CN107674879A - A kind of photogene plasmid and its application - Google Patents

A kind of photogene plasmid and its application Download PDF

Info

Publication number
CN107674879A
CN107674879A CN201610619893.7A CN201610619893A CN107674879A CN 107674879 A CN107674879 A CN 107674879A CN 201610619893 A CN201610619893 A CN 201610619893A CN 107674879 A CN107674879 A CN 107674879A
Authority
CN
China
Prior art keywords
light
gene
plasmid
cell
hsyn
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201610619893.7A
Other languages
Chinese (zh)
Inventor
汤勇
詹阳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shenzhen Institute of Advanced Technology of CAS
Original Assignee
Shenzhen Institute of Advanced Technology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shenzhen Institute of Advanced Technology of CAS filed Critical Shenzhen Institute of Advanced Technology of CAS
Priority to CN201610619893.7A priority Critical patent/CN107674879A/en
Publication of CN107674879A publication Critical patent/CN107674879A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
    • G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
    • G01N21/64—Fluorescence; Phosphorescence
    • G01N21/6486—Measuring fluorescence of biological material, e.g. DNA, RNA, cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/10021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
    • C12N2750/14121—Viruses as such, e.g. new isolates, mutants or their genomic sequences

Abstract

The present invention provides a kind of photogene plasmid and its application, the plasmid and includes promoter, light sensation gene and changeable colour fluorescence protein gene.The present invention makes light sensation gene and changeable colour fluorescence protein gene combine to form the plasmid on plasmid, and it can be used for function of the observation definitely by the cell or tissue of light regulation and control.Physiological function change can be produced under light stimulus by expressing the cell of the light-gene plasmid；The cell for determining to be regulated and controled by light with reference to change in fluorescence indicative function on optical channel.These comprehensive functions, the plasmid can react those exactly by the cell or tissue function of light stimulus.

Description

A kind of light-gene plasmid and its application
Technical field
The present invention relates to a kind of light-gene plasmid and its application, belongs to light-gene technology field.
Background technology
" light-gene technology system " technology (Optogenetic Technology) is that last decade is first in the U.S. and Germany First have developed, it is a kind of brand-new biological skill for incorporating genetic engineering, electrophysiology, optics and electronic engineering technology Art.Method of the technology based on gene therapy, using viral vector (generally with slow virus or adeno-associated virus) by one kind from green What algae Chlamydomonas reinhardtii were cloned can be with the gene of encoded light sensitive cation channel protein (ChR2) import in a certain specific cell subsets and express, when this channel protein is stimulated by blue light (472nm), Na can be made+From Son enters causes after birth to depolarize and excitatory cells into the cell.In addition, separately have a kind of from Natruonobacterium The chlorion chlG gene NpHR for the light regulation and control that pharaonis is extracted, it is sensitive to gold-tinted (593nm wavelength), by it It is cloned into after being expressed in a certain cell, the chloride channel protein can make Cl under gold-tinted stimulation-After birth is answered into cell Polarization, so that cell replys tranquillization, so controlled using alternate blue light or gold-tinted can in specific cells subgroup level Cytoactive processed.There is this technology cell-specific spatially (to induce corresponding gene in certain detail using specific promoter Expressed in born of the same parents group) and time upper millisecond level on accuracy, therefore no matter in terms of scientific research, or clinical medicine research and development All there is very big application potential.
Existing light-gene technology system photoreceptor is expressed in cell surface, and the cell either cultivated in vitro is also It is the cell or tissue in organism, the expression scope of light receptor is not all in the range of light irradiation, in light-gene technology In, the tissue or cell in a certain space of control accurate are known problems, determine which table light stimulus has arrived currently without method Up to the cell of photoreceptor.Therefore light-gene technology system is not accurate enough when studying definite cell function, and research object is One general light-gene expression region cell mass.
The content of the invention
To solve the above problems, it is a primary object of the present invention to provide a kind of light-gene plasmid, it is set to can be applied to see Examine definitely by the function of the cell or tissue of light regulation and control.
Another object of the present invention is to provide with the restructuring disease of viral vector packaging light-gene plasmid of the present invention Poison.
Another object of the present invention is to provide by the recombinant protein of plasmid expression of the present invention.
Another object of the present invention is to provide the biological material containing plasmid of the present invention, recombinant virus or recombinant protein Material.
It is still another object of the present invention to provide a kind of method of smooth regulating cell, methods described make use of of the present invention Plasmid.
To achieve the above object, the present invention provides a kind of light-gene plasmid, wherein, the plasmid includes promoter, light sensation base Cause and changeable colour fluorescence protein gene.
Preferably, it is located at the light sensation gene and changeable colour fluorescin base by the duplication direction of plasmid, the promoter The upstream of cause；It is highly preferred that by the clone method of plasmid, it is described to contain promoter, light sensation gene and changeable colour fluorescence protein gene Order is connected successively.
It is as shown in Figure 1 as the embodiment of the present invention, the collection of illustrative plates of the plasmid.
Promoter of the present invention is expressed for induction light sensation gene and changeable colour fluorescence protein gene in specific cells group Specific promoter, these feature promoters can be selected according to the cell or tissue actually regulated and controled according to prior art.
Exemplary promoter includes but is not limited to Ef1a, CaMKIIa, hSyn, CAG, Fos, PV or TH.Preferably, institute It is hSyn to state promoter.
As it was previously stated, light sensation gene of the present invention is the gene of encoded light responsive type albumen, as the albumen expressed by it Physiological function change can be produced under light stimulus.Can be applied to the present invention photosensitizing effect include but is not limited to ChR2, eNpHR3.0、C1V1、ChETA、ArchT.Preferentially, the photosensitizing effect is eNpHR3.0.
Changeable colour fluorescence protein gene of the present invention is the gene that encoded light converts fluorescin, as the egg expressed by it Color conversion can be achieved under specific illumination condition in vain.Can be applied to the changeable colour fluorescence protein gene of the present invention is included but not It is limited to EosFP, Dendra2, Kaede, mKikGR.It is preferred that Dendra2.Realize the spy of the changeable colour fluorescin converting colors Determining illumination wavelength can select according to prior art, such as from brain coral (lobed) (Lobophyllia hemprichii) EosFP, it becomes red by 390~405nm illumination by green.From soft coral (Dendronephthya) DendGFP derivative Dendra2, it becomes red by 488nm or 405nm illumination by green.
As it was previously stated, existing light-gene technology system photoreceptor is expressed in cell surface, either cultivate in vitro Cell or organism in cell or tissue, the expression scope of light receptor is not all in the range of light irradiation, in light-base Because in technology, the tissue or cell in a certain space of control accurate are known problems, determine that light stimulus is arrived currently without method The cell of which expression photoreceptor.Therefore light-gene technology system is not accurate enough when studying definite cell function, research pair As being a general light-gene expression region cell mass.The present invention solve those skilled in the art want for a long time solve but The technical problem not solved, creatively light sensation gene and changeable colour fluorescence protein gene are combined to form on plasmid described Plasmid, it can be used for function of the observation definitely by the cell of light regulation and control and tissue.The cell of the light-gene plasmid is expressed in polished bard Physiological function change can be produced under swashing；The cell for determining to be regulated and controled by light with reference to change in fluorescence indicative function on optical channel.Integrate this A little functions, the plasmid of a kind of brand-new function is generated, it can react those exactly by the cell function of light stimulus, to be more accurate Explain that cell or tissue function provides more convenient, effective tool and method in ground.
According to the embodiment of the present invention, in plasmid of the present invention, the promoter is hSyn, the light sensation Gene is eNpHR3.0, and the changeable colour fluorescence protein gene is Dendra2.Preferably, by the clone method of plasmid, HSyn, eNpHR3.0 and Dendra2 are sequentially connected successively.Because the plasmid has eNpHR3.0 and Dendra2 simultaneously, therefore, The ability that light regulating cell activity is had by light regulating cell can not only be made, also there is discoloration instruction ability, both characteristic knots Being combined makes cell or tissue functional study more flexibly accurate, and the method for this kind of instrument and the application instrument causes life work( It can detect and phenomenon explains the lifting for having matter.
According to the embodiment of the present invention, the plasmid is pAAV-hSyn-eNpHR3.0-Dendra2.Preferably, should ENpHR3.0-Dendra2 gene order such as SEQ ID NO in plasmid:Shown in 2.It is further preferred that pAAV-hSyn- ENpHR3.0-Dendra2 collection of illustrative plates is as shown in Figure 2 b.PUC origin replication initiations position in the plasmid from plasmid is suitable successively Sequence includes gene L-ITR, hSyn, eNphR3.0, Dendra2, WPRE, hGHployA, R-ITR, f1origin and AmPR.
PAAV-hSyn-eNpHR3.0-Dendra2 plasmids of the present invention are prepared to include but is not limited to：Use in conjunction Mfe I is single After enzyme and III single enzymes of Hind cut the EYFP genes in pAAV-hSyn-eNpHR3.0-EYFP plasmids, then in digested plasmid bone Connection uses I single enzymes of Mfe and the single enzyme digestion SEQ ID NO of Hind III on frame pAAV-hSyn-eNpHR3.0:Contain Dendra2 after 1 The fragment of gene.
By the photoreceptor protein fusion light conversion fluorescence albumen of pAAV-hSyn-eNpHR3.0-Dendra2 plasmid expressions Expression is green in tissue, and this state can determine expression effect；When embedded fibers to expression of receptor area and transmit strong Ultraviolet (405nm) or blue light (488nm) light beam irradiation can make illuminated green fluorescent protein be converted into red fluorescent protein, according to This can determine that embedded fibers position and is specifically adjusted cell, such as brain cell by what light beam was irradiated to.
PAAV-hSyn-eNpHR3.0-EYFP is existing plasmid, its can by commercially available, its collection of illustrative plates as shown in Figure 2 a, The plasmid has 1352bp Mfe I and the single endonuclease digestion sites of 2371bp Hind III, III single enzyme of I single enzymes of use in conjunction Mfe and Hind After EYFP genes in the plasmid are cut, then Mfe I is connected through on digested plasmid skeleton pAAV-hSyn-eNpHR3.0 Single single enzyme digestion SEQ ID NO of enzyme and Hind III:The fragment of the gene containing Dendra2 after 1 be it is obtainable as shown in Figure 2 b pAAV-hSyn-eNpHR3.0-Dendra2。
On the other hand, the present invention provides a kind of recombinant virus, and it is to be carried by light-gene plasmid of the present invention through virus Body packaging forms.Preferably, viral vector adeno-associated virus, retrovirus or the slow virus.
As mode of priority, the viral vector is adeno-associated virus.In the embodiment of the present invention, using gland Related viral vectors system introducing gene, substitution method may be selected other channel genes modes, such as retroviral systems, The viral vectors such as slow virus system.
On the other hand, the present invention can provide a kind of recombinant protein, and it is by light-gene plasmid of the present invention or this hair Bright described expression of recombinant virus.
On the other hand, the present invention provides a kind of biomaterial, wherein, the biomaterial contain light of the present invention- Gene plasmid, or recombinant virus of the present invention, or recombinant protein of the present invention.Preferably, the biomaterial is Microorganism, cell or tissue.
On the other hand, the present invention provides a kind of method of smooth regulating cell, and methods described comprises the following steps：
(1) plasmid of the present invention is prepared；Preferably, the plasmid is pAAV-hSyn- of the present invention eNpHR3.0-Dendra2；
(2) plasmid obtained by step (1) is packed using viral vector；Preferably, the viral vector is gland related diseases Poison；
(3) virus injection after step (2) is packed is to treating regulating cell area or tissue；Preferably, this is organized as brain group Knit；
(4) optoelectronic pole is implanted into, light stimulus is carried out under the sensitive wavelength of the photosensitive protein of expression, and records cell physiological change Change；Preferably, light stimulus is carried out under the conditions of wavelength is 593nm；
(5) illumination is carried out under the wavelength of the convertible color of changeable colour fluorescin of expression, marked by the thin of light stimulus Born of the same parents；Preferably, illumination is carried out in 405nm or 488nm；
(6) micro- Microscopic observation is by the cell of light stimulus.
Preferably, plasmid described in step (1) is pAAV-hSyn-eNpHR3.0-Dendra2 of the present invention；
Virus is adeno-associated virus described in step (2)；
Step (3) is that the virus injection after step (2) is packed enters brain tissue；
Step (4) is to carry out light stimulus under the conditions of wavelength is 593nm；
Step (5) is that 405nm or 488nm carries out illumination.
Especially, the accuracy controlling that the method for smooth regulating cell of the present invention is particularly suitable for use in brain tissue, existing light- Expression scope of the gene in brain typically observes fluorescence to determine using brain tissue slice, and expression scope depends on injecting virus Volume and different types of antivirus tool.Similarly, stimulated although the nerve cell of light regulation and control is centered around near light, with current Technological means cannot be distinguished by which brain cell is regulated and controled by light, which express light-gene but be not affected by light regulation and control, also with regard to nothing Method reaches control accurate and the functional analysis of cellular level.The method of the invention applies the plasmid, and this class plasmid is not only The ability of light regulating cell activity with photogene, the discoloration instruction ability also with light conversion fluorescence albumen, both spies Property be combined together and make the research of cell or tissue function more flexibly precisely so that cranial nerve function detects and cerebration phenomenon Explaining has the lifting of matter.
In summary, invention broadly provides a kind of light-gene plasmid and its application, it is true that the plasmid is mainly used in observation Cut the function by the cell of light regulation and control and tissue.Physiological function can be produced under light stimulus by expressing the cell of the light-gene plasmid Change；The cell for determining to be regulated and controled by light with reference to change in fluorescence indicative function on optical channel.These comprehensive functions, the plasmid can be accurate Ground reacts those by the cell function of light stimulus, more convenient, effective more accurately to explain that cell or tissue function provides Tool and method.
Brief description of the drawings
Fig. 1 is the collection of illustrative plates schematic diagram of plasmid of the present invention.
Fig. 2 a are the collection of illustrative plates of pAAV-hSyn-eNpHR3.0-EYFP plasmids in embodiment 1.
Fig. 2 b are the pAAV-hSyn-eNpHR3.0-Dendra2 collection of illustrative plates being prepared in embodiment 1.
Fig. 3 a are the cellular electrophysiologicalsensor variation diagram recorded in embodiment 1 in 593nm laser stimulation connection core.
Fig. 3 b are light organization of regulation control color change process in embodiment 1, wherein, left figure pAAV-hSyn-eNpHR3.0- Dendra2 plasmids are injected at connection core brain area expression effect, and right figure is the area of illumination after 405nm or 488nm light irradiations in optical fiber For red (cell mass being adjusted), non-area of illumination (is not regulated and controled by light for green but expresses pAAV-hSyn- ENpHR3.0-Dendra2 cell mass).
Embodiment
In order to which technical characteristic, purpose and the beneficial effect of the present invention is more clearly understood, in conjunction with specific implementation Example and accompanying drawing to technical scheme carry out it is described further below, it should be understood that these examples be merely to illustrate the present invention without For limiting the scope of the present invention.In embodiment, each Starting reagents material is commercially available, the experiment of unreceipted actual conditions Method is conventional method and normal condition known to art, or according to the condition proposed by apparatus manufacturer.
Embodiment 1
(I) preparation of competent escherichia coli cell
1) fallen within from one single bacterium of picking on Escherichia coli (conventional DH5a bacterial strains) flat board in the test tube of 3ml LB culture mediums, 37 DEG C of shaken cultivations are stayed overnight；
2) 0.4ml bacterium solutions are taken to be transferred in 40ml LB fluid nutrient mediums, 37 DEG C of 2~3h of shaken cultivation；
3) bacterium solution is transferred in 50ml centrifuge tubes, places 10min on ice；
4) 4 DEG C of centrifugation 10min (4000r/min)；
5) nutrient solution is poured out, the mouth of pipe is inverted so that nutrient solution flows to end；
6) precipitated with the 0.1mol/L calcium chloride 10ml suspension cells of ice bath, immediately ice bath 30min；
7) 4 DEG C of centrifugation 10min (4000r/min)；
8) supernatant is poured out, with the 0.1mol/L calcium chloride 2ml suspension cells (placing on ice) of ice bath；
9) cell is dispensed, 200 μ l are a, 4 DEG C of preservations.
(II), the conversion of DNA
1) the 200 freshly prepared competent cells of μ l are taken, adding DNA, (collection of illustrative plates of the plasmid as shown in Figure 2 a, comes Source：http://www.addgene.org/26972/) 2 μ l mixings, ice bath 30min；
2) centrifuge tube is put into 42 DEG C of insulation 90s；
3) ice bath 2min；
4) often pipe adds 800 μ l LB fluid nutrient mediums, 37 DEG C of culture 1h (150r/min)；
5) proper volume (100 μ l) recovery cell is taken, is coated on selective medium, just puts 30min；
6) 37 DEG C of plate is inverted, 12~16h, bacterium colony occurs.
(III) plasmid extraction step
1) bacterium solution of 1~4ml overnight incubations in LB culture mediums is taken, 12000 leave heart 1min, abandon supernatant；
2) plus 250 μ l cell suspending liquids and RNaseA mixed liquor, the violent vibration of whirlpool suspend again completely up to thalline, It is stored at room temperature 1-2min；
3) 250 μ l cell pyrolysis liquids are added, soft overturning repeatedly mixes 5-6 times.Room temperature places 1-2min, fills thalline Division solution, until forming the cracked solution of clarification；
4) 350 μ l neutralizers are added, gently overturns mix 5-6 times repeatedly at once, white flock precipitate now occurs；
5) 12000 room temperatures centrifugation 10min, collects supernatant；
6) supernatant is placed in DNA purification columns, stands 1-2min；
7) 12000 heart 1min is left, abandons filtrate；
8) add 500 μ l cleaning solutions PB12000 leave heart 1min, abandon filtrate, it is therefore an objective to by the albumen adsorbed on pellosil, The Impurity elutions such as salt, to obtain high quality DNA；
9) 500 μ l are added and removes saline solution, 12000 leave heart 1min, abandon filtrate, are repeated once；
10) 12000 heart 3min is left, thoroughly to remove the liquid remained in purification column；
11) DNA purification columns are placed in new centrifuge tube, the dropwise addition 50-100 μ l solution Es that suspend luent (aseptic double-distilled water, PH is 8.0-8.5), room temperature places 2min；
12) 12000 heart 1min is left, now ttom of pipe is the DNA (more than 1 μ g/uL) of high-purity, and plasmid is in -20 DEG C preserve.
(IV) structure of pAAV-hSyn-eNpHR3.0-Dendra2 plasmids
Synthesize sequence as follows (SEQ ID NO:1, existing method is pressed by Nanjing Genscript Biotechnology Co., Ltd. Synthesis)：
ggtatccaattgtgtgggctcttggagtcgagggtatcgcggtgttgcccgttggggtgacgagctggggatattct ttcctggatatcgtggcaaagtacattttcgcattcttgctcctgaactatctgacgtcaaacgaatctgtcgtgtc cggcagcattttggatgttccatctgcttctgggaccccggctgatgatgcgcatgaacaccccgggaattaacctg atcaaggaggacatgcgcgtgaaggtgcacatggagggcaacgtgaacggccacgccttcgtgatcgagggcgaggg caagggcaagccctacgagggcacccagaccgccaacctgaccgtgaaggagggcgcccccctgcccttcagctacg acatcctgaccaccgccgtgcactacggcaaccgggtgttcaccaagtaccccgaggacatccccgactacttcaag cagagcttccccgagggctacagctgggagcgcaccatgaccttcgaggacaagggcatctgcaccatccgcagcga catcagcctggagggcgactgcttcttccagaacgtgcgcttcaagggcaccaacttcccccccaacggccccgtga tgcagaagaagaccctgaagtgggagcccagcaccgagaagctgcacgtgcgcgacggcctgctggtgggcaacatc aacatggccctgctgctggagggcggcggccactacctgtgcgacttcaagaccacctacaaggccaagaaggtggt gcagctgcccgacgcccacttcgtggaccaccgcatcgagatcctgggcaacgacagcgactacaacaaggtgaagc tgtacgagcacgccgtggcccgctacagccccctgcccagccaggtgtggtaacgaattcgatatcaagcttatcga (SEQ ID NO:1) genetic fragment, wherein comprising Dendra2 genes, digestion matter will be inserted after this section of synthetic gene fragment digestion PAAV-hSyn-eNpHR3.0-Dendra2 plasmids, its collection of illustrative plates such as Fig. 2 b institutes are obtained on grain skeleton pAAV-hSyn-eNpHR3.0 Show.
Concrete operation step is：
1) digestion pAAV-hSyn-eNpHR3.0-EYFP
Digestion system：
pAAV-hSyn-eNpHR3.0-EYFP 5μl
10 × M buffer solutions 5μl
Mfe Ⅰ 0.5μl
Hind Ⅲ 0.5μl
H2O 39μl
Amount to 50μl
Reaction condition：37 DEG C, overnight.
Electrophoresis runs glue, 120v, 35min.
Recovery 5134bpDNA fragments are dissolved in 20 μ l distilled waters.
2) digestion SEQ ID NO:1
Digestion system：
SEQ ID NO:1 5μl
10 × M buffer solutions 5μl
Mfe Ⅰ 0.5μl
Hind Ⅲ 0.5μl
H2O 39μl
Amount to 50μl
Reaction condition：37 DEG C, overnight.
Electrophoresis runs glue, 120v, 35min.
Recovery 907bpDNA fragments are dissolved in 20 μ l distilled waters.
3) 5134bpDNA fragments and SEQ ID NO after connection plasmid backbone pAAV-hSyn-eNpHR3.0 digestions:1 digestion 907bpDNA fragments afterwards
Linked system：
Condition of contact：5h is connected at 16 DEG C.
Connection product is pAAV-hSyn-eNpHR3.0-Dendra2 plasmids, eNpHR3.0-Dendra2 in the plasmid Gene order such as SEQ ID NO:Shown in 2.
PAAV-hSyn-eNpHR3.0-Dendra2 plasmids obtain high according to preceding step (I), (II), (III) step successively The DNA (more than 1 μ g/uL) of purity, plasmid is in -20 DEG C of preservations；
PAAV-hSyn-eNpHR3.0-Dendra2 is cut by Kpn I and SanD I, then with T4 polymerases, in ra2yn- ENpHR3.0 end-fillings, last T4DNA ligases connection can obtain pAAV-hSyn-Dendra2 plasmids, for contrast ratio Compared with.Concrete operation step：
1) digestion pAAV-hSyn-eNpHR3.0-Dendra2
Digestion system：
pAAV-hSyn-eNpHR3.0-Dendra2 5μl
10 × L buffer solutions 5μl
Kpn Ⅰ 0.5μl
SanD Ⅰ 0.5μl
H2O 39μl
Amount to 50μl
Reaction condition：37 DEG C, overnight.
Electrophoresis runs glue, 120v, 35min.
Recovery 5134bpDNA fragments are dissolved in 20 μ l distilled waters.
2) end smoothing reaction
A) following reaction solution (μ l of cumulative volume 9) is prepared in microcentrifugal tube.
Note：DNA fragmentation must pass through ethanol precipitation.
B) 70 DEG C are incubated 5 minutes, are then transferred to 37 DEG C of insulations.
C) 1 μ l T4 archaeal dna polymerases are added, it is soft to mix (acutely vibrate).
D) 37 DEG C are reacted 5 minutes.(the relatively low DNA of G/C content, then 25 DEG C of reactions.)
If e) DNA concentration is very high, DNA dilution buffers are added, DNA concentration is reached 1 μ g/50 μ l, and fierce vibration, T4DNA polymerases are inactivated, are subsequently placed on ice, are ready for reacting in next step.If necessary to preserve reaction solution, then do immediately Phenol processing, ethanol precipitation.DNA precipitations are with the dissolving of DNA dilution buffers after -20 DEG C of preservations.
3) fragment after the smoothing of pAAV-hSyn-eNpHR3.0-Dendra2 fragments (I/SanD of Kpn I) end is connected certainly
Linked system：
Condition of contact：5h is connected at 16 DEG C.
Connection product is pAAV-hSyn-Dendra2 plasmids.
PAAV-hSyn-Dendra2 plasmids obtain the plasmid of high-purity according to preceding step (I), (II), (III) step successively DNA (more than 1 μ g/ μ L), plasmid is in -20 DEG C of preservations；
(V) pAAV-hSyn-eNpHR3.0-Dendra2 glands are packed according to AAV Helper-Free System operating procedures Correlated virus, it is standby.Concrete operation step：
(A) AAV-293 cells freeze
1) remove cell culture supernatant, add the culture medium that PBS washes away residual.
2) 0.25% pancreatin is added, after digesting 1~2min, Microscopic observation cell rounding, when intercellular gap increases, is gone Except pancreatin, add fresh culture piping and druming and mix, move into centrifuge tube.
3) cell count, under cell is all shaken, the 10%DMEM of 37 DEG C of preheatings of 3mL is added, is carried out with 10mL pipettes Piping and druming, blow and beat 6-8 times more energetically, do not stay dead angle, afterwards, all cells are suctioned out and are placed in 15mL centrifuge tubes, take 50 μ l Cell after mixing adds 450 μ l10%DMEM, as 10 times dilutions, mixes, take 10 μ l in 1.5mL eppendorf pipes Cell counts in tally.Totally 4 big lattice on tally, per big 16 small lattice of lattice.During counting, 4 big lattice count, sum divided by 4 (obtaining per big lattice cell number), multiplied by with 10 (10 times of dilutions), as actual ten thousand/mL of n cell concentrations.
4) cell centrifuges, 1000rpm/min, 5min.Remove supernatant.
5) cells frozen storing liquid (70% complete medium+20%FBS+10%DMSO) is added according to cell counts to be resuspended Cell, density are 3 × 106Individual/ml.
6) dispense into cell cryopreservation tube, be put into freezing storing box, be put into -80 DEG C of ultra low temperature freezers.
(B) recovery of AAV-293 cells
When passage number is excessive, when cell state is deteriorated, or, it is necessary to abandon and right when contamination accident occurs in cell The cell initially frozen is recovered.
1) water-bath that temperature is 37~42 DEG C is set.
2) check cell bank record, according to record taken out from liquid nitrogen container freeze cell (mitten need to be put on, prevent by Frostbite), lose rapidly in water-bath and quickly rock, be completely dissolved cell solution in 1~2min as far as possible.
3) cell solution is transferred in 15ml centrifuge tubes, and complete medium fresh plus 1ml wherein, after mixing Centrifugation, 1000rpm/min, 5min.
4) remove supernatant, add the fresh complete mediums of 5ml, after mixing precipitation, be transferred to 6cm culture dishes.
5) culture dish is steadily put into 37 DEG C, 5%CO2Cultivated with the incubator of 95% relative humidity.
6) second day observation cell survival rate.Culture medium is changed to cell.Observe cell growth status daily later.
(C) passage of AAV-293 cells
When cell growth needs to carry out passage operation to cell to converging when rate reaches 80%~90%, to expand cell number Amount, maintain the good growth conditions of cell.
1) vitellophag, the same cell cryopreservation of method.
2) after cell centrifugation terminates, add complete medium and be resuspended.
3) as the case may be, cell is assigned in 10cm culture dishes, each culture dish supplies 10ml culture mediums.
(D) AAV packagings and concentration etc.
1) AAV carriers, packaging plasmid and the helper plasmid that plasmid amplification is built need to pass through a large amount of extractings, and concentration is more than 1 μ G/ μ l, A260/280 can be wrapping poison between 1.7-1.8.Recommend a large amount of the going that Qiagen takes out greatly kit progress plasmid Endotoxin extracts.
2) AAV-293 cells are passed the culture medium cultivated in AAV-293 cell T75 bottles exhausts, adds 2mL4 DEG C of refrigerator and take 0.25% pancreatin gone out, make its uniform fold bottom of bottle, be placed in 3-5min in 37 DEG C of incubators, take out, rock can find cell in Bottom departs from, and under it is all shaken, adds in 37 DEG C of water-baths of 3mL the 10%DMEM preheated, liquid-transfering gun is carried out with 10mL pipettes Piping and druming, blow and beat 6-8 times more energetically, do not stay dead angle, pipette can be directed at training mouth by the more difficult piping and druming of bottle mouth position, and small power will cultivate Base gets the cell that can be covered close to bottleneck.Afterwards, all cells are suctioned out, be placed in 15mL centrifuge tubes, take 50 μ l to mix Cell after even adds 450 μ l 10%DMEM, as 10 times dilutions, mixes, take 10 μ l thin in 1.5mL eppendorf pipes Born of the same parents count in tally.Totally 4 big lattice on tally, per big 16 small lattice of lattice.During counting, 4 big lattice count, sum divided by 4 ( Per big lattice cell number), multiplied by with 10 (10 times of dilutions), as actual ten thousand/mL of n cell concentrations.The passage same day is designated as first day, if Transfected within second day, ten thousand/T75 of paving 900-1000；If the 3rd day transfects, ten thousand/T75 of paving 350-400.Every bottle of T75 adds 10mL 10%DMEM culture mediums.Transfection same day observation cell density, 80-90% can be transfected.Culture medium need not be changed before transfection.
3) prepare fat and turn compound (complex)
Reagent name amount of reagent
The μ l of vector plasmid 5 (1.0 μ g/ μ l)
The μ l of packaging plasmid 5 (1.0 μ g/ μ l)
The μ l of helper plasmid 5 (1.0 μ g/ μ l)
LipofectamineTM2000 helper plasmid mixtures are transferred to cell
4) AAV viruses receive poison：Virion is present in incasing cells and culture supernatant simultaneously.Can be by cell and culture Supernatant all is collected to obtain best yield.
A) prepare a dry ice ethanol bath and (ethanol is poured into the foam box equipped with dry ice, it is also possible to liquid nitrogen alternative dry Ice ethanol bath) and 37 DEG C of water-baths；
B) cell for producing poison is together collected into 15ml centrifuge tube together with culture medium.When collecting cell, it will train Disk inclination certain angle is supported to scrape cell in culture medium；
C) 1000rpm/min, centrifuge 3 minutes, separate cell and supernatant, supernatant is deposited in addition, cell 1ml PBS weights It is outstanding；
D) cell suspending liquid is shifted repeatedly in dry ice ethanol bath and 37 DEG C of water-baths, freeze thawing four times.After melting every time slightly Add concussion.Pay attention to：Solidification and defrosting probably need the time of ten minutes every time.
5) AAV viral concentrations：
A) 10,000g centrifugations remove cell fragment, and centrifugation supernatant is transferred in a new centrifuge tube.
B) supernatant collected twice is mixed, with 0.45 μm of filter filtering and impurity removing matter.
C) 1M NaCl, the 10%PEG8000 solution of 1/2 volume is added, is well mixed, 4 DEG C overnight.
D) 12,000rpm centrifuges 2h, abandons supernatant, and viral pellet is dissolved with appropriate PBS solution, used until completely dissolved 0.22 μm of filter filtration sterilization.
E) DNA (final concentration of 50U/ml) that nuclease (Benzonase) digestion removes residual is added.Close pipe Lid, overturn several times to be sufficiently mixed.It is incubated 30 minutes at 37 DEG C；
F) filtered with 0.45 μm of filtering head, take filter liquor, the AAV viruses as concentrated.
6) AAV purifying
A) solid CsCl is added into viral concentration liquid until density is 1.41g/ml (refractive index 1.372)；
B) sample is added in ultracentrifugation pipe, it is with the 1.41g/ml CsCl solution prepared in advance that centrifuge tube is remaining Space is filled up；
C) centrifuged 24 hours under 175,000g, to form density gradient.The sample of Fraction collection different densities in order, Sampling carries out titer determination.Collect the component for being enriched with AAV particles；
D) said process is repeated once.
E) virus is loaded to 100KDa bag filter, 4 DEG C of dialysis desaltings are stayed overnight, and this is the AAV viruses purified.
7) AAV virus packaging titer determinations (using Q-PCR methods)
A) 20 μ l concentrating virus liquid are taken, add 1 μ l RNAse-free DNAse, are mixed, 37 DEG C of water-bath 30min.
B) 4 DEG C, 12 000rpm/min, 10min is centrifuged, takes 10 μ l supernatants into another sterile 1.5ml EP pipe.
C) add 90 μ l dilution buffers (Dilution Buffer, 1mM Tris-HCl, pH 8.0,0.1mM EDTA, 150mM NaCl), mix, 37 DEG C of metal baths react 30min.
D) room temperature is naturally cooled to, adds 1 μ l Proteinase Ks, 65 DEG C of water-bath 1h.
E) 100 DEG C of metal bath reaction 10min, naturally cool to room temperature.
F) progress Q-PCR detections titre, 5.0 × 1012IU/mL or so.
8) storage, the dilution of AAV viruses
A) viral storage：
Tested, virus can be temporarily positioned over using adeno-associated virus within a very short time after receiving virus liquid 4 DEG C of preservations；Long-term preserve such as is needed to be positioned over -80 DEG C (virus is placed in cryopreservation tube, and is sealed using sealed membrane).
I) virus can deposit in -80 DEG C more than 6 months；But if viral storage time was more than 6 months, it is proposed that is using Before need to redeterminate virus titer.
Ii) multigelation can reduce virus titer：Each freeze thawing can reduce virus titer 10%；Therefore used in virus Cheng Zhongying avoids multigelation as far as possible, to avoid multigelation, it is proposed that dispensed after receiving virus according to each usage amount.
B) viral dilution：
If necessary to dilute virus, virus taking-up is placed in after ice bath melts, uses PBS or culture aim cell Serum free medium (does not influence containing serum or viral infection) containing dual anti-.4 DEG C of preservations (were used in three days as far as possible after mixing packing It is complete) packing after use.
(VI) application of pAAV-hSyn-eNpHR3.0-Dendra2 plasmids
Concrete operation step：
1) 50mg/kg is anaesthetized to mouse injection yellow Jackets, is fixed on stereotaxic apparatus；
2) core (AP is connected:-1.0mm；ML:0.0mm；DV:3.8mm) drilling and with a diameter of 10-20 μm of exterior tip Glass micro syringe carries out pressure injection 100nL 3.0 × 1012VP/Ml pAAV-hSyn-eNpHR3.0-Dendra2 or PAAV-hSyn-Dendra2 correlated virus；
3) slowly injection (50nL/min), after having injected, let the acupuncture needle remain at a certain point 10 minutes, slowly draws back syringe, sews up a wound；
4) expressing viral is after 3 weeks, in connection core (AP:-1.0mm；ML:0.0mm；DV:3.8mm) it is implanted into optoelectronic pole；
5) mouse recovers one week, and 593nm laser stimulation connection core simultaneously records cellular electrophysiologicalsensor change, as a result such as Fig. 3 a institutes Show, wherein, a is injection pAAV-hSyn-eNpHR3.0-Dendra2 mouse in Fig. 3 a, does not record electricity to light stimulus single neuron Signal, b are injection pAAV-hSyn-eNpHR3.0-Dendra2 mouse, stimulate single neuron to record electric signal to 593nm gold-tinteds, C is injection pAAV-hSyn-Dendra2 mouse, stimulates single neuron to record electric signal to 593nm gold-tinteds；Compare in Fig. 3 a three groups Data can be seen that injection pAAV-hSyn-eNpHR3.0-Dendra2 mouse, and neuron is suppressed during to light stimulus.
6) 10% amobarbital deep anaesthesia 3 injected pAAV-hSyn-eNpHR3.0-Dendra2 mouse, through heart Irrigate physiological saline and 4% paraformaldehyde fixes mouse brain, take out brain and fixed after 4% paraformaldehyde overnight, then 30% sugarcane Sugar dehydration two days；
7) the 3 laser irradiation connection core for injecting pAAV-hSyn-eNpHR3.0-Dendra2 mouse 405nm or 488nm Brain area, mark by the cell of light stimulus；
8) the treated mouse of the step of 10% amobarbital deep anaesthesia the 7th, through heart perfusion physiological saline and 4% poly first Aldehyde fixes mouse brain, takes out brain and is fixed after 4% paraformaldehyde overnight, then 30% sucrose is dehydrated two days；
9) 6 mouse brains of frozen section, connection core (AP is taken:-1.0mm；ML:0.0mm；DV:3.8mm) organize to read under microscope Piece, as a result as shown in Figure 3 b, left hand view are pAAV-hSyn-eNpHR3.0- in the laser irradiation control group mouse brain without 488nm Dendra2 luciferase expression effect, right figure are pAAV-hSyn- in the laser irradiation control group mouse brain through 405nm or 488nm ENpHR3.0-Dendra2 luciferase expression effect.Compare two width figures in Fig. 3 b to can be seen that by laser conversion discoloration (conversion Into red, arrow meaning part) cell or tissue arrived by light stimulus can be found well.
In summary step, the present invention in plasmid can react those exactly by the cell function of light stimulus.
What is finally illustrated is：Above example is merely to illustrate the implementation process and feature of the present invention, and unrestricted is sent out Bright technical scheme, although the present invention is described in detail with reference to above-described embodiment, one of ordinary skill in the art should Work as understanding：The present invention can still be modified or equivalent substitution, without departing from the spirit and scope of the present invention any Modification or local replacement, all should cover among protection scope of the present invention.

Claims (10)

1. a kind of light-gene plasmid, wherein, the plasmid includes promoter, light sensation gene and changeable colour fluorescence protein gene.
2. light-gene plasmid according to claim 1, wherein, the changeable colour fluorescence protein gene include EosFP, Dendra2, Kaede or mKikGR.
3. plasmid according to claim 1 or 2, wherein, the light sensation gene include ChR2, eNpHR3.0, C1V1, ChETA or ArchT.
4. light-gene plasmid according to claim 1 or 2, wherein, the promoter include Ef1a, CaMKIIa, hSyn, CAG, Fos, PV or TH；
Preferably, in the light-gene plasmid, the promoter is hSyn, and the light sensation gene is eNpHR3.0, and described Changeable colour fluorescence protein gene is Dendra2.
5. light-gene plasmid according to claim 4, wherein, the plasmid is pAAV-hSyn-eNpHR3.0-Dendra2；
Preferably, eNpHR3.0-Dendra2 gene order such as SEQ ID NO in the plasmid:Shown in 2；
It is highly preferred that pAAV-hSyn-eNpHR3.0-Dendra2 collection of illustrative plates is as shown in Figure 2 b.
6. light-gene plasmid preparation method described in claim 5, wherein, methods described include I single enzymes of use in conjunction Mfe and After III single enzymes of Hind cut the EYFP genes in pAAV-hSyn-eNpHR3.0-EYFP plasmids, then in digested plasmid skeleton Connection uses I single enzymes of Mfe and the single enzyme digestion SEQ ID NO of Hind III on pAAV-hSyn-eNpHR3.0:Contain Dendra2 after 1 The fragment of gene.
7. a kind of recombinant virus, it is to be packed by light-gene plasmid according to any one of claims 1 to 5 through viral vector Form；Preferably, described viral vector is adeno-associated virus, retrovirus or slow virus.
8. a kind of recombinant protein, it is as shown in light-gene plasmid according to any one of claims 1 to 5 or claim 6 Expression of recombinant virus.
9. a kind of biomaterial, wherein, the biomaterial contains light according to any one of claims 1 to 5-gene matter Grain, or the recombinant virus shown in claim 6, or the recombinant protein described in claim 7；
Preferably, the biomaterial is microorganism, cell or tissue.
10. a kind of method of smooth regulating cell, methods described comprise the following steps：
(1) light-gene plasmid according to any one of claims 1 to 5 is prepared；
(2) plasmid obtained by step (1) is packed using viral vector；
(3) virus injection after step (2) is packed is to treating regulating cell area or tissue；
(4) optoelectronic pole is implanted into, light stimulus is carried out under the sensitive wavelength of the photosensitive protein of expression, and records cell physiological change；
(5) illumination is carried out under the wavelength of the convertible color of changeable colour fluorescin of expression, marked by the cell of light stimulus；
(6) micro- Microscopic observation is by the cell of light stimulus；
Preferably, light-gene plasmid described in step (1) is the pAAV-hSyn-eNpHR3.0-Dendra2；
Virus is adeno-associated virus described in step (2)；
Step (3) is that the virus injection after step (2) is packed enters brain tissue；
Step (4) is to carry out light stimulus under the conditions of wavelength is 593nm；
Step (5) is that 405nm or 488nm carries out illumination.
CN201610619893.7A 2016-08-01 2016-08-01 A kind of photogene plasmid and its application Pending CN107674879A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201610619893.7A CN107674879A (en) 2016-08-01 2016-08-01 A kind of photogene plasmid and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201610619893.7A CN107674879A (en) 2016-08-01 2016-08-01 A kind of photogene plasmid and its application

Publications (1)

Publication Number Publication Date
CN107674879A true CN107674879A (en) 2018-02-09

Family

ID=61133728

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201610619893.7A Pending CN107674879A (en) 2016-08-01 2016-08-01 A kind of photogene plasmid and its application

Country Status (1)

Country Link
CN (1) CN107674879A (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020083398A1 (en) * 2018-10-26 2020-04-30 山东大学 Real-time screening and measurement system for cell-specific photosensitive effect and method thereof
CN111690683A (en) * 2020-05-08 2020-09-22 天津大学 Design method of photosensitive protein plasmid sensitive to green light
CN114606268A (en) * 2020-12-08 2022-06-10 中国科学院深圳先进技术研究院 BV2 tool cell sensitive to light and construction method and application thereof
CN114921480A (en) * 2022-06-09 2022-08-19 国科宁波生命与健康产业研究院 Construction method of bone cell Terc gene knockout mouse model

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101518483A (en) * 2009-03-26 2009-09-02 深圳先进技术研究院 Biological vision assisting system
CN101760443A (en) * 2010-01-06 2010-06-30 深圳先进技术研究院 Method for constructing photo-sensitive inductivity multifunctional stem cell graft
CN103898160A (en) * 2012-12-25 2014-07-02 中国科学院深圳先进技术研究院 Recombinant vector for expressing light-sensitive type adenylate cyclase, applications and construction method of the recombinant vector and treating system for demyelination
CN104350372A (en) * 2012-08-09 2015-02-11 斯坦福大学托管董事会 Methods and compositions for preparing biological specimens for microscopic analysis
CN102643852B (en) * 2011-02-28 2015-04-08 华东理工大学 Optical controllable gene expression system
CN104711281A (en) * 2013-12-11 2015-06-17 中国科学院深圳先进技术研究院 LAMP1 green fluorescence expression vector and preparation method and application of LAMP1 green fluorescence expression vector
CN109628415A (en) * 2018-12-13 2019-04-16 中国科学院深圳先进技术研究院 Three-level neural circuitry manipulates composition and animal three-level neural circuitry method of operating

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101518483A (en) * 2009-03-26 2009-09-02 深圳先进技术研究院 Biological vision assisting system
CN101760443A (en) * 2010-01-06 2010-06-30 深圳先进技术研究院 Method for constructing photo-sensitive inductivity multifunctional stem cell graft
CN102643852B (en) * 2011-02-28 2015-04-08 华东理工大学 Optical controllable gene expression system
CN104350372A (en) * 2012-08-09 2015-02-11 斯坦福大学托管董事会 Methods and compositions for preparing biological specimens for microscopic analysis
CN103898160A (en) * 2012-12-25 2014-07-02 中国科学院深圳先进技术研究院 Recombinant vector for expressing light-sensitive type adenylate cyclase, applications and construction method of the recombinant vector and treating system for demyelination
CN104711281A (en) * 2013-12-11 2015-06-17 中国科学院深圳先进技术研究院 LAMP1 green fluorescence expression vector and preparation method and application of LAMP1 green fluorescence expression vector
CN109628415A (en) * 2018-12-13 2019-04-16 中国科学院深圳先进技术研究院 Three-level neural circuitry manipulates composition and animal three-level neural circuitry method of operating

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
ARISTIDES B. ARRENBERG等: "Optical control of zebrafish behavior with halorhodopsin", 《PNAS》 *
DMITRIY M. CHUDAKOV等: "Using photoactivatable fluorescent protein Dendra2 to track protein movement", 《BIOTECHNIQUES》 *
HYUNG-SU KIM: "Selective Control of Fear Expression by Optogenetic Manipulation of Infralimbic Cortex after Extinction", 《NEUROPSYCHOPHARMACOLOGY》 *
VIVIANA GRADINARU等: "Molecular and Cellular Approaches for Diversifying and Extending Optogenetics", 《CELL》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020083398A1 (en) * 2018-10-26 2020-04-30 山东大学 Real-time screening and measurement system for cell-specific photosensitive effect and method thereof
CN111690683A (en) * 2020-05-08 2020-09-22 天津大学 Design method of photosensitive protein plasmid sensitive to green light
CN114606268A (en) * 2020-12-08 2022-06-10 中国科学院深圳先进技术研究院 BV2 tool cell sensitive to light and construction method and application thereof
CN114921480A (en) * 2022-06-09 2022-08-19 国科宁波生命与健康产业研究院 Construction method of bone cell Terc gene knockout mouse model

Similar Documents

Publication Publication Date Title
CN107674879A (en) A kind of photogene plasmid and its application
CN104762324B (en) Method using Runx2 and micromolecular compound induction human fibroblasts reprogramming for Gegenbaur's cell
CN108588026A (en) The preparation method and its usage of the clinical grade mescenchymal stem cell of height expression IL10
CN109988746A (en) A kind of mescenchymal stem cell adipogenic induction differentiation method
CN104099371A (en) Application of KAP26.1 gene as exogenous gene introduced into cashmere goat cells and used for improving wool fineness
CN102212535A (en) Construction and identification of over-expression lentivirus vector of rat GSK-3 beta (Glycogen Synthase Kinase-3 beta) target gene
CN104313054A (en) Human hematopoietic stem cell expressing human exogenous proinsulin and application thereof
CN109680006A (en) A kind of construction method of stable expression cytochrome C protein cell strain
CN109735568A (en) Stablize the construction method of expression FGF-1 albuminous cell strain
CN108774633A (en) It is a kind of for Cerebral Infarction Treatment simultaneously can be by the neural stem cell preparation of magnetic resonance and fluorescence imaging bimodal tracer
CN105039342A (en) siRNA capable of inhibiting MAT2A genetic expression and application of siRNA
CN107964536A (en) A kind of hematopoietic stem/progenitor cells potent method transplanted in vivo in the induced multi-potent stem cell source for realizing people
CN107557391A (en) Based on the canine distemper sensitive cell line method for building up of Nectin4 acceptors and application
CN110029086A (en) The factor of inducing somatic reprogramming and the method reprogrammed using the factor inducing somatic
CN108130314A (en) A kind of monoclonal cell cultural method
CN113088532B (en) Gene expression switch for regulating and controlling red light and far-red light as well as construction method and application thereof
CN105567737A (en) Construction and application of miRNA-34a overexpression recombinant vector
CN105420275A (en) Method for preparing exogenous functional gene targeted integration human neural stem cells
CN108795987A (en) A kind of neural stem cell preparation method and application of FerritinH, Bcl2 and EGFP gene combined modification
CN101302529A (en) Transgenic neural stem cell co-expressing GDNF and BDNF
CN108570100A (en) Cotton fiber stretches transcription factor GhbHLH18 and its application of long-term expression
CN110117618A (en) A kind of labeling method of Sepiella maindroni archaeocyte
CN1872997A (en) New technique for culturing stem cells (carrying therapy gene) of human's xenogenic stromata in large-scale
CN114480309B (en) shRNA lentivirus for inhibiting ALKBH1 expression and preparation and application thereof
WO2024044892A1 (en) Modified vector of aav-8 serotype for gene targeting and expression, construction method therefor, and use thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20180209