Ala Trp

50 55 60

Val Val Phe Asp Asn Thr Glu Ser Ala Ser Thr Ala Ile Ala Lys Met

65 70 75 80

Asn Asn Phe Pro Phe Tyr Asp Lys Glu Met Arg Ile Gln Tyr Ala Lys

85 90 95

Thr Lys Ser Asp Val Val Ala Lys Ala Asp Gly Thr Phe Val Pro Arg

100 105 110

Glu Lys Arg Lys Arg His Glu Glu Lys Gly Gly Gly Lys Lys Lys Lys

115 120 125

Asp Gln His His Asp Ser Thr Gln Met Gly Met Pro Met Asn Ser Ala

130 135 140

Tyr Pro Gly Val Tyr Gly Ala Ala Pro Pro Leu Ser Gln Val Pro Tyr

145 150 155 160

Pro Gly Gly Met Lys Pro Asn Met Pro Glu Ala Pro Ala Pro Pro Asn

165 170 175

Asn Ile Leu Phe Val Gln Asn Leu Pro His Glu Thr Thr Pro Met Val

180 185 190

Leu Gln Met Leu Phe Cys Gln Tyr Gln Gly Phe Lys Glu Val Arg Met

195 200 205

Ile Glu Ala Lys Pro Gly Ile Ala Phe Val Glu Phe Ala Asp Glu Met

210 215 220

Gln Ser Thr Val Ala Met Gln Gly Leu Gln Gly Phe Lys Ile Gln Gln

225 230 235 240

Asn Gln Met Leu Ile Thr Tyr Ala Lys Lys

245 250

<210> 3

<211> 33

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 3

aaaaaagcag gcttcatgga gatgcaagag gct 33

<210> 4

<211> 33

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 4

caagaaagct gggtctttct tggcatacgt gat 33

<210> 5

<211> 31

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 5

ggggacaagt ttgtacaaaa aagcaggctg c 31

<210> 6

<211> 30

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<400> 6

ggggaccact ttgtacaaga aagctgggtc 30

Claims

1. arabidopsis U1A genes, it is characterised in that the arabidopsis U1A genes have the nucleotide sequence shown in (1) or (2)：

(1) nucleotide sequence shown in SEQ ID NO.1；

(2) tool that the nucleotide sequence shown in SEQ ID No.1 was substituted, and lacked or added one or several nucleotides and formed There is the nucleotide sequence of equal function.

2. arabidopsis U1A genes as claimed in claim 1, it is characterised in that the amino acid sequence of the gene coded protein is：

(1) amino acid sequence shown in SEQ ID NO.2；

(2) tool that the amino acid sequence shown in SEQ ID No.2 was substituted, and lacked or added one or several amino acid and formed There is the sequence of equal function.

3. the expression vector containing the arabidopsis U1A genes described in claim 1 or 2.

4. the cell line containing the arabidopsis U1A genes described in claim 1 or 2.

5. the Host Strains containing the arabidopsis U1A genes described in claim 1 or 2.

6. application of the arabidopsis U1A genes in plant salt endurance is improved described in claim 1 or 2.

7. application of the arabidopsis U1A genes in prepare transgenosis plant described in claim 1 or 2.

8. application of the arabidopsis U1A genes in plant germplasm resource improvement described in claim 1 or 2.

9. the primer for the arabidopsis U1A genes described in PCR amplification claims 1 or 2, it is characterised in that its sequence such as SEQ Shown in ID NO.3-4.

10. a kind of prepare the method with salt resistance ability genetically modified plants, it is characterised in that table is crossed in transgenic plant cells Up to the arabidopsis U1A genes described in claim 1 or 2.