CN107699567A - A kind of Araneus ventricosus parcel silk-fibroin full-length gene and preparation method thereof - Google Patents
A kind of Araneus ventricosus parcel silk-fibroin full-length gene and preparation method thereof Download PDFInfo
- Publication number
- CN107699567A CN107699567A CN201711024721.6A CN201711024721A CN107699567A CN 107699567 A CN107699567 A CN 107699567A CN 201711024721 A CN201711024721 A CN 201711024721A CN 107699567 A CN107699567 A CN 107699567A
- Authority
- CN
- China
- Prior art keywords
- primer
- silk
- full
- fibroin
- preparation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43513—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae
- C07K14/43518—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae from spiders
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Insects & Arthropods (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Tropical Medicine & Parasitology (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention relates to a kind of Araneus ventricosus parcel silk-fibroin full-length gene and preparation method thereof, the gene order is as shown in SEQ ID NO.1.Preparation method includes:The NT sequences of portion envelops Silk gene are amplified using the method for degenerate pcr, with anchor PCR by NT sequence completions, the CT sequences obtained in the NT sequences and NCBI obtained according to sequencing expand the AcSp genes of total length to design pair of primers for PCR, the fragment that amplification obtains is subjected to flat end clone, and plasmid is extracted to the positive colony bacterium containing total length AcSp genes, total length sequencing is carried out, that is, obtains the gene.The present invention is that the Araneus ventricosus for including complete NT ends, duplicate block and complete CT ends wraps up Silk gene, has potential using value in artificial spider's thread fiber preparation field.
Description
Technical field
The invention belongs to spider silk protein gene field, more particularly to a kind of Araneus ventricosus parcel silk-fibroin full-length gene and
Its preparation method.
Background technology
Spider silk is a kind of natural protein fiber caused by spider, is the life rope that it is depended on for existence, billions of years
Evolution imparts the excellent mechanical strength of spider silk and biocompatibility, is a kind of high-quality, preferable natural biologic material, comprehensive
The far super silk of performance and current best make undulation degree.It is in high-performance fiber, composite and biomedical engineering material
There is huge application value in the fields such as material.The artificial bionic of domestic and international spider's thread protein fiber is made slow progress so far, due to
The features such as spider's thread protein species is more, molecular weight is big and multiplicity is high, the identification of spider's thread protein total length encoding gene and clone are always
It is difficult to realize.Nineteen ninety PNAS (PNAS) has just published first code segment of spider silk dragline proteins MaSp 1
Gene order, due to the particularity of spider's thread protein encoding gene, it clones the progress in field always extremely slowly,
Although different spider's thread fiber mechanical performance difference is larger, the chemistry of these silk fibers is analyzed originally from molecular level
Matter is protein.Spider's thread protein structure is more typical, and it is non-duplicate to be divided into the non-duplicate area of N-terminal (NT, about 130 amino acid), C-terminal
Area's (CT, about 110 amino acid) and middle duplicate block composition (Rp, accounting for more than the 90% of whole protein sequence), it is different
Spider's thread protein fibre property then mainly determines by duplicate block, and NT and CT are then primarily involved in the storage of spider's thread protein high concentration and into silk mistakes
Adjustment effect in journey.
Although different spider silk performances and the structure composition of molecular level differ greatly, they possess many common
Fine quality:Smooth in appearance, glittering, UV resistant performance are strong, density is very low and memory performance is good etc., in addition, spider
Silk also possesses good high temperature resistant and low-temperature characteristics, is polymerization of protein fiber additionally, due to spider silk, biodegradable etc., because
This bioaffinity is good, and environment will not be polluted, and meets the strategic requirement of sustainable development.A variety of excellent product of spider silk
Matter becomes a kind of strategic resource urgently leaved for development.
The content of the invention
The technical problems to be solved by the invention are to provide a kind of Araneus ventricosus parcel silk-fibroin full-length gene and its preparation
Method, the gene include complete NT ends, duplicate block and complete CT ends, for encoding Araneus ventricosus parcel silk-fibroin;
The silk fiber is better than silk and staple fibre in mechanical property and biocompatibility, and environmentally safe, is
Spider albumen is mass produced in genetic engineering and has established gene basis.
A kind of Araneus ventricosus parcel silk-fibroin full-length gene of the present invention, the full length gene size is 10,338bp, altogether
3445 amino acid are encoded, particular sequence is as shown in SEQ ID NO.1, molecular weight of albumen 330.0kDa.
NT ends size is 489bp in the full-length gene, encodes 163 amino acid, particular sequence such as SEQ ID NO.2 institutes
Show.
Duplicate block size is 9117bp, encodes 3039 amino acid altogether, particular sequence is as shown in SEQ ID NO.3.
CT ends size is 297bp, encodes 99 amino acid altogether, particular sequence is as shown in SEQ ID NO.4.
A kind of preparation method of Araneus ventricosus parcel silk-fibroin full-length gene of the present invention, comprises the following steps:
(1) the AcSp GFPs of silk are wrapped up according to existing spider, in NT ends degenerate primer, 2 are designed in duplicate block
Specific primer, expand to obtain the NT ends gene order of part by degenerate pcr;
(2) sequence obtained according to step (1) separately designs 2 pairs of specific primers and 1 anchor primer, passes through grappling
PCR is by NT ends polishing;
(3) complete NT terminal sequences are included according to what step (2) was obtained, in NT ends 5 ' tip designs, 1 forward primer,
CT ends 3 ' tip designs, 1 reverse primer, for expanding total length AcSp genes;
(4) after to PCR primer carries out Ago-Gel gel extraction obtained by step (3), with carrier pEASY-Blunt
Zero Cloning Vector carry out blunt end cloning reaction, are attached product recovery afterwards;
(5) flat end clone is carried out to the connection product of step (4), using the method for transformation of thermal shock, is transferred to DH5 α impressions
Converted, the bacterium solution after conversion is coated on the Double LB solid mediums with Amp and Kan, mistake in state cell
After night culture, picking monoclonal enters performing PCR detection;
(6) plasmid of the positive monoclonal obtained in step (5) is completely sequenced, finally gives Araneus ventricosus parcel
Silk-fibroin full-length gene.
It is used for the forward primer for expanding part NT ends in the step (1):TGTTTYCARGCNGTNATG;
Reverse primer:GCACCACTGGTCTGAGAGAAC.
The forward primer of the part NT terminal sequences obtained with degenerate pcr is degenerate primer, and reverse primer is the spy of duplicate block
Specific primer.
The condition of degenerate pcr in the step (1) is:95 DEG C of pre-degeneration 5min, 95 DEG C of denaturation 30s, 55 DEG C are annealed
30s, 72 DEG C of extension 30s, is circulated 30 times.
The specific primer 1 for completion NT ends in the step (2):GACTTGTTGCTTGAAACGATGCTG;With
Specific primer 2 in completion NT ends:GCAGAGAAAGCTCCTTGGTCTTG;
Anchor primer:ACTCCTGTGGAACCATCGGACGGGGGG.
The anchor PCR condition is:In first round PCR, single primer amplification, condition are carried out using specific primer 1:95
DEG C pre-degeneration 5min, 95 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, is circulated 30 times;PCR primer is subjected to fine jade afterwards
Sepharose gel extraction, is carried out with TdT enzymes plus C reactions, product carry out the second wheel PCR after reclaiming;Using specific primer 2 with
And anchor primer is expanded, condition is same as above.
It is used for the forward primer for expanding total length AcSp genes in the step (3):
CAGGCTTACAGTCATGAATTGGTTAACC;
Reverse primer:TTAAGCTAAAACTAATTCAAAAGACCTGGCAG.1 pair of primer is located at the 5 ' of Tusp genes respectively
End and 3 ' ends, to obtain complete Tusp genes.
The enzyme for being used to expand total length AcSp genes in the step (3) is Q5 high-fidelity enzymes.
Amplification condition is in the step (3):98 DEG C of pre-degeneration 1min, 98 DEG C of denaturation 5s, 60 DEG C of annealing 15s, 72 DEG C are prolonged
10min is stretched, is circulated 30 times.
Blunt end cloning reaction condition in the step (4) is:16 DEG C of reactions are overnight.
The volume ratio of connection product and DH5 α competent cells is 1 in the step (5):10, the recovery time is 1h.
The carrier for being used for flat end clone in the step (5) is pEASY-Blunt Zero Cloning Vector.
LB solid mediums in the step (5) contain ampicillin and kanamycins, ampicillin and Ka Na
The concentration of mycin in the medium is 100 μ g/mL.
The present invention amplifies AcSp NT ends sub-sequence by degenerate pcr first, is then mended using anchor PCR
Entirely, expand to obtain complete AcSp genes using long range PCR method afterwards and carry out flat end clone, obtain containing total length
The clone of AcSp genes.
Araneus ventricosus eggcase silk albumen in the present invention is used to wrap up prey and forms oopod internal layer silk for Araneus ventricosus
Main component, there is most strong toughness in 7 kinds of silks secreted by Araneus ventricosus, and it is outer that the ovum in oopod can be protected to resist
The invasion of portion microorganism and the change of temperature.
Beneficial effect
Whole gene of the present invention includes complete NT ends, duplicate block and complete CT ends, for encoding Araneus ventricosus
Wrap up silk-fibroin;The silk fiber is better than silk and staple fibre in mechanical property and biocompatibility, and to ring
Border is pollution-free;Preparation method technique is simple, and mild condition is easily operated, is to mass produce spider albumen in genetic engineering to establish
Gene basis is determined.
Brief description of the drawings
Fig. 1 is the amino acid sequence of Araneus ventricosus AcSp albumen of the present invention.
Fig. 2 is the hydrophobicity plot of Araneus ventricosus AcSp albumen of the present invention;Wherein it is that complete AcSp albumen is dredged on Fig. 2
Water-based figure, NT ends, repeat 7, the hydrophobicity profile at CT ends are followed successively by from left to right under Fig. 2.
Fig. 3 is the secondary structure prediction figure of Araneus ventricosus AcSp albumen of the present invention;Wherein Fig. 3 is followed successively by NT from left to right
End, repeat 7, the secondary structure prediction figure at CT ends.
Fig. 4 is the sequence alignment figure of Araneus ventricosus AcSp albumen of the present invention;Wherein, Fig. 4 a are the NT ends of 17 kinds of spider's thread proteins
Sequence alignment figure, Fig. 4 b are the CT terminal sequence comparison charts of 24 kinds of spider's thread proteins, and Fig. 4 c are 15 in Araneus ventricosus AcSp duplicate blocks
Sequence alignment figure between individual repeat unit.
Embodiment
With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are merely to illustrate the present invention
Rather than limitation the scope of the present invention.In addition, it is to be understood that after the content of the invention lectured has been read, people in the art
Member can make various changes or modifications to the present invention, and these equivalent form of values equally fall within the application appended claims and limited
Scope.
Embodiment 1
(1) according to the conserved sequence at the AcSp of other spiders NT ends, at NT ends and CT ends, respectively 1 degeneracy of design draws respectively
Thing:NT ends degenerate primer:TGTTTYCARGCNGTNATG, and 1 specific reverse primers is designed in duplicate block, specificity is reversely
Primer:GCACCACTGGTCTGAGAGAAC;Then performing PCR is entered, condition is 95 DEG C of pre-degeneration 5min, 95 DEG C of denaturation 30s, 55 DEG C
Anneal 30s, 72 DEG C of extension 30s, circulates 30 times.
(2) 2 specific primers and 1 anchor primer are respectively designed at NT ends and CT ends according to the sequence obtained respectively
For completion NT ends and CT ends.
NT ends primer 1:GACTTGTTGCTTGAAACGATGCTG;
NT end primer 2s:GCAGAGAAAGCTCCTTGGTCTTG;
Anchor primer:ACTCCTGTGGAACC ATCGGACGGGGGG;
Anchor PCR condition is:In first round PCR, single primer amplification, condition are carried out using specific primer 1:95 DEG C pre-
5min is denatured, 95 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, is circulated 30 times.PCR primer is subjected to agarose afterwards
Gel gel extraction, is carried out with TdT enzymes plus C reactions, product carry out the second wheel PCR after reclaiming.Use specific primer 2 and anchor
Determine primer to be expanded, condition is same as above.
(3) 1 pair of specific primer of design is used to expand total length AcSp genetic fragments after,
Forward primer:CAGGCTTACAGTCATGAATTGGTTAACC;
Reverse primer:TTAAGCTAAAACTAATTCAAAAGACCTGGCAG;
PCR conditions are 98 DEG C of pre-degeneration 1min, 98 DEG C of denaturation 5s, 60 DEG C of annealing 15s, 72 DEG C of extension 10min, circulate 30
It is secondary.Ago-Gel gel extraction afterwards.
(4) recovery product and flat ends vector pEASY-Blunt Zero Cloning vector are subjected to flat end company
Reversed to answer, condition is:16 DEG C of reactions overnight, complete long segment clone.
(5) DH5 α competent cells, volume ratio 1 are transferred to after:10, the recovery time is 1h.Bacterium solution is coated on afterwards
On the solid medium of ampicillin and kanamycins, 37 DEG C of culture 12h.Then bacterium colony is screened, be sequenced.
It is soft using the online softwares such as SignalP4.1, Expasy tools, PSIPRED and Geneious, DNA star
Part is analyzed the gene, and SignalP4.1 is used for the signal peptide for finding gene, and Expasy tools are used for dredging Tusp
Water-based to be analyzed, PSIPRED is predicted to AcSp secondary structure, and Geneious is used for carrying out Multiple Sequence Alignment, DNA
Star analyzes for the base composition to AcSp genes and amino acid composition.
Analysis result is as follows:
SignalP4.1 and DNA star analysis results:Fig. 1 is the domain and sequence map of AcSp albumen, from figure
As can be seen that whole AcSp genes are divided into three regions, NT ends, duplicate block and CT ends in 1.By 15 wherein in duplicate block
The extremely similar repeat unit composition in sequence, and occupy more than the 85% of whole protein sequence.Wherein preceding 14 repetitions
Cell size is 203 amino acid, and the 15th repeat unit is 197 amino acid.In Fig. 1 it can be found that the signal peptide of albumen
It is present in NT ends (red bar mark), and 2 Cys residues is present.
Expasy tools analysis results:Hydrophobicity plots and NT end of the Fig. 2 for whole AcSp albumen, Repeat
Unit 7 (R7), the hydrophobicity profile at CT ends.From fig. 2 it can be seen that water repellent region and hydrophilic region are in whole albumen
Change repeatedly in sequence, whole protein molecular shows as hydrophobicity.The average hydrophilicity value at CT ends is more than NT ends, but NT ends is thin
Water-based peak value is more than CT ends.
PSIPRED analysis results:Fig. 3 is AcSp Protein secondary structure prognostic charts, from figure 3, it can be seen that containing in NT ends
There are 5 αhelix, and 2 Cys residues are respectively in the 1st and the 4th spiral.In figure 3 it can be found that in CT ends
Equally comprise only 4 helical structures.There are 5 helical structures in Fig. 3 in repeat unit.
Geneious analysis results:Fig. 4 is the comparison diagram of AcSp albumen.From Fig. 4 a it can be seen that AcSp NT ends have compared with
High similarity.Conservative in Fig. 4 b between AcSp CT ends is stronger than NT end, in Fig. 4 c between this 15 repeat units
Compare, similarity is high between finding repeat unit.
SEQUENCE LISTING
<110>Donghua University
<120>A kind of Araneus ventricosus parcel silk-fibroin full-length gene and preparation method thereof
<130> 1
<160> 11
<170> PatentIn version 3.3
<210> 1
<211> 10335
<212> DNA
<213>Artificial sequence
<400> 1
atgaattggt taaccactct tgctttcgca gttctactac tctcagttca gtacgatgca 60
gcgcaaagcg cgtcacctac cttctcaaca agtccttggg ccaatccagc caaagcaagt 120
tcgttgatga actgcctgct caccaaaatc gccagctcta atgtactacc tcaacaggag 180
aaagaagact tggaatccat tatggacaca ttgatgtctg caataaaagg agcgagtgct 240
aaaggcaaaa gctctggagc acagttgcag gcgatcaaca tggccgttgc atcttccctg 300
gcggaaatag ttgttgctga agacgtagga aaccaggcca gcatggctgt gaaaacccag 360
gccctttcag gagctttgga gcaatgtttc caggcagtca tgggaagagt cgacagaaag 420
ttcatcaatg aaattaatga tttgatatca atgtttgcta gacaagctgc cacagaatca 480
aatgaaatac aagaccaagg agctttctct gcagccggtt catcagcttc agcatcgttt 540
caagcaacaa gtcagacatt ccaaggatca tcccaaacag ctggtggatt cagcacgtat 600
ccgggaggag cattccctgg tcctcaagtt tcacaacctg caccaattgg cattggacct 660
caggtatcac aacctgcacc aattgttgtt ggacctcagg tatcacaacc tgcaccaact 720
ggatacactg gtggagcagg gtcctatggt ggcggaggac agttcggagg tatcacaggt 780
caaacaactg ccgcgcaatc tggtctcatc tccagagtcg caaacgcact ggcaaataca 840
tctacaatga gaacagtcct cagaagcagt gtatcacgac aaactatcgc taacgtggtg 900
cagagaacaa ttcaagcatt ggctagcact ttcggcctgg acgcaaataa tttgtcaaga 960
atagcgttgc aagcaatttc tcaagtaccc gcgggatccg atacttctgc ttacactcaa 1020
gcattctcaa ctgccttggt caccggtgga gttctgaatg aaagaaacat tgacacattg 1080
ggatcccaag tcctctcagc agttttgaac ggagtatcaa gtgcggcgca aggccttgga 1140
atcaatgtag acactggaag tgtacaaagt gacattcgtt ccagcagtag ctccctgtca 1200
acaagttctt cgtctgccag tttctctcag accagtggtg cagcttcgac aactggtttc 1260
acaggggctg gtggctaccc tggtggagct ggtcctttgg gtggcggagt aggctctttg 1320
acaggccaaa cctctttcgg tcaaacatca ggctttactt caactgctgg cgcccaagga 1380
ggtttcggtc caacaactgg cgcgcaatct gcccttatct ccagaatagc taacgcactg 1440
gcgaatacat caacactgag atcggtcctc agaaccggtg tatcccaaca gactgcctct 1500
agcgtggtac agagaaccat ccagaccttg gctagtaatc tcggcatcga cggaaataac 1560
ttgtccagaa tagcgttaca agccatctct caagtccccg cgggttctga cacttctgct 1620
tacgctcaag cattttctac tgccttggtc accggtggag ttctgaacgc aaacaacgtt 1680
gacacattgg gatcccaagt actctcagca gttttgaacg gagtatcaag tgcggcgcaa 1740
ggccttggaa tcaatgtaga cactggaagt gtacaaagtg acattcgttc cagcagtagc 1800
tccctgtcaa caagttcttc gtctgccagt ttctctcaga ccagtggtgc agcttcgaca 1860
actggtttca caggggctgg tggctaccct ggtggagctg gtcctttggg tggcggagta 1920
ggctctttga caggccaaac ctctttcggt caaacatcag gctttacttc aactgctggc 1980
gcccaaggag gtttcggtcc aacaactggc gcgcaatctg cccttatctc cagaatagct 2040
aacgcactgg cgaatacatc aacactgaga tcggtcctca gaaccggtgt atcccaacag 2100
actgcctcta gcgtggtaca gagaaccatc cagaccttgg ctagtaatct cggcatcgac 2160
ggaaataact tgtccagaat agcgttacaa gccatctctc aagtccccgc gggttctgac 2220
acttctgctt acgctcaagc attttctact gccttggtca ccggtggagt tctgaacgca 2280
aacaacgttg acacattggg atcccaagta ctctcagcag ttttgaacgg agtatcaagt 2340
gcggcgcaag gccttggaat caatgtagac actggaagtg tacaaagtga cattcgttcc 2400
agcagtagtt ccctgtcaac aagttcttcg tctgccagtt tctctcagac cagtggtgca 2460
gcttcgacaa ctggtttcac aggggctggt ggctaccctg gtggagctgg tcctttgggt 2520
ggcggagtag gctctttgac aggccaaacc tctttcggtc aaacatcagg ctttacttca 2580
actgctggcg cccaaggagg tttcggtcca acaactggcg cgcaatctgc ccttatctcc 2640
agaatagcta acgcactggc gaatacatca acactgagat cggtcctcag aaccggtgta 2700
tcccaacaga ctgcctctag cgtggtacag agaaccatcc agaccttggc tagtaatctc 2760
ggcatcgacg gaaataactt gtccagaata gcgttacaag ccatctctca agtccccgcg 2820
ggttctgaca cttctgctta cgctcaagca ttttctactg ccttggtcac cggtggagtt 2880
ctgaacgcaa acaacgttga cacattggga tcccaagtac tctcagcagt tttgaacgga 2940
gtatcaagtg cggcgcaagg ccttggaatc aatgtagaca ctggaagtgt acaaagtgac 3000
attcgttcca gcagtagttc cctgtcaaca agttcttcgt ctgccagttt ctctcagacc 3060
agtggtgcag cttcgacaac tggtttcaca ggcgctggtg gctaccctgg tggagctggt 3120
cctttgggtg gcggagtagg ctctttgaca ggccaaacct ctttcggtca aacatcaggc 3180
tttacttcaa ctgctggcgc ccaaggaggt ttcggtccaa caactggcgc gcaatctgcc 3240
cttatctcca gaatagctaa cgcactggcg aatacatcaa cactgagatc ggtcctcaga 3300
accggtgtat cccaacagac tgcctctagc gtggtacaga gaaccatcca gaccttggct 3360
agtaatctcg gcatcgacgg aaataacttg tccagaatag cgttacaagc catctctcaa 3420
gtccccgcgg gttctgacac ttctgcttac gctcaagcat tttctactgc cttggtcacc 3480
ggtggagttc tgaacgcaaa caacgttgac acattgggat cccaagtact ctcagcagtt 3540
ttgaacggag tatcaagtgc ggcgcaaggc cttggaatca atgtagacac tggaagtgta 3600
caaagtgaca ttcgttccag cagtagttcc ctgtcaacaa gttcttcgtc tgccagtttc 3660
tctcagacca gtggtgcagc ttcgacaact ggtttcacag gggctggtgg ctaccctggt 3720
ggagctggtc ctttgggtgg cggagtaggc tctttgacag gccaaacctc tttcggtcaa 3780
acatcaggct ttacttcaac tgctggcgcc caaggaggtt tcggtccaac aactggcgcg 3840
caatctgccc ttatctccag aatagctaac gcactggcga atacatcaac actgagatcg 3900
gtcctcagaa ccggtgtatc ccaacagact gcctctagcg tggtacagag aaccatccag 3960
accttggcta gtaatctcgg catcgacgga aataacttgt ccagaatagc gttacaagcc 4020
atctctcaag tccccgcggg ttctgacact tctgcttacg ctcaagcatt ttctactgcc 4080
ttggtcaccg gtggagttct gaacgcaaac aacgttgaca cattgggatc ccaagtactc 4140
tcagcagttt tgaacggagt atcaagtgcg gcgcaaggcc ttggaatcaa tgtagacact 4200
ggaagtgtac aaagtgacat tcgttccagc agtagctccc tgtcaacaag ttcttcgtct 4260
gccagtttct ctcagaccag tggtgcagct tcgacaactg gtttcacagg ggctggtggc 4320
taccctggtg gagctggtcc tttgggtggc ggagtaggct ctttgacagg ccaaacctct 4380
ttcggtcaaa catcaggctt tacttcaact gctggcgccc aaggaggttt cggtccaaca 4440
actggcgcgc aatctgccct tatctccaga atagctaacg cactggcgaa tacatcaaca 4500
ctgagatcgg tcctcagaac cggtgtatcc caacagactg cctctagcgt ggtacagaga 4560
accatccaga ccttggctag taatctcggc atcgacggaa ataacttgtc cagaatagcg 4620
ttacaagcca tctctcaagt ccccgcgggt tctgacactt ctgcttacgc tcaagcattt 4680
tctactgcct tggtcaccgg tggagttctg aacgcaaaca acgttgacac attgggatcc 4740
caagtactct cagcagtttt gaacggagta tcaagtgcgg cgcaaggcct tggaatcaat 4800
gtagacactg gaagtgtaca aagtgacatt cgttccagca gtagttccct gtcaacaagt 4860
tcttcgtctg ccagtttctc tcagaccagt ggtgcagctt cgacaactgg tttcacaggg 4920
gctggtggct accctggtgg agctggtcct ttgggtggcg gagtaggctc tttgacaggc 4980
caaacctctt tcggtcaaac atcaggcttt acttcaactg ctggcgccca aggaggtttc 5040
ggtccaacaa ctggcgcgca atctgccctt atctccagaa tagctaacgc actggcgaat 5100
acatcaacac tgagatcggt cctcagaacc ggtgtatccc aacagactgc ctctagcgtg 5160
gtacagagaa ccatccagac cttggctagt aatctcggca tcgacggaaa taacttgtcc 5220
agaatagcgt tacaagccat ctctcaagtc cccgcgggtt ctgacacttc tgcttacgct 5280
caagcatttt ctactgcctt ggtcaccggt ggagttctga acgcaaacaa cgttgacaca 5340
ttgggatccc aagtactctc agcagttttg aacggagtat caagtgcggc gcaaggcctt 5400
ggaatcaatg tagacactgg aagtgtacaa agtgacattc gttccagcag tagttccctg 5460
tcaacaagtt cttcgtctgc cagtttctct cagaccagtg gtgcagcttc gacaactggt 5520
ttcacagggg ctggtggcta ccctggtgga gctggtcctt tgggtggcgg agtaggctct 5580
ttgacaggcc aaacctcttt cggtcaaaca tcaggcttta cttcaactgc tggcgcccaa 5640
ggaggtttcg gtccaacaac tggcgcgcaa tctgccctta tctccagaat agctaacgca 5700
ctggcgaata catcaacact gagatcggtc ctcagaaccg gtgtatccca acagactgcc 5760
tctagcgtgg tacagagaac catccagacc ttggctagta atctcggcat cgacggaaat 5820
aacttgtcca gaatagcgtt acaagccatc tctcaagtcc ccgcgggttc tgacacttct 5880
gcttacgctc aagcattttc tactgccttg gtcaccggtg gagttctgaa cgcaaacaac 5940
gttgacacat tgggatccca agtactctca gcagttttga acggagtatc aagtgcggcg 6000
caaggccttg gaatcaatgt agacactgga agtgtacaaa gtgacatacg ttccagcagt 6060
agttccctgt caacaagttc ttcgtctgcc agtttctctc agaccagtgg tgcagcttcg 6120
acaactggtt tcacaggcgc tggtggctac cctggtggag ctggtccttt gggtggcgga 6180
gtaggctctt tgacaggcca aacctctttc ggtcaaacat caggctttac ttcaactgct 6240
ggtgcccaag gcggtttcgg tccaataact ggcgcgcaat ctgcccttat ctccagaata 6300
gctaacgcac tggcgaatac atcaacactg agatcggtcc tcagaaccgg tgtatcccaa 6360
cagactgcct ctagcgtggt acagagaacc atccagacct tggctagtaa tctcggcatc 6420
gacggaaata acttgtccag aatagcgtta caagccatct ctcaagtccc cgcgggttct 6480
gacacttctg cttacgctca agcattttct actgccttgg tcaccggtgg agttctgaac 6540
gcaaacaacg ttgacacatt gggatcccaa gtactctcag cagttttgaa cggagtatca 6600
agtgcggcgc aaggccttgg aatcaatgta gacactggaa gtgtacaaag tgacattcgt 6660
tccagcagta gttccctgtc aacaagttct tcgtctgcca gtttctctca gaccagtggt 6720
gcagcttcga caactggttt cacaggcgct ggtggctacc ctggtggagc tggtcctttg 6780
ggtggcggag taggctcttt gacaggccaa acctctttcg gtcaaacatc aggctttact 6840
tcaactgctg gtgcccaagg aggtttcggt ccaacaactg gcgcgcaatc tgcccttatc 6900
tccagaatag ctaacgcact ggcgaataca tcaacactga gatcggtcct cagaaccggt 6960
gtatcccaac agactgcctc tagcgtggta cagagaacca tccagacctt ggctagtaat 7020
ctcggcatcg acggaaataa cttgtccaga atagcgttac aagccatctc tcaagtcccc 7080
gcgggttctg acacttctgc ttacgctcaa gcattttcta ctgccttggt caccggtgga 7140
gttctgaacg caaacaacgt tgacacattg ggatcccaag tactctcagc agttttgaac 7200
ggagtatcaa gtgcggcgca aggccttgga atcaatgtag acactggaag tgtacaaagt 7260
gacattcgtt ccagcagtag ttccctgtca acaagttctt cgtctgccag tttctctcag 7320
accagtggtg cagcttcgac aactggtttc acaggcgctg gtggctaccc tggtggagct 7380
ggtcctttgg gtggcggagt aggctctttg acaggccaaa cctctttcgg tcaaacatca 7440
ggctttactt caactgctgg tgcccaaggc ggtttcggtc caataactgg cgcgcaatct 7500
gcccttatct ccagaatagc taacgcactg gcgaatacat caacactgag atcggtcctc 7560
agaaccgttg tatcccaaca gactgcctct agcgtggtac agagaaccat ccagaccttg 7620
gctagtaatc tcggcctcga cggaaataac ttgtccagaa tagcgttaca agccatctct 7680
caagtccccg cgggttctga cgcttctgct tacgctcaag cattttctac tgccttggtc 7740
accggtggag ttctgaacgc aaacaacgtt gacacattgg gatcccaagt actctcagca 7800
gttttgaacg gagtatcaag tgcggcgcaa ggccttggaa tcaatgtaga cactggaagt 7860
gtacaaagtg acattcgttc cagcagtagt tccctgtcaa caagttcttc gtctgccagt 7920
ttctctcaga ccagtggtgc agcttcgaca actggtttca caggcgctgg tggctaccct 7980
ggtggagctg gtcctttggg tggcggagta ggctctttga caggccaaac ctctttcggt 8040
caaacatcag gctttacttc aactgctggc gcccaaggag gtttcggtcc aacaactggc 8100
gcgcaatctg cccttatctc cagaatagct aacgcactgg cgaatacatc aacactgaga 8160
tcggtcctca gaaccggtgt atcccaacag actgcctcta gcgtggtaca gagaaccatc 8220
cagaccttgg ctagtaatct cggcatcgac ggaaataact tgtccagaat agcgttacaa 8280
gccatctctc aagtccccgc gggttctgac acttctgctt acgctcaagc attttctact 8340
gccttggtca ccggtggagt tctgaacgca aacaacgttg acacattggg atcccaagta 8400
ctctcagcag ttttgaacgg agtatcaagt gcggcgcaag gccttggaat caatgtagac 8460
actggaagtg tacaaagtga cattcgttcc agcagtagtt ccctgtcaac aagttcttcg 8520
tctgccagtt tctctcagac cagtggtgca gcttcgacaa ctggtttcac aggggctggt 8580
ggctaccctg gtggagctgg tcctttgggt ggcggagtag gctctttgac aggccaaacc 8640
tctttcggtc aaacatcagg ctttacttca actgctggcg cccaaggagg tttcggtcca 8700
ataactggcg cgcaatctgc ccttatctcc agaatagcta acgcactggc gaatacatca 8760
acactgagat cggtcctcag aaccggtgta tcccaacaga ctgcctctag cgtggtacag 8820
agaaccatcc agaccttggc tagtaatctc ggcatcgacg gaaataactt gtccagaata 8880
gcgttacaag ccatctctca agtccccgcg ggttctgaca cttctgctta cgctcaagca 8940
ttttctactg ccttggtcac cggtggagtt ctgaacgcaa acaacgttga cacattggga 9000
tcccaagtac tctcagcagt tttgaacgga gtatcaagtg cggcgcaagg ccttggaatc 9060
aatgtagaca ctggaagtgt acaaagtgac attcgttcca gcagtagctc cctgtcaaca 9120
agttcttcgt ctgccagttt ctctcagacc agtggtgcag cttcgacaac tggtttcaca 9180
ggggctggtg gctaccctgg tggagctggt cctttgggtg gcggagtagg ctctttgaca 9240
ggccaaacct ctttcggtca aacatcaggc tttacttcaa ctgctggcgc ccaaggaggt 9300
ttcggtccaa caactggcgc gcaatctgcc cttatctcca gaatagctaa cgcactggcg 9360
aatacatcaa cactgagatc ggtcctcaga accggtgtat cccaacagac tgcctctagc 9420
gtggtacaga gaaccatcca gaccttggct agtaatctcg gcatcgacgg aaataacttg 9480
tccagaatag cgttacaagc catctctcaa gtccccgcgg gttctgacac ttctgcttac 9540
gctcaagcat tttctactgc cttggtcacc ggtggagttc tgaacgcaaa caacgttgac 9600
acattgggat cccaagtact ctcagcagtt ttgaacggag tatcaagtgc ggcgcaaggc 9660
cttggaatca atgtagacac tggaagtgta caaagtgaca tccgttccag cagtagctcc 9720
ctgtcaacaa gttcttcgtc tgccagtttc tctcagacca gtggtgcagc ttcgacaact 9780
ggtttcacag gggctggtgg ctaccctggt ggagctggtc ctttgggtgg cggagtaggc 9840
tcatttggag gtcaaacctc tttcggtcaa acatcaggct tgacctcttc tgctgctagc 9900
caatcggatt tcactcaagc tagtgacttt gtgtcatctg ctaccagtca aggtgctttt 9960
ggtcaaacgt cgggtattgc ttcatttggt gctggaccat cggctggatt atcggtgaga 10020
tctactctta attcgcccaa tggattgagg tcgggttcgg ctgcagctag aatcagccaa 10080
ttgacatcat ctgtaaggaa tgcgatcggt cccaatggcg ttgatgctaa tgctctggcc 10140
cgtagtcttc aagcaagttt ctcgagtctt cgaagttccg gtatgtcttc aagtgatgct 10200
aaaattgaag ttctgtttga aactattgtt ggcctgcttc agctcttaag caacactcag 10260
atccgaggag tgaacatggc tacggcgtct tctgttgcga attctgctgc caggtctttt 10320
gaattagttt tagct 10335
<210> 2
<211> 489
<212> DNA
<213>Artificial sequence
<400> 2
atgaattggt taaccactct tgctttcgca gttctactac tctcagttca gtacgatgca 60
gcgcaaagcg cgtcacctac cttctcaaca agtccttggg ccaatccagc caaagcaagt 120
tcgttgatga actgcctgct caccaaaatc gccagctcta atgtactacc tcaacaggag 180
aaagaagact tggaatccat tatggacaca ttgatgtctg caataaaagg agcgagtgct 240
aaaggcaaaa gctctggagc acagttgcag gcgatcaaca tggccgttgc atcttccctg 300
gcggaaatag ttgttgctga agacgtagga aaccaggcca gcatggctgt gaaaacccag 360
gccctttcag gagctttgga gcaatgtttc caggcagtca tgggaagagt cgacagaaag 420
ttcatcaatg aaattaatga tttgatatca atgtttgcta gacaagctgc cacagaatca 480
aatgaaata 489
<210> 3
<211> 9117
<212> DNA
<213>Artificial sequence
<400> 3
ggtcaaacaa ctgccgcgca atctggtctc atctccagag tcgcaaacgc actggcaaat 60
acatctacaa tgagaacagt cctcagaagc agtgtatcac gacaaactat cgctaacgtg 120
gtgcagagaa caattcaagc attggctagc actttcggcc tggacgcaaa taatttgtca 180
agaatagcgt tgcaagcaat ttctcaagta cccgcgggat ccgatacttc tgcttacact 240
caagcattct caactgcctt ggtcaccggt ggagttctga atgaaagaaa cattgacaca 300
ttgggatccc aagtcctctc agcagttttg aacggagtat caagtgcggc gcaaggcctt 360
ggaatcaatg tagacactgg aagtgtacaa agtgacattc gttccagcag tagctccctg 420
tcaacaagtt cttcgtctgc cagtttctct cagaccagtg gtgcagcttc gacaactggt 480
ttcacagggg ctggtggcta ccctggtgga gctggtcctt tgggtggcgg agtaggctct 540
ttgacaggcc aaacctcttt cggtcaaaca tcaggcttta cttcaactgc tggcgcccaa 600
ggaggtttcg gtccaacaac tggcgcgcaa tctgccctta tctccagaat agctaacgca 660
ctggcgaata catcaacact gagatcggtc ctcagaaccg gtgtatccca acagactgcc 720
tctagcgtgg tacagagaac catccagacc ttggctagta atctcggcat cgacggaaat 780
aacttgtcca gaatagcgtt acaagccatc tctcaagtcc ccgcgggttc tgacacttct 840
gcttacgctc aagcattttc tactgccttg gtcaccggtg gagttctgaa cgcaaacaac 900
gttgacacat tgggatccca agtactctca gcagttttga acggagtatc aagtgcggcg 960
caaggccttg gaatcaatgt agacactgga agtgtacaaa gtgacattcg ttccagcagt 1020
agctccctgt caacaagttc ttcgtctgcc agtttctctc agaccagtgg tgcagcttcg 1080
acaactggtt tcacaggggc tggtggctac cctggtggag ctggtccttt gggtggcgga 1140
gtaggctctt tgacaggcca aacctctttc ggtcaaacat caggctttac ttcaactgct 1200
ggcgcccaag gaggtttcgg tccaacaact ggcgcgcaat ctgcccttat ctccagaata 1260
gctaacgcac tggcgaatac atcaacactg agatcggtcc tcagaaccgg tgtatcccaa 1320
cagactgcct ctagcgtggt acagagaacc atccagacct tggctagtaa tctcggcatc 1380
gacggaaata acttgtccag aatagcgtta caagccatct ctcaagtccc cgcgggttct 1440
gacacttctg cttacgctca agcattttct actgccttgg tcaccggtgg agttctgaac 1500
gcaaacaacg ttgacacatt gggatcccaa gtactctcag cagttttgaa cggagtatca 1560
agtgcggcgc aaggccttgg aatcaatgta gacactggaa gtgtacaaag tgacattcgt 1620
tccagcagta gttccctgtc aacaagttct tcgtctgcca gtttctctca gaccagtggt 1680
gcagcttcga caactggttt cacaggggct ggtggctacc ctggtggagc tggtcctttg 1740
ggtggcggag taggctcttt gacaggccaa acctctttcg gtcaaacatc aggctttact 1800
tcaactgctg gcgcccaagg aggtttcggt ccaacaactg gcgcgcaatc tgcccttatc 1860
tccagaatag ctaacgcact ggcgaataca tcaacactga gatcggtcct cagaaccggt 1920
gtatcccaac agactgcctc tagcgtggta cagagaacca tccagacctt ggctagtaat 1980
ctcggcatcg acggaaataa cttgtccaga atagcgttac aagccatctc tcaagtcccc 2040
gcgggttctg acacttctgc ttacgctcaa gcattttcta ctgccttggt caccggtgga 2100
gttctgaacg caaacaacgt tgacacattg ggatcccaag tactctcagc agttttgaac 2160
ggagtatcaa gtgcggcgca aggccttgga atcaatgtag acactggaag tgtacaaagt 2220
gacattcgtt ccagcagtag ttccctgtca acaagttctt cgtctgccag tttctctcag 2280
accagtggtg cagcttcgac aactggtttc acaggcgctg gtggctaccc tggtggagct 2340
ggtcctttgg gtggcggagt aggctctttg acaggccaaa cctctttcgg tcaaacatca 2400
ggctttactt caactgctgg cgcccaagga ggtttcggtc caacaactgg cgcgcaatct 2460
gcccttatct ccagaatagc taacgcactg gcgaatacat caacactgag atcggtcctc 2520
agaaccggtg tatcccaaca gactgcctct agcgtggtac agagaaccat ccagaccttg 2580
gctagtaatc tcggcatcga cggaaataac ttgtccagaa tagcgttaca agccatctct 2640
caagtccccg cgggttctga cacttctgct tacgctcaag cattttctac tgccttggtc 2700
accggtggag ttctgaacgc aaacaacgtt gacacattgg gatcccaagt actctcagca 2760
gttttgaacg gagtatcaag tgcggcgcaa ggccttggaa tcaatgtaga cactggaagt 2820
gtacaaagtg acattcgttc cagcagtagt tccctgtcaa caagttcttc gtctgccagt 2880
ttctctcaga ccagtggtgc agcttcgaca actggtttca caggggctgg tggctaccct 2940
ggtggagctg gtcctttggg tggcggagta ggctctttga caggccaaac ctctttcggt 3000
caaacatcag gctttacttc aactgctggc gcccaaggag gtttcggtcc aacaactggc 3060
gcgcaatctg cccttatctc cagaatagct aacgcactgg cgaatacatc aacactgaga 3120
tcggtcctca gaaccggtgt atcccaacag actgcctcta gcgtggtaca gagaaccatc 3180
cagaccttgg ctagtaatct cggcatcgac ggaaataact tgtccagaat agcgttacaa 3240
gccatctctc aagtccccgc gggttctgac acttctgctt acgctcaagc attttctact 3300
gccttggtca ccggtggagt tctgaacgca aacaacgttg acacattggg atcccaagta 3360
ctctcagcag ttttgaacgg agtatcaagt gcggcgcaag gccttggaat caatgtagac 3420
actggaagtg tacaaagtga cattcgttcc agcagtagct ccctgtcaac aagttcttcg 3480
tctgccagtt tctctcagac cagtggtgca gcttcgacaa ctggtttcac aggggctggt 3540
ggctaccctg gtggagctgg tcctttgggt ggcggagtag gctctttgac aggccaaacc 3600
tctttcggtc aaacatcagg ctttacttca actgctggcg cccaaggagg tttcggtcca 3660
acaactggcg cgcaatctgc ccttatctcc agaatagcta acgcactggc gaatacatca 3720
acactgagat cggtcctcag aaccggtgta tcccaacaga ctgcctctag cgtggtacag 3780
agaaccatcc agaccttggc tagtaatctc ggcatcgacg gaaataactt gtccagaata 3840
gcgttacaag ccatctctca agtccccgcg ggttctgaca cttctgctta cgctcaagca 3900
ttttctactg ccttggtcac cggtggagtt ctgaacgcaa acaacgttga cacattggga 3960
tcccaagtac tctcagcagt tttgaacgga gtatcaagtg cggcgcaagg ccttggaatc 4020
aatgtagaca ctggaagtgt acaaagtgac attcgttcca gcagtagttc cctgtcaaca 4080
agttcttcgt ctgccagttt ctctcagacc agtggtgcag cttcgacaac tggtttcaca 4140
ggggctggtg gctaccctgg tggagctggt cctttgggtg gcggagtagg ctctttgaca 4200
ggccaaacct ctttcggtca aacatcaggc tttacttcaa ctgctggcgc ccaaggaggt 4260
ttcggtccaa caactggcgc gcaatctgcc cttatctcca gaatagctaa cgcactggcg 4320
aatacatcaa cactgagatc ggtcctcaga accggtgtat cccaacagac tgcctctagc 4380
gtggtacaga gaaccatcca gaccttggct agtaatctcg gcatcgacgg aaataacttg 4440
tccagaatag cgttacaagc catctctcaa gtccccgcgg gttctgacac ttctgcttac 4500
gctcaagcat tttctactgc cttggtcacc ggtggagttc tgaacgcaaa caacgttgac 4560
acattgggat cccaagtact ctcagcagtt ttgaacggag tatcaagtgc ggcgcaaggc 4620
cttggaatca atgtagacac tggaagtgta caaagtgaca ttcgttccag cagtagttcc 4680
ctgtcaacaa gttcttcgtc tgccagtttc tctcagacca gtggtgcagc ttcgacaact 4740
ggtttcacag gggctggtgg ctaccctggt ggagctggtc ctttgggtgg cggagtaggc 4800
tctttgacag gccaaacctc tttcggtcaa acatcaggct ttacttcaac tgctggcgcc 4860
caaggaggtt tcggtccaac aactggcgcg caatctgccc ttatctccag aatagctaac 4920
gcactggcga atacatcaac actgagatcg gtcctcagaa ccggtgtatc ccaacagact 4980
gcctctagcg tggtacagag aaccatccag accttggcta gtaatctcgg catcgacgga 5040
aataacttgt ccagaatagc gttacaagcc atctctcaag tccccgcggg ttctgacact 5100
tctgcttacg ctcaagcatt ttctactgcc ttggtcaccg gtggagttct gaacgcaaac 5160
aacgttgaca cattgggatc ccaagtactc tcagcagttt tgaacggagt atcaagtgcg 5220
gcgcaaggcc ttggaatcaa tgtagacact ggaagtgtac aaagtgacat acgttccagc 5280
agtagttccc tgtcaacaag ttcttcgtct gccagtttct ctcagaccag tggtgcagct 5340
tcgacaactg gtttcacagg cgctggtggc taccctggtg gagctggtcc tttgggtggc 5400
ggagtaggct ctttgacagg ccaaacctct ttcggtcaaa catcaggctt tacttcaact 5460
gctggtgccc aaggcggttt cggtccaata actggcgcgc aatctgccct tatctccaga 5520
atagctaacg cactggcgaa tacatcaaca ctgagatcgg tcctcagaac cggtgtatcc 5580
caacagactg cctctagcgt ggtacagaga accatccaga ccttggctag taatctcggc 5640
atcgacggaa ataacttgtc cagaatagcg ttacaagcca tctctcaagt ccccgcgggt 5700
tctgacactt ctgcttacgc tcaagcattt tctactgcct tggtcaccgg tggagttctg 5760
aacgcaaaca acgttgacac attgggatcc caagtactct cagcagtttt gaacggagta 5820
tcaagtgcgg cgcaaggcct tggaatcaat gtagacactg gaagtgtaca aagtgacatt 5880
cgttccagca gtagttccct gtcaacaagt tcttcgtctg ccagtttctc tcagaccagt 5940
ggtgcagctt cgacaactgg tttcacaggc gctggtggct accctggtgg agctggtcct 6000
ttgggtggcg gagtaggctc tttgacaggc caaacctctt tcggtcaaac atcaggcttt 6060
acttcaactg ctggtgccca aggaggtttc ggtccaacaa ctggcgcgca atctgccctt 6120
atctccagaa tagctaacgc actggcgaat acatcaacac tgagatcggt cctcagaacc 6180
ggtgtatccc aacagactgc ctctagcgtg gtacagagaa ccatccagac cttggctagt 6240
aatctcggca tcgacggaaa taacttgtcc agaatagcgt tacaagccat ctctcaagtc 6300
cccgcgggtt ctgacacttc tgcttacgct caagcatttt ctactgcctt ggtcaccggt 6360
ggagttctga acgcaaacaa cgttgacaca ttgggatccc aagtactctc agcagttttg 6420
aacggagtat caagtgcggc gcaaggcctt ggaatcaatg tagacactgg aagtgtacaa 6480
agtgacattc gttccagcag tagttccctg tcaacaagtt cttcgtctgc cagtttctct 6540
cagaccagtg gtgcagcttc gacaactggt ttcacaggcg ctggtggcta ccctggtgga 6600
gctggtcctt tgggtggcgg agtaggctct ttgacaggcc aaacctcttt cggtcaaaca 6660
tcaggcttta cttcaactgc tggtgcccaa ggcggtttcg gtccaataac tggcgcgcaa 6720
tctgccctta tctccagaat agctaacgca ctggcgaata catcaacact gagatcggtc 6780
ctcagaaccg ttgtatccca acagactgcc tctagcgtgg tacagagaac catccagacc 6840
ttggctagta atctcggcct cgacggaaat aacttgtcca gaatagcgtt acaagccatc 6900
tctcaagtcc ccgcgggttc tgacgcttct gcttacgctc aagcattttc tactgccttg 6960
gtcaccggtg gagttctgaa cgcaaacaac gttgacacat tgggatccca agtactctca 7020
gcagttttga acggagtatc aagtgcggcg caaggccttg gaatcaatgt agacactgga 7080
agtgtacaaa gtgacattcg ttccagcagt agttccctgt caacaagttc ttcgtctgcc 7140
agtttctctc agaccagtgg tgcagcttcg acaactggtt tcacaggcgc tggtggctac 7200
cctggtggag ctggtccttt gggtggcgga gtaggctctt tgacaggcca aacctctttc 7260
ggtcaaacat caggctttac ttcaactgct ggcgcccaag gaggtttcgg tccaacaact 7320
ggcgcgcaat ctgcccttat ctccagaata gctaacgcac tggcgaatac atcaacactg 7380
agatcggtcc tcagaaccgg tgtatcccaa cagactgcct ctagcgtggt acagagaacc 7440
atccagacct tggctagtaa tctcggcatc gacggaaata acttgtccag aatagcgtta 7500
caagccatct ctcaagtccc cgcgggttct gacacttctg cttacgctca agcattttct 7560
actgccttgg tcaccggtgg agttctgaac gcaaacaacg ttgacacatt gggatcccaa 7620
gtactctcag cagttttgaa cggagtatca agtgcggcgc aaggccttgg aatcaatgta 7680
gacactggaa gtgtacaaag tgacattcgt tccagcagta gttccctgtc aacaagttct 7740
tcgtctgcca gtttctctca gaccagtggt gcagcttcga caactggttt cacaggggct 7800
ggtggctacc ctggtggagc tggtcctttg ggtggcggag taggctcttt gacaggccaa 7860
acctctttcg gtcaaacatc aggctttact tcaactgctg gcgcccaagg aggtttcggt 7920
ccaataactg gcgcgcaatc tgcccttatc tccagaatag ctaacgcact ggcgaataca 7980
tcaacactga gatcggtcct cagaaccggt gtatcccaac agactgcctc tagcgtggta 8040
cagagaacca tccagacctt ggctagtaat ctcggcatcg acggaaataa cttgtccaga 8100
atagcgttac aagccatctc tcaagtcccc gcgggttctg acacttctgc ttacgctcaa 8160
gcattttcta ctgccttggt caccggtgga gttctgaacg caaacaacgt tgacacattg 8220
ggatcccaag tactctcagc agttttgaac ggagtatcaa gtgcggcgca aggccttgga 8280
atcaatgtag acactggaag tgtacaaagt gacattcgtt ccagcagtag ctccctgtca 8340
acaagttctt cgtctgccag tttctctcag accagtggtg cagcttcgac aactggtttc 8400
acaggggctg gtggctaccc tggtggagct ggtcctttgg gtggcggagt aggctctttg 8460
acaggccaaa cctctttcgg tcaaacatca ggctttactt caactgctgg cgcccaagga 8520
ggtttcggtc caacaactgg cgcgcaatct gcccttatct ccagaatagc taacgcactg 8580
gcgaatacat caacactgag atcggtcctc agaaccggtg tatcccaaca gactgcctct 8640
agcgtggtac agagaaccat ccagaccttg gctagtaatc tcggcatcga cggaaataac 8700
ttgtccagaa tagcgttaca agccatctct caagtccccg cgggttctga cacttctgct 8760
tacgctcaag cattttctac tgccttggtc accggtggag ttctgaacgc aaacaacgtt 8820
gacacattgg gatcccaagt actctcagca gttttgaacg gagtatcaag tgcggcgcaa 8880
ggccttggaa tcaatgtaga cactggaagt gtacaaagtg acatccgttc cagcagtagc 8940
tccctgtcaa caagttcttc gtctgccagt ttctctcaga ccagtggtgc agcttcgaca 9000
actggtttca caggggctgg tggctaccct ggtggagctg gtcctttggg tggcggagta 9060
ggctcatttg gaggtcaaac ctctttcggt caaacatcag gcttgacctc ttctgct 9117
<210> 4
<211> 297
<212> DNA
<213>Artificial sequence
<400> 4
aatggattga ggtcgggttc ggctgcagct agaatcagcc aattgacatc atctgtaagg 60
aatgcgatcg gtcccaatgg cgttgatgct aatgctctgg cccgtagtct tcaagcaagt 120
ttctcgagtc ttcgaagttc cggtatgtct tcaagtgatg ctaaaattga agttctgttt 180
gaaactattg ttggcctgct tcagctctta agcaacactc agatccgagg agtgaacatg 240
gctacggcgt cttctgttgc gaattctgct gccaggtctt ttgaattagt tttagct 297
<210> 5
<211> 18
<212> DNA
<213>Artificial sequence
<220>
<221> misc_feature
<222> (12)..(12)
<223> n is a, c, g, or t
<220>
<221> misc_feature
<222> (15)..(15)
<223> n is a, c, g, or t
<400> 5
tgtttycarg cngtnatg 18
<210> 6
<211> 21
<212> DNA
<213>Artificial sequence
<400> 6
gcaccactgg tctgagagaa c 21
<210> 7
<211> 24
<212> DNA
<213>Artificial sequence
<400> 7
gacttgttgc ttgaaacgat gctg 24
<210> 8
<211> 23
<212> DNA
<213>Artificial sequence
<400> 8
gcagagaaag ctccttggtc ttg 23
<210> 9
<211> 27
<212> DNA
<213>Artificial sequence
<400> 9
actcctgtgg aaccatcgga cgggggg 27
<210> 10
<211> 28
<212> DNA
<213>Artificial sequence
<400> 10
caggcttaca gtcatgaatt ggttaacc 28
<210> 11
<211> 32
<212> DNA
<213>Artificial sequence
<400> 11
ttaagctaaa actaattcaa aagacctggc ag 32
Claims (10)
1. a kind of Araneus ventricosus wraps up silk-fibroin full-length gene, it is characterised in that:The gene order such as SEQ ID NO.1 institutes
Show.
2. a kind of preparation method of Araneus ventricosus parcel silk-fibroin full-length gene, comprises the following steps:
(1) the AcSp GFPs of silk are wrapped up according to existing spider, in NT ends degenerate primer, 2 are designed in duplicate block specifically
Property primer, expands to obtain the NT ends gene order of part by degenerate pcr;
(2) sequence obtained according to step (1) separately designs 2 pairs of specific primers and 1 anchor primer, passes through anchor PCR
By NT ends polishing;
(3) complete NT terminal sequences are included according to what step (2) was obtained, in NT ends 5 ' tip designs, 1 forward primer, at CT ends
3 ' the reverse primers of tip designs 1, for expanding total length AcSp genes;
(4) after to PCR primer carries out Ago-Gel gel extraction obtained by step (3), with carrier pEASY-Blunt Zero
Cloning Vector carry out blunt end cloning reaction, are attached product recovery afterwards;
(5) flat end clone is carried out to the connection product of step (4), using the method for transformation of thermal shock, it is thin is transferred to DH5 α competence
Converted in born of the same parents, the bacterium solution after conversion is coated on the Double LB solid mediums with Amp and Kan, overnight training
After supporting, picking monoclonal enters performing PCR detection;
(6) plasmid of the positive monoclonal obtained in step (5) is completely sequenced, finally gives Araneus ventricosus parcel silk egg
White full-length gene.
A kind of 3. preparation method of Araneus ventricosus parcel silk-fibroin full-length gene according to claim 2, it is characterised in that:
It is used for the forward primer for expanding part NT ends in the step (1):TGTTTYCARGCNGTNATG;Reverse primer:
GCACCACTGGTCTGAGAGAAC。
A kind of 4. preparation method of Araneus ventricosus parcel silk-fibroin full-length gene according to claim 2, it is characterised in that:
The condition of degenerate pcr in the step (1) is:95 DEG C of pre-degeneration 5min, 95 DEG C of denaturation 30s, 55 DEG C of annealing 30s, 72 DEG C are prolonged
30s is stretched, is circulated 30 times.
A kind of 5. preparation method of Araneus ventricosus parcel silk-fibroin full-length gene according to claim 2, it is characterised in that:
The specific primer 1 for completion NT ends in the step (2):GACTTGTTGCTTGAAACGATGCTG;For completion NT
The specific primer 2 at end:GCAGAGAAAGCTCCTTGGTCTTG;Anchor primer:ACTCCTGTGGAACCATCGGACGGGGGG.
A kind of 6. preparation method of Araneus ventricosus parcel silk-fibroin full-length gene according to claim 5, it is characterised in that:
The anchor PCR condition is:In first round PCR, single primer amplification, condition are carried out using specific primer 1:95 DEG C of pre-degenerations
5min, 95 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, is circulated 30 times;PCR primer is subjected to Ago-Gel afterwards
Gel extraction, is carried out with TdT enzymes plus C reactions, product carry out the second wheel PCR after reclaiming;Drawn using specific primer 2 and grappling
Thing is expanded, and condition is same as above.
A kind of 7. preparation method of Araneus ventricosus parcel silk-fibroin full-length gene according to claim 2, it is characterised in that:
It is used for the forward primer for expanding total length AcSp genes in the step (3):CAGGCTTACAGTCATGAATTGGTTAACC;Reversely
Primer:TTAAGCTAAAACTAATTCAAAAGACCTGGCAG.
A kind of 8. preparation method of Araneus ventricosus parcel silk-fibroin full-length gene according to claim 2, it is characterised in that:
The enzyme for being used to expand total length AcSp genes in the step (3) is Q5 high-fidelity enzymes;Amplification condition is:98 DEG C of pre-degeneration 1min,
98 DEG C of denaturation 5s, 60 DEG C of annealing 15s, 72 DEG C of extension 10min, are circulated 30 times.
A kind of 9. preparation method of Araneus ventricosus parcel silk-fibroin full-length gene according to claim 2, it is characterised in that:
Blunt end cloning reaction condition in the step (4) is:16 DEG C of reactions are overnight.
10. a kind of preparation method of Araneus ventricosus parcel silk-fibroin full-length gene according to claim 2, its feature exist
In:The volume ratio of connection product and DH5 α competent cells is 1 in the step (5):10, the recovery time is 1h;LB solids are trained
Foster base contains ampicillin and kanamycins, and the concentration of ampicillin and kanamycins in the medium is 100 μ g/
mL。
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201711024721.6A CN107699567A (en) | 2017-10-27 | 2017-10-27 | A kind of Araneus ventricosus parcel silk-fibroin full-length gene and preparation method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201711024721.6A CN107699567A (en) | 2017-10-27 | 2017-10-27 | A kind of Araneus ventricosus parcel silk-fibroin full-length gene and preparation method thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN107699567A true CN107699567A (en) | 2018-02-16 |
Family
ID=61183226
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201711024721.6A Pending CN107699567A (en) | 2017-10-27 | 2017-10-27 | A kind of Araneus ventricosus parcel silk-fibroin full-length gene and preparation method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107699567A (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109371035A (en) * | 2018-11-30 | 2019-02-22 | 东华大学 | A kind of gene and preparation method thereof of Araneus ventricosus pyriform gland silk-fibroin |
CN110106571A (en) * | 2019-04-09 | 2019-08-09 | 商文辉 | A kind of spider web textile fabric and preparation method thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106480045A (en) * | 2016-10-19 | 2017-03-08 | 东华大学 | A kind of Araneus ventricosus eggcase silk full length protein gene and preparation method thereof |
-
2017
- 2017-10-27 CN CN201711024721.6A patent/CN107699567A/en active Pending
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106480045A (en) * | 2016-10-19 | 2017-03-08 | 东华大学 | A kind of Araneus ventricosus eggcase silk full length protein gene and preparation method thereof |
Non-Patent Citations (3)
Title |
---|
RUI WEN ET AL.: "Molecular cloning and analysis of the full-length aciniform spidroin gene from Araneus ventricosus", 《INTERNATIONAL JOURNAL OF BIOLOGICAL MACROMOLECULES》 * |
ZHANG ET AL.: "HQ008714.1", 《GENBANK》 * |
张立树等: "蜘蛛牵引丝蛋白cDNA的扩增、克隆与序列分析", 《生物工程学报》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN109371035A (en) * | 2018-11-30 | 2019-02-22 | 东华大学 | A kind of gene and preparation method thereof of Araneus ventricosus pyriform gland silk-fibroin |
CN110106571A (en) * | 2019-04-09 | 2019-08-09 | 商文辉 | A kind of spider web textile fabric and preparation method thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN113881652B (en) | Novel Cas enzymes and systems and applications | |
Munishkin et al. | Efficient templates for Qβ replicase are formed by recombination from heterologous sequences | |
Chiarabelli et al. | Investigation of de novo totally random biosequences, Part II: On the folding frequency in a totally random library of de novo proteins obtained by phage display | |
Sala-Rovira et al. | Molecular cloning and immunolocalization of two variants of the major basic nuclear protein (HCc) from the histone-less eukaryote Crypthecodinium cohnii (Pyrrhophyta) | |
CA2703161A1 (en) | Plant-optimized polynucleotides encoding approximately 15 kda and approximately 45 kda pesticidal proteins | |
JPH03501928A (en) | Nucleotide sequence encoding a protein with urease activity | |
CN107012130A (en) | A kind of glucose oxidase mutant and its encoding gene and application | |
CN107699567A (en) | A kind of Araneus ventricosus parcel silk-fibroin full-length gene and preparation method thereof | |
CN110331136A (en) | A kind of terminal deoxy ribonucleotide transfer enzyme variants and its application | |
DE10030529A1 (en) | New ester-cleaving enzyme from Thermomonospora fusca, useful for degrading e.g. polyesters, for recycling or surface modification | |
CN107365789A (en) | A kind of preparation method of recombinant spider silk protein nano fibrous membrane | |
EP2261332A2 (en) | Libraries of recombinant chimeric proteins | |
RU2007111137A (en) | HONADOTROPIC HORMONE OBTAINED FROM INERTIBRIETS AND ITS SYNTHESIS | |
Behammer et al. | Flagellar structure and hyperthermophily: analysis of a single flagellin gene and its product in Aquifex pyrophilus | |
CN104672314B (en) | One kind restructuring 4 albumen of archaerhodopsin and its preparation method and application | |
CN106480045B (en) | A kind of Araneus ventricosus eggcase silk full length protein gene and preparation method thereof | |
CN117487027B (en) | Multivalent nanometer chelating peptide and application thereof | |
CN113717256A (en) | Fusion protein and application thereof | |
EP1326964A2 (en) | THERMOSTABLE POLYMERASE BASED ON i THERMOCOCCUS PACIFICUS /i | |
CN110195044A (en) | One group of amino acid sequence that SOD activity and stability can be improved and its application | |
CN105018452B (en) | Streptokinase QK genes and recombinant expression carrier, recombinant bacterium and application containing the gene | |
CN114380918B (en) | System and method for single base editing of target RNA | |
CN116854823A (en) | Multi-block recombinant protein, preparation method thereof and spinning process | |
JPS6229982A (en) | Novel plasmid and novel microorganism transformed by said plasmid | |
Beznosov et al. | Archaeal flagella as matrices for new nanomaterials |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180216 |
|
RJ01 | Rejection of invention patent application after publication |