CN102212535A

CN102212535A - Construction and identification of over-expression lentivirus vector of rat GSK-3 beta (Glycogen Synthase Kinase-3 beta) target gene

Info

Publication number: CN102212535A
Application number: CN 201110088018
Authority: CN
Inventors: 单云峰; 谢元康
Original assignee: Individual
Current assignee: Individual
Priority date: 2011-04-08
Filing date: 2011-04-08
Publication date: 2011-10-12

Abstract

The invention discloses construction of an over-expression lentivirus vector of a rat GSK-3 beta (Glycogen Synthase Kinase-3 beta) target gene, comprising the following steps of: tagging the GSK-3 beta target gene by using a PCR (Polymerase Chain Reaction) method; performing directional exchange on the GSK-3 beta target gene and an enzyme-cutting linear vector to obtain a product; converting the product into bacterial competent cells; performing bacterial colony PCR identification on grown clones; and sequencing positive clones identified by the PCR. The invention further discloses identification of the over-expression lentivirus vector of the rat GSK-3 beta target gene, comprising the following steps of: transfecting rat WB-F344 (Western Blot F344) cells by the target gene over-expression lentivirus vector, a vacuolating virus vector and physiological saline; after achieving optimal infection multiplicity, observing expression of fluorescent protein; and detecting the expression condition by adopting Western Blot. According to the construction and identification disclosed by the invention, action mechanisms of the GSK-3 beta in organisms and related diseases thereof can be known deeply; pathogenesis of the diseases can be known better; and a foundation for future clinical application can be laid.

Description

Rat GSK-3 β goal gene is crossed the expression lentiviral vectors and is made up and identify

Technical field

The invention belongs to molecular biology and biological medicine technology field, be specifically related to rat GSK-3 β goal gene and cross expression lentiviral vectors construction process, and rat GSK-3 β goal gene is crossed expression lentiviral vectors authentication method.。

Background technology

The full name of GSK-3 β is glycogen synthase kinase-3 β, GSK-3 β, and promptly glycogen synthase kinase-3 β is a kind of protein serine/threonine, extensively is present in various cells, is an enzyme that constitutes multi-functional expression.GSK-3 β begins only to be found storage and the metabolism that participates in muscular energy, but along with going deep into of research, it is found that this enzyme not only acts on Wnt, Notch and many cell signal paths such as hedgehog, insulin signaling conduction, and all play important regulatory role at aspects such as the generation of the generation of apoptosis, genetic expression, cell proliferation and differentiation, tumour, Invasion and Metastasis, diabetes and development.In view of GSK-3 β in numerous disease such as diabetes, tumour, other nervous system disorderss of bipolar affective disorder and senile dementia and some take place, the influence of progress, and its research is also more and more become focus.

Along with intensification and the development of biology to disease molecular mechanism understanding, gene therapy has become the new focus of treatment infectious diseases, genetic diseases, nervous system disorders and tumour.Be used for the Vectors in Gene Therapy system and can be divided into viral carrier and non-viral carrier two classes.Virus vector commonly used at present comprises retroviral vector, adenovirus carrier, gland relevant viral vector, herpesvirus vector, vaccinia virus vector etc., but all there is weak point in these carriers, have had a strong impact on the validity and the security of gene therapy.The subject matter that the retroviral vector of widespread use exists in gene therapy, it is the non-division stage cell of efficiently to transduce, and though adenovirus carrier can be transduceed non-division stage cell, but can not realize the long-term expression that goal gene is stable in vivo, and application causes immune response easily repeatedly.Lentiviral vectors not only can infect non-division stage cell, also has advantages such as the exogenous target gene of holding fragment is big, immune response is little, is with a wide range of applications in gene therapy.

Summary of the invention

In order to solve the technological deficiency of above-mentioned existence, first purpose of the present invention provides a kind of rat GSK-3 β goal gene and crosses the construction process of expression lentiviral vectors and cross the expression lentiviral vectors according to the rat GSK-3 β goal gene that this construction process obtains, second purpose of the present invention provides rat GSK-3 β goal gene and crosses the authentication method of expressing lentiviral vectors, make people understand the mechanism of action of GSK-3 β more in depth, for the cell therapy and the gene therapy of relative disease lays the first stone.

In order to realize first above-mentioned purpose, the present invention has adopted following technical scheme:

A kind of rat GSK-3 β goal gene is crossed the expression lentiviral vectors and is made up, and this construction process may further comprise the steps,

1. the linearization for enzyme restriction lentiviral vectors of lentiviral vectors adopts the pGC-FU carrier, cuts digestion lentiviral vectors pGC-FU with restriction enzyme A ge I enzyme, reclaims the pGC-FU fragment.

The endonuclease reaction system and the reaction conditions of lentiviral vectors are as follows:

Reagent	Add-on	Concentration
			ddH2O	42μl	/
10×buffer1	5μl	/
			The DNA plasmid of purifying	2μl	1 ug/μl

Age I	1μl	5 U/μl
			Total	50μl	/

Temperature of reaction is 37 ℃ of reaction times 2 h.

2. primer is synthetic: Synthetic 2 bar primer, and sequence is as follows:

The primer title	Primer sequence
		Gsk3b-AgeI-F	GAGGATCCCCGGGTACCGGTCGCCACCATGTCGGGGCGACCGAGAACC
Gsk3b-Age I-R	TCACCATGGTGGCGACCGGGGTAGAGTTGGAGGCTGATG

Contain the exchange pairing base among the primer Gsk3b-Age I-F, ACCGGT is an Age I restriction enzyme site, CGCCACC contains the exchange pairing base for expressing enhancement sequences among the primer Gsk3b-Age I-R, ACCGG(has removed the T base in order to adjust reading frame) be Age I restriction enzyme site;

3. target gene fragment obtains the gene fragment that adopts the dna sequence dna contain GSK-3 β goal gene, angle with Gsk3b-Age I-F and Gsk3b-Age I-R and to get GSK-3 β goal gene, to angling the GSK-3 β goal gene of getting to carry out pcr amplification, obtain the PCR product;

As preferably, the pcr amplification reaction system is as follows:

Reagent	Add-on	Concentration
			ddH ₂ O	12.4μl	/
5×Taqbuffer	4.0μl	/
			DNTPs	1.6μl	2.5mM
Primer(+)	0.4μl	10μM
			Primer(-)	0.4μl	10μM
Template	1.0μl	10ng/μl
			Taqpolymerase	0.2μl	/

As preferably, the pcr amplification reaction condition is as follows:

Temperature	Time	Circulation
				94℃	5min	/
94℃	30''	30cycles
			55℃	30''	30cycles
72℃	1.5min	30cycles
			72℃	10min	/
4℃	∞	/

4. the GSK-3 β goal gene structure of crossing the purpose plasmid of expressing lentiviral vectors will contain the PCR product purification of GSK-3 β goal gene, lentiviral vectors with PCR product behind the purifying and linearization for enzyme restriction carries out the orientation exchange again, to exchange product transformed into escherichia coli competent cell, extract and purification, select transformant and continue to cultivate;

As preferred again, it is as follows that the lentiviral vectors of PCR product and linearization for enzyme restriction carries out directed reaction system and the reaction conditions that exchanges:

Reaction system (μ l):	Positive control	From connecting contrast	The exchange group
				ddH2O	17.5-X-Y	17.5-X	17.5-X-Y
10 In-Fusion convertase damping fluid*	2	2	2
				Linearized vector DNA	X	X	X
The PCR product of purifying	Y	0	Y
				The In-Fusion convertase	0.5	0.5	0.5
Total	20	20	20

Above-mentioned reactant is prior to 25 ℃ of reaction 30min, again in 42 ℃ of reaction 15min;

5. the detection of GSK-3 β destination gene expression slow virus carrier purpose plasmid is carried out subsequent P CR evaluation to the clone body that grows needs synthetic 3 detection primers:

The primer title

Primer sequence

Gsk3b-SEQF	CGCACTGTGTAGCCGTCTCC
		EGFP-N-R	CGTCGCCGTCCAGCTCGACCAG
Ubi-F	GGGTCAATATGTAATTTTCAGTG

The PCR tests positive can tentatively be judged as transformed clone, and the clone that PCR is positive carries out dna sequencing;

As preferred again, PCR detection reaction system and reaction conditions are as follows:

Reagent	Add-on	Concentration
			ddH ₂ O	12.4μl	/
5×Taqbuffer	4.0μl	/
			DNTPs	1.6μl	2.5mM
Primer(+)	0.4μl	10μM
			Primer(-)	0.4μl	10μM
Template	1.0 ul	1010ng/μl
			Taqpolymerase	0.2 ul	/

PCR detection reaction condition is as follows:

Temperature	Time	Circulation
				94℃	2min	/
94℃	30''	30cycles
			60℃	30''	30cycles
72℃	30''	30cycles
			72℃	6min	/
4℃	∽	/

6. the packing of GSK-3 β destination gene expression slow virus carrier purpose plasmid preparation coding slow virus particulate recombinant virus plasmid pGC-LV carrier and two kinds of auxiliary package original paper vector plasmid pHelper 1.0 carriers thereof and pHelper 2.0 carriers, three kinds of plasmid carriers carry out high purity is not respectively had the intracellular toxin extracting, and carry out cotransfection 293T cell, continue after the transfection to cultivate, results and concentrated, obtain the slow virus concentrated solution of high titre after it is concentrated, in the 293T cell, measure and demarcate virus titer.

Step of the present invention GSK-3 β goal gene is 4. crossed in the structure of the purpose plasmid of expressing lentiviral vectors, the carrier of GSK-3 β target gene PCR product and linearization for enzyme restriction carries out directed exchange and is connected under 25 the temperature and carries out, convertase is the In-Fusion convertase, the permutoid reaction time is 30 minutes, under 42 ℃ temperature, reacted 15 minutes again after finishing, prepare exchange liquid.

Competent escherichia coli cell is by CaCl ₂Prepare, exchange product transformed into escherichia coli competent cell comprises the exchange liquid adding competent escherichia coli cell that exchanges product with containing, the uniform mixing content, in ice, placed 30 minutes, again mixture is carried out 42 ℃ water-bath, take out to leave standstill after 90 seconds mixture is transferred in the ice bath fast, cooled off 1～2 minute, the LB substratum that adds 800ul, recovery is 45 minutes on 37 ℃ of shaking tables; 150 μ l are transferred on the LB nutrient agar of AMP resistance, place greenhouse to liquid to be absorbed, in 37 ℃ of cultivations 16 hours, select transformant again, cultivate again.

A kind of rat GSK-3 β goal gene is crossed the expression lentiviral vectors, and this carrier obtains according to above-mentioned construction process.

In order to realize above-mentioned second purpose, the present invention has adopted following technical scheme:

Cross the authentication method of expressing lentiviral vectors by the rat GSK-3 β goal gene that is worth as above-mentioned construction process, this authentication method may further comprise the steps:

1. before the transfection rat WB-F344 cell transfecting, with the WB-F344 cell of tryptic digestion logarithmic phase, adjust cell density, cell density to be treated reaches at 70%～80% o'clock and promptly can be used for transfection; During transfection, cross expression lentiviral vectors transfection rat WB-F344 cell with physiological saline, empty virus vector and rat GSK-3 β goal gene respectively, finish respectively and be 1#, 2# and 3#; After the transfection, under fluorescent microscope, observe the expression of fluorescin.

2. after the genetic expression of Western Blot testing goal reaches best infection multiplicity, at first extract total protein of cell, survey protein concentration, the albumen ultimate density of each sample is adjusted into 2 μ g/ μ l; Each sample is got identical total protein concentration, add sample-loading buffer, make all product, carry out SDS-PAGE again, carry out immunoblotting and immunity colour developing after the end, analytical results.

Beneficial effect of the present invention: cross the successful structure of expressing the lentiviral vectors structure by rat GSK-3 β goal gene, realized the stable and secular expression of this gene in rat cell; Rat GSK-3 β goal gene is crossed expression lentiviral vectors structure makes the more deep understanding GSK-3 β of people in body and relative diabetes, tumour, mechanism of action in bipolar affective disorder and senile dementia and some other nervous system disorderss, better understand the pathogeny of these diseases, for its clinical application in future lays the foundation.

Description of drawings

Fig. 1 is the collection of illustrative plates of pGC-FU carrier of the present invention;

Fig. 2 is the collection of illustrative plates of pHelper1.0 carrier of the present invention;

Fig. 3 is the collection of illustrative plates of pHelper2.0 carrier of the present invention;

Fig. 4 crosses the structure structural representation of expressing lentiviral vectors for rat GSK-3 β goal gene of the present invention;

Fig. 5 is the agarose gel electrophoretogram behind the embodiment of the invention 1 lentiviral vectors linearization for enzyme restriction;

Fig. 6 is the agarose gel electrophoretogram of the embodiment of the invention 1 target gene PCR amplified production;

Fig. 7 detects the design of graphics of positive colony for PCR of the present invention;

Fig. 8 is that the embodiment of the invention 1 PCR detects positive colony evaluation picture;

Fig. 9 is the design of graphics of slow virus plasmid packing of the present invention;

Figure 10 is the photo of cell transfecting during Lentivirus virus is packed in the embodiment of the invention 1;

Figure 11 is another photos of cell transfecting during Lentivirus virus is packed in the embodiment of the invention 1;

Figure 12 is the results and the concentration operation step operation chart 4. of virus in the embodiment of the invention 1;

Figure 13 is the results and the concentration operation step operation chart 7. of virus in the embodiment of the invention 1;

Figure 14 is the results and the concentration operation step operation chart 8. of virus in the embodiment of the invention 1;

Figure 15 is the results and the concentration operation step operation chart 9. of virus in the embodiment of the invention 1;

Figure 16 is the results and the concentration operation step operation chart 10. of virus in the embodiment of the invention 1;

Figure 17 is the solubility curve of goal gene during slow virus plasmid packing Real-time PCR detects in the embodiment of the invention 1;

Figure 18 is the solubility curve of Actin gene during slow virus plasmid packing Real-time PCR detects in the embodiment of the invention 1;

Figure 19 is the photo behind the slow-virus transfection rat WB-F344 cell 72h in the embodiment of the invention 2;

Figure 20 is the photo behind the slow-virus transfection rat WB-F344 cell 72h in the embodiment of the invention 2;

Figure 21 is the immunity colour developing figure behind the electrophoresis that immunity colour developing Western-Blotting testing goal gene GSK-3 β expresses in the embodiment of the invention 2;

Figure 22 is the immunity colour developing figure that immunity colour developing Western-Blotting detects confidential reference items GAPDH in the embodiment of the invention 2;

Figure 23 is the order-checking structure comparison diagram of positive colony in the embodiment of the invention 1.

Embodiment

Method in the embodiment 1 usefulness this patent makes up rat GSK-3 β goal gene and crosses the expression lentiviral vectors

The experiment material source that present embodiment is used is as follows:

Carrier	The carrier source
		pGC-FU?Vector	GENECHEM company

The main agents source is as follows:

Reagent name	Reagent source	cat.No.
			1kpDNA ladder Marker	Fermentas company	#SM0311
250bpDNA ladder Marker	JaRa company	DL250+,100T
			Agarose	Match Parkson company	GA4-100
Age I	NEB company	R0552v
			In-Fusion?PCR Cloning Kit	clontech	639626
Taqpolymerase	SinoBio	E001-02B
			dNTP	Takara	D4030A
Primer	The JaRa biology	/
			Plasmid extracting Kit	Promega	A1460

The key instrument source is as follows:

The instrument title	The instrument source	cat. No.
			The PCR instrument	AppliedBiosystems company	2720thermal cycler
The positiveclone order-checking	U.S.'s season biotechnology	The ABI3730 type
			Voltage stabilizing DNA electrophoresis apparatus	BioRad company	/
The gel imaging instrument	It can company	/
			The bacterium shaking table	Hua Lida experimental installation company	HI-9211K
Bacteriological incubator	Shanghai Yiheng Scientific Instruments Co., Ltd	/
			The Gilson pipettor	Gilson Inc	/
Supercentrifuge	Hitachi, Ltd	TGL-16G-A
			Disposable plate	The biological Science and Technology Ltd. of people from world, Changsha	/
The pGC-FU carrier, Age I enzyme is cut	Shanghai JiKai Gene Chemical Technology Co., Ltd	/

1, the linearization for enzyme restriction of lentiviral vectors

Use Age I to carry out enzyme and cut digestion, the endonuclease reaction system is as follows:

Reagent	Add-on	Concentration
			ddH2O	42μl	/
10×buffer1	5μl	/
			The DNA plasmid of purifying	2μl		1 ug/μl
Age I	1μl	5 U/μl
			Total	50μl	/

Above-mentioned blended reactant is placed 37 ℃ of reaction 2h down, carrier after enzyme cut carries out agarose gel electrophoresis with the voltage stabilizing electrophoresis apparatus, obtain the carrier restriction enzyme mapping, restriction enzyme mapping as shown in Figure 5, wherein, the 1# band is 1kb Marker, band is followed successively by from top to bottom: 10kb, 8kb, 6kb, 5kb, 4kb, 3.5kb, 3kb, 2.5kb, 2kb, 1.5kb, 1kb, 750bp, 500bp, 250bp, the 2# band is the pGC-FU carrier for pGC-FU Vector, and the 3# band is that pGC-FU Vector Age I Enzyme cutting production is that the enzyme of pGC-FU carrier is cut product.

, the obtaining of goal gene

Synthetic two primers, primer sequence is as follows:

The primer title

Primer sequence

Gsk3b-AgeI-F	GAGGATCCCCGGGTACCGGTCGCCACCATGTCGGGGCGACCGAGAACC
		Gsk3b-AgeI-R	TCACCATGGTGGCGACCGGGGTAGAGTTGGAGGCTGATG

Wherein, primer Gsk3b-Age I-F contains exchange pairing base, Age I restriction enzyme site ACCGGT and expresses enhancement sequences CGCCACC, and contains target gene 5 ' end parts sequence, and Gsk3b-Age I-F is used for PCR and angles and get goal gene.Primer Gsk3b-Age I-R contains exchange pairing base and Age I restriction enzyme site (wherein, having removed the T base in order to adjust reading frame), and contains goal gene 3 ' end parts sequence, is used for PCR and angles and get goal gene.

Employing contains the gene fragment of the dna sequence dna of GSK-3 β goal gene, this gene fragment obtains by buying in the cDNA library, angle with Gsk3b-Age I-F and Gsk3b-Age I-R and to get GSK-3 β goal gene, carry out pcr amplification, obtain the PCR product angling the GSK-3 β goal gene of getting;

The PCR reaction system is as follows:

Reagent	Add-on	Concentration
			ddH ₂ O	12.4μl	/
5×Taqbuffer	4.0μl	/
			DNTPs	1.6μl	2.5mM
Primer(+)	0.4μl	10μM
			Primer(-)	0.4μl	10μM
Template	1.0μl	1010ng/μl
			Taqpolymerase	0.2μl	/

The PCR reaction conditions is as follows:

Temperature	Time	Circulation
				94℃	5min	/
94℃	30''	30cycles
			55℃	30''	30cycles
72℃	1.5min	30cycles
			72℃	10min	/
4℃	∞	/

Primer (+) is Gsk3b-Age I-F, and Primer (-) is Gsk3b-Age I-R.

PCR product size is 1306bp, and the PCR product that obtains is carried out electrophoresis, obtains PCR product agarose gel electrophoresis spectrogram, as shown in Figure 6,

3, the structure of purpose plasmid and detection

(1) competent cell preparation

1. dispose 0.1M CaCl ₂Solution, and with 0.22 μ m filtration sterilization, configuration 250mM KCl ₂Solution, configuration 2M MgCl ₂Solution, and autoclaving configuration SOB: with 1ml 250mM KCl ₂Solution adds 100ml LB, regulates pH value to 7.0 with 5M NaOH, and autoclaving faces the 2M MgCl with preceding adding 0.5ml ₂Solution.

2. prepare fresh competent escherichia coli cell with calcium chloride

(a), cultivate single bacterium colony of picking in 16 hours the fresh flat board in 37 ℃, forward in the 1L flask that contains 100ml LB substratum, cultivated 3 hours in 37 ℃ of violent joltings, the rotating speed of rotary shaker is 300 rev/mins.

(b), under aseptic condition, bacterium is transferred in aseptic, disposable, the ice-cold 50 ml polypropylene tube, placed 10 minutes, make culture be cooled to 0 ℃ on ice.

(c), with the temperature of polypropylene tube in 4 ℃, with 4000 rev/mins centrifugal 10 minutes, reclaim cell.

(d), pour out nutrient solution, polypropylene tube was inverted 1 minute, the trace nutrient solution of final residual is flow to end.

(e), with the CaCl of the ice-cold 0.1mol/L of 10ml ₂Resuspended every part of precipitation is positioned on the ice bath.

(f), with polypropylene tube in 4 ℃, with 4000 rev/mins rotating speed centrifugal 10 minutes, reclaim cell.

(g), pour out nutrient solution, polypropylene tube was inverted 1 minute, the trace nutrient solution of final residual is flow to end.

(h), with 0.1 mol/L CaCl ₂With the ice precooling, per 50 ml initial incubation things are with 0.1 mol/L CaCl of 2 ml precoolings ₂Resuspended every part of cell precipitation.

(i), cell is distributed into aliquot, be put under-70 ℃ of temperature frozen.

The preparation of competent cell of the present invention is with reference to 55 pages of " molecular cloning experiment guide " second editions.

(2) GSK-3 β goal gene is crossed the structure of the purpose plasmid of expressing lentiviral vectors

1. the PCR product exchanges the PCR product purification that the lentiviral vectors that enters linearization for enzyme restriction will contain GSK-3 β goal gene, and the lentiviral vectors with PCR product behind the purifying and linearization for enzyme restriction carries out the orientation exchange again,

The reaction system that the lentiviral vectors of PCR product and linearization for enzyme restriction carries out directed exchange is as follows:

Reaction system (μ l):	Positive control	From connecting contrast	The exchange group
				ddH2O	17.5-X-Y	17.5-X	17.5-X-Y
10×In-FusionThe convertase damping fluid	2	2	2
				Linearized vector DNA	X	X	X
Purifying PCRProduct	Y	0	Y
				In-FusionConvertase	0.5	0.5	0.5
Total	20	20	20

Wherein, the mole number ratio of the linearized vector DNA that adds and the PCR product of purifying is: between 1:3～1:9, positive control and connect contrast certainly, the carrier that adds is consistent with the exchange group, but the PCR product of the purifying that positive control adds is that GAPDH gene (having exchange arm equally) reacts above-mentioned reactant 30 minutes under 25 ℃ temperature, under 42 ℃ temperature, reacted 15 minutes again, and preparation exchange liquid, prepare to transform.

2. transform

(a), from every kind of competent cell suspension, get 200 μ l with the aseptic suction nozzle of refrigerative and transfer in the aseptic Eppendorf tube, every pipe adds 10 μ l and connects liquid, rotates gently with the mixing content, places 30 minutes in ice.

(b), the circulator bath temperature is warmed to 42 ℃ in advance, the EP pipe support is placed in the circulator bath, Eppendorf tube is put on the EP pipe support of putting well again, exactly placed 90 seconds, do not shake the EP pipe support.

(c), fast Eppendorf tube is transferred in the ice bath, make cell cooling l-2 minute.

(d), in every pipe, add 800 μ l LB substratum, with water-bath substratum is heated to 37 ℃, then Eppendorf tube is transferred on 37 ℃ of shaking tables, incubation made bacteria resuscitation in 45 minutes.

(e), the competent cell that 150 μ l have been transformed is transferred on the LB nutrient agar of AMP resistance (100ug/ml).

(f), place room temperature to be absorbed flat board until liquid.

(g), be inverted plate, plate was cultivated 16 hours under 37 ℃ of temperature.

The operation that the present invention transforms is with reference to 55～56 pages of " molecular cloning experiment guide " second editions.

(3) detection of GSK-3 β destination gene expression slow virus carrier purpose plasmid

1. PCR identifies positive colony

The clone body that grows is carried out subsequent P CR evaluation needs synthetic two detection primers:

The primer title	Primer sequence
		Gsk3b-SEQF	CGCACTGTGTAGCCGTCTCC
EGFP-N-R	CGTCGCCGTCCAGCTCGACCAG
		Ubi-F	GGGTCAATATGTAATTTTCAGTG

PCR detection reaction system is as follows:

Reagent	Add-on	Concentration
			ddH ₂ O	12.4μl	/
5×Taqbuffer	4.0μl	/
			DNTPs	1.6μl	2.5mM
Primer(+)	0.4μl	10μM
			Primer(-)	0.4μl	10μM
Template	1.0 μl	1010ng/μl
			Taqpolymerase	0.2 μl	/

PCR detection reaction condition is as follows:

Temperature	Time	Circulation
				94℃	2min	/
94℃	30''	30cycles
			60℃	30''	30cycles
72℃	30''	30cycles
			72℃	6min	/
4℃	∽	/

Primer(+ wherein) be Gsk3b-SEQF Primer(-) be EGFP-N-R, the primer that the positive contrast of Ubi-F is used, this primer is arranged in the Ubiquitin promotor, is used for bacterium colony PCR and identifies transformant and order-checking.

Be stained with on the bacterium clone surface that the exchange converted product grows, be dissolved in 10 μ l LB, get 1 μ l behind the mixing as the bacterium colony pcr template;

When carrying out negative control, make water as template, the external source pollution of nucleic acid causes false positive results in the removal system;

Carry out from connecting when contrast, uses from connecting the contrast transformant to be template, the eliminating non-specific amplification causes causes false positive results

When carrying out positive control, use the positive control transformant to be template, the part of amplification GAPDH gene is used for getting rid of the false negative result that reasons such as PCR reagent, PCR instrument and PCR reaction conditions cause.

Attention: the primer that positive control uses is different with other group as Ubi-F, this primer can increase the GAPDH gene a part and identify not have homology with primer.

PCR identifies that the design of graphics of positive colony sees Fig. 7 for details.

2. electrophoresis is identified the PCR product

Electrophoresis identifies that PCR product system is as follows:

Swimming lane	Sample number into spectrum
		1#	Negative control (ddH2O)
2#	Negative control (unloaded) from connecting control group
		3#	Positive control (GAPDH)
4#	Marker			5 kb，3 kb，2 kb，1.5 kb，1 Kb，750 bp，500 bp，250 bp，100 bp
		5#～12#	Gsk3b-1～No. 8 transformant

The PCR positive colony is identified picture as shown in Figure 8,

3. positive colony order-checking and interpretation of result

The inoculation positive transformant, after cultivating 16 hours under 37 ℃ the temperature, save as glycerol stock, packing 200 μ l send order-checking, sequencing result is seen the positive colony sequencing result at specification sheets end, analyze the positive colony sequencing result, as sequence in the sequence table 1 is the base sequence of goal gene, and sequence 7 is the DNA gene order in the purpose plasmid that makes up; DNA base sequence in the purpose plasmid is the target gene sequence with the consistent Sbjct of the base sequence of goal gene; Identities=1259/1260 (99%), as shown in figure 23, the CCG same sense mutation of density bullet is CCT.

, the slow virus plasmid packing

The experiment material of slow virus plasmid packing is as follows:

Cell strain: 293T, the packing cell of slow virus, for adherent dependent form becomes the epithelioid cell, growth medium is DMEM (containing 10%FBS), attached cell forms monolayer cell through incubation growth propagation.

Bacterial strain: coli strain DH5 α, lentiviral vectors and auxiliary package vector plasmid are used to increase.

Virus vector: pGC-LV recombinant vectors; PHelper 1.0; PHelper 2.0;

The preparation of dna solution: the plasmid extraction test kit with Qiagen company extracts three kinds of plasmid DNA in the slow virus packaging system, plasmid DNA is dissolved among the TE of degerming, measure its concentration and purity with the ultraviolet absorption method, the A260/A280 that guarantees the plasmid DNA of putting forward is between 1.8～2.0.

Experiment reagent is as follows:

Reagent name	Reagent source	cat.No.
			Platform is expected orchid	Gene engineering company limited is doubly thought in the Shanghai victory	?
Foetal calf serum FBS	Shanghai biochemical reagents company limited of little section	A11-102
			DMSO	Shanghai biological reagent factory	?
DMEM	GIBCO	12800-017
			Pancreatin	Shanghai chemical reagents corporation	?
Lipofectamine2000	Invitrogen	?11668-500

Laboratory apparatus is as follows:

The instrument title	The instrument source	cat.No.
			Fluorescent microscope	The Olympus	micropublisher3.3RTV
CO2 Incubator	SANYO GS SANYO	MCO-175
			Biohazard Safety Equipment	The Shanghai sample wound air-purification unit company limited of shaking	Bio 1200-Ⅱ-A2
Plus-20The centrifugal ultrafiltration device	MILLIPORE	ufc910024

The experimental procedure of slow virus plasmid packing is as follows:

(1) cultivation of viral packing cell 293T

1. viable count is diluted to 200～2000/ml (general extension rate is 100 times) to cell suspension with serum free medium.0.4% of adding 0.1 ml platform is expected blue solution in the cell suspension of 0.1ml.Mixing after several minutes, is used the blood counting chamber counting cells gently.Viable cell repels platform and expects orchid, thereby to dye blue cell be dead cell.

2. cell strain is frozen

(a), get and cultivate 2～3 days eugonic cells, with cell culture fluid cell is made into 2 * 10 ⁶～2 * 10 ⁷/ ml.

(b), in 1 ml cell cryopreservation pipe, add 0.5 ml cell suspension, 0.4 ml calf serum and 0.1 ml dimethyl sulfoxide (DMSO), also can use glycerine, seal behind the mixing, under 4 ℃ of temperature, put 1 hour, under-20 ℃ of temperature, put 2 hours again, directly put into liquid nitrogen then or put the back of spending the night on the liquid nitrogen steam and immerse liquid nitrogen.

3. cell recovery

(a), from liquid nitrogen container, take out the cell cryopreservation pipe, should have safety glasses and gloves when taking.

(b), the cell cryopreservation pipe that takes out is put into the water-bath that fills 37 ℃ of water rapidly, and shake frequently, thaw as early as possible.

(c), with after the 70% alcohol wipe sterilization, the cell cryopreservation pipe is moved on the clean bench, the sucking-off cell suspension is added the DMEM substratum that 3ml contains 10% FBS to culturing bottle, place incubator to cultivate.

(d), continue again to cultivate after changing nutrient solution next day.

4. passage

(a), discard old nutrient solution, add the sterilization PBS solution of 5ml at culturing bottle, rock gently, the washed cell aufwuchsplate discards PBS solution then.

(b), again add 2ml trysinization liquid, digestion 1～2 min gets off up to the cell complete digestion.

(c), again add and contain 10% foetal calf serum and the two anti-DMEM substratum 5ml of 100U/ml, with calibrated pipet piping and druming for several times, the cell on the bottle wall is washed.

(d) divide behind the mixing cell to two new culturing bottles, continue to cultivate.

(2) Lentivirus virus packing

1. cell transfecting

(a), preceding 24 h of transfection, with the 293T cell of tryptic digestion logarithmic phase, adjusting cell density with the substratum that contains 10% serum is 1.2 x 10 ⁷Cell/20 ml is re-seeded into 15 cm Tissue Culture Dishs, in 37 ℃, 5% CO ₂Incubator in cultivate 24h, treat that cell density reaches at 70%～80% o'clock and promptly can be used for transfection.It is important that cell state is filled to the pass for virus packets, therefore needs to guarantee good cell state and less passage number.

(b), 2h is replaced by serum free medium with cell culture medium before the transfection.

(c), in a sterilization centrifuge tube, add prepared each DNA solution (wherein, pGC-LV carrier 20 μ g, pHelper1.0 carrier 15 μ g, pHelper2.0 carrier 10 μ g), mix with the Opti-MEM of respective volume, adjusting cumulative volume is 2.5 ml, and at room temperature incubation is 5 minutes.

(d), Lipofectamine2000 reagent is softly shaken up, get 100 μ l Lipofectamine, 2000 reagent and mix at another Guan Zhongyu 2.4ml Opti-MEM, at room temperature incubation is 5 minutes.

(e), the DNA after the dilution is mixed with Lipofectamine 2000 after the dilution, put upside down mixing lightly, vibrate.Must within 5 minutes, mix.

(f), mix after, incubation 20min at room temperature is so that form the transfection composite of DNA and Lipofectamine2000 diluent.

(g), DNA and Lipofectamine 2000 mixed solutions are transferred in the nutrient solution of 293T cell, mixing, in 37 ℃, 5%CO ₂Cultivate in the cell culture incubator.

(h), cultivate the substratum that removes to contain the transfection miscellany behind 8 h, every bottle of cell adds the PBS liquid of 20ml, gently double swerve once culturing bottle go then to wash remaining transfection miscellany.

(i), in every bottle of cell, add cell culture medium 25 ml that contain 10% serum, in 37 ℃, 5% CO ₂Continue in the incubator to cultivate 48 hours.

2. cells transfected is taken pictures, the cell transfecting photo is seen Figure 10 and Figure 11.

(3) Bing Du results and concentrated

1. collect after the transfection 293T cell conditioned medium liquid of 48 hours (transfection gets final product, be 0 hour count);

2. with 4000g 293T cell conditioned medium liquid under 4 ℃ of temperature, centrifugal 10 min remove cell debris;

3. place 40 ml ultracentrifugation pipes with 0.45 μ m filter filtering supernatant;

4. viral crude extract sample is joined (19ml at most) in the filtering cup, cover lid is inserted into filtering cup in the filtered solution collection tube, and application drawing is seen Figure 12;

5. after combining, carry out balance, be placed in the rotary head.

6. centrifugal at 4000 * g to the concentrated volume of the virus that needs.Usually the time that needs is 10～15 minutes.

7. after the centrifugal end, take out centrifugal device, filtering cup and following filtered solution collection cups are separated, application drawing is seen Figure 13;

8. filtering cup is tipped upside down on the sample collection cup, application drawing is seen Figure 14.

9. it is centrifugal to be no more than 1000g at centrifugal force, and the time is 2 minutes, and excessive speeds can cause sample loss, and filtering cup is removed from the sample collection cup, is viral concentrated solution in the sample collection cup, and application drawing is seen Figure 15.

10. viral concentrated solution is shifted out, be kept at after the packing in the viral pipe, in-80 ℃ of prolonged preservation, get wherein one and carry out the viral biology titer determination, application drawing is seen Figure 16.

(4) Lentivirus titer determination

1. the hole dilution method is measured titre

(a), measure the day before yesterday, for measure the required cell of titre (the 293T cell that Ji Kai genome company uses: adherent growth) bed board, be provided with 96 orifice plates, each hole adds 4 * 10 ⁴Individual cell, volume are 100 μ l.

(b), according to the expection titre of virus, prepare 8 aseptic Ep pipes.The serum free medium that in each Ep pipe, adds 90 μ l.

(c), get virus stock solution used to be determined 10 μ l and join in first Ep pipe, behind the mixing, get 10 μ l and join in second pipe.Continue an identical operations pipe to the last.

(d), choose required cell hole, inhale and remove 90 μ l substratum and abandon, add 90 μ l and dilute good viral solution, put into incubator and cultivate.

(e), after 24 hours, add perfect medium 100 μ l, note careful operation, do not blow afloat cell.

(f), after 4 days, observe the luciferase expression situation, the fluorocyte number reduces with the increase of extension rate.

Illustrate:

Add the 10ul virus stock solution used in first Ep pipe, be designated as 1E+1 μ l;

Carried out ten times of dilutions for the first time in second Ep pipe, the gained virus stock solution used is 1/10 among first Ep, is designated as 1E+0 μ l;

Carried out ten times of dilutions for the second time in the 3rd the Ep pipe, the gained virus stock solution used is 1/10 among second Ep, is designated as 1E-1 μ l;

Carried out ten times of dilutions for the third time in the 4th the Ep pipe, the gained virus stock solution used is 1/10 among the 3rd Ep, is designated as 1E-2 μ l;

Carried out the 4th ten times of dilutions in the 5th the Ep pipe, the gained virus stock solution used is 1/10 among the 4th Ep, is designated as 1E-3 μ l;

Carried out the 5th ten times of dilutions in the 6th the Ep pipe, the gained virus stock solution used is 1/10 among the 5th Ep, is designated as 1E-4 μ l;

Carried out the 6th ten times of dilutions in the 7th the Ep pipe, the gained virus stock solution used is 1/10 among the 6th Ep, is designated as 1E-5 μ l;

Carried out the 7th ten times of dilutions in the 8th the Ep pipe, the gained virus stock solution used is 1/10 among the 7th Ep, is designated as 1E-6 μ l;

Titre is calculated:

According to GFP expression in the above fluorescence picture, in the hole that adds 1E-6 μ l virus stock solution used, observe 2 cells that have fluorescence, illustrate and have at least 2 virions to infect cell in this hole, titre that then should virus equals to have the cell count of fluorescence divided by the virus stock solution used amount, unit is TU/ μ l

2. Real time quantitative PCR method is measured titre

(a), specimen preparation

ⅰ, detect the day before yesterday,, add 1 * 10 in each 24 hole the 293T passage ⁵Individual cell, volume are 500 μ l;

ⅱ, next day, prepare 8 aseptic Ep pipes, in each pipe, add the substratum (DMEM+10%FBS) of 90 μ l;

ⅲ, get virus stock solution used to be determined 10 μ l and join in first pipe, behind the mixing, get 10 μ l and join in second pipe, continue an identical operations pipe to the last;

ⅳ, choose required cell hole, inhale and remove 90 μ l substratum, add the good viral solution of dilution, put into 37 ℃ 5%CO ₂Cultivate in the incubator;

ⅴ, after 48 hours, add fresh culture 500 μ l, note careful operation, do not blow afloat cell;

ⅵ, after 4 days, extracting RNA goes to RT-qPCR.

Illustrate:

(b), total RNA extracting

Illustrate: the TRIZOL process specifications according to Invitrogen company carries out, and is the RNase-free operation.

ⅰ, remove cell conditioned medium, every hole adds 1ml TRIZOL piping and druming, and room temperature leaves standstill 5 min, after be transferred in another 1.5 new mleppendorf pipes.

ⅱ, every pipe add 200 μ l chloroforms, firmly shake 15s, and room temperature leaves standstill 15 min.

ⅲ, under 4 ℃ temperature, with the centrifugal 15min of 2000 rev/mins rotating speed.

ⅳ, from every pipe, draw supernatant liquor, add equal-volume in the Virahol of-20 ℃ of precoolings to another 1.5 new ml eppendorf pipe, behind the mixing under-20 ℃ of temperature precipitation 10 min.

ⅴ, under 4 ℃ of temperature, behind centrifugal 10 min of 2000 rev/mins rotating speed, remove supernatant.

75% ethanol, washing precipitation and the centrifugal tube wall of ⅵ, adding at least 1 ml precooling under 4 ℃ of temperature.

ⅶ, in 4 ℃, with centrifugal 5 min of 10000 rev/mins rotating speed, abandon supernatant.

ⅷ, in 4 ℃, with 10000 rev/mins rotating speed recentrifuge 5 min, inhale and to remove raffinate, drying at room temperature (not needing complete drying).

ⅸ, adding 20 μ l RNase-free water, to dissolving fully, the concentration of institute's extracting RNA is measured in ultra-violet analysis.

(c) the RNA reverse transcription obtains cDNA

M-MLV reversed transcriptive enzyme and dNTP are available from PROMEGA company.Oligo dT gives birth to the worker available from Shanghai, and the article of RNase-free are all available from Axygen.

Illustrate: the M-MLV process specifications according to Promega company carries out, and is the RNase-free operation.

Step is as follows:

ⅰ, 1 μ l Oligo dT (0.5 μ g/ μ l) and 2.0 μ g Total RNA are joined in the PCR tubule, replenish DEPC-H2O to 9 μ l.Centrifugal behind the mixing, temperature is bathed 10min under 70 ℃ of temperature, is inserted into immediately afterwards in 0 ℃ of ice-water bath, makes Oligo dT and template annealing.

ⅱ, the ratio of form among the ⅲ are set by step figured out required amount of reagent according to reaction tubes, and M-MLV enzyme etc. at mixing on ice, is obtained the RT reaction solution.

The RT reaction solution of ⅲ, the 11ul that in each reaction tubes, adds, centrifugal behind the mixing.

Reaction system is as follows:

Reagent	Every pipe add-on	Concentration
			5×RTbuffer	4μl	/
dNTPs	2μl	10mM
			RNasin	0.5μl	/
M-MLV-RTase	1μl	/
			DEPCH2O	3.5μl	/

ⅳ, RT are reflected at 42 ℃ to carry out finishing behind the 1h, handles 10min with 70 ℃ afterwards and makes the RT enzyme deactivation.

ⅴ, the RT reaction product-cDNA that obtains can be used for PCR immediately, also can be kept under-80 ℃ of temperature, are provided with the back and use.

(d) Real-time PCR detects

Real-time PCR finishes on the iQ5 of Bio-rad, and SYBR Master Mixture is from TAKARA.

ⅰ, by following proportional arrangement reaction system:

Reagent	Every pipe add-on	Concentration
			SYBRpremix ex taq:	10μl	/
Upstream primer	1.0μl	5μM
			Downstream primer	1.0μl	5μM
cDNA	1.0μl	/
			Water	7.5μl	/

ⅱ, setting program are that two-step approach Real-Time is quantitative.95 ℃ of pre-sex change, 15S, 95 ℃ of each step sex change afterwards, 5S, annealing is extended 60 ℃, and 30S carries out 40 circulations altogether, reads light absorption value in the extension stage at every turn.

Figure 2011100880188100002DEST_PATH_IMAGE002

Image data is also carried out real-time and is analyzed.

ⅲ, making melting curve.After PCR finishes, at 95 ℃ of sex change 1min.Be cooled to 55 ℃ then, make the double-stranded fully combination of DNA.Since 55 ℃ to 95 ℃, each step increases by 0.5 ℃, keeps 30S, reads light absorption value simultaneously.

Cycle3:	(1X)	/
			Step1:	95.0℃	for01:00.
Cycle4:	(1X)	/
			Step1:	55.0℃	for01:00.
Cycle5:	(81X)	/
			Step1:	55.0℃-95.0℃	for00:30.

After circulation cycle 2, increase the temperature of 0.5 ℃ of setting at every turn

The value of sample sets and expression amount analysis behind the different concns virus infection

Figure 2011100880188100002DEST_PATH_IMAGE003

Virus titer calculates

In this titre detected, there were 2 left and right sides differences in the Ct value of 1.00E-04 ul group sample and control group sample, thought to have virion in 1.00E-04 ul group sample.Suppose that this group sample contains and has 1 virion at least, then Bing Du titre is: 1/ (1.00E-04) * 20=2.00E+5 TU/ul=2.00E+8 TU/ml.

The melting curve of goal gene as shown in figure 17, the melting curve of Actin gene is as shown in figure 18.

The melt curve analysis explanation

Because SYBR Green I combines with all double-stranded DNA, therefore the false positive that is caused by the amplified production of primer dimer, strand secondary structure and mistake can influence quantitative accuracy.Can help to reduce the influence of non-special product by the variation of fluorescence behind the measurement elevated temperature.Come the homogeneity of assay products to help to analyze more accurately SYBR Green Real-Time PCR quantitative result by melting curve.After PCR finished, we can change the melting curve of drawing each sample according to the fluorescent value in the denaturation process.When drawing melting curve, each sample of Real-Time PCR instrument continuous monitoring be paired to fully from two strands the intensification of unwinding fully cross with the change procedure of fluorescent value.Different amplified productions unwinds under different temperature because its length is different with GC content, and when product unwind, the fluorescent value of SYBR Green I will reduce and be arrived by instrument monitoring.Draw out the temperature variant negative figure once reciprocal of fluorescence intensity thus.(fusing point Tm) is the fusion peak value to the flex point that fluorescence intensity changes.Melting curve is the Quality Control approach of amplified reaction, does not occur assorted peak among the figure, the unusual broadening of main peak also do not occur, shows not occur pollution, primer dimer and non-specific amplification in the experiment.

Authentication method evaluation rat GSK-3 β goal gene in the embodiment 2 usefulness this patents is crossed the expression lentiviral vectors

The main experiment material of this authentication method is as follows:

REAGENTS (reagent)	COMPANY	Cat.No.
			BCAProtein Assay	HyClone-Pierce	23225
Kit	In brilliant company	SM0441
			Prestainedprotein	AmershamCompany	RPN2132
marker	Kodak	/
			ECL-PLUS/Kit	/	/
Medical X ray mating plate	Shanghai hat Long Zhaoxiangcailiaochang	/
			X line film development powder	Shanghai hat Long Zhaoxiangcailiaochang	/
X line film fixing powder	Santacrze	/
			Gsk-3 β antibody	Santacrze	/
Goat-anti rabbit two is anti-	/	/

The main laboratory apparatus of this authentication method is as follows:

EQUIPMENTS (instrument)	COMPANY	Cat.No.
			Voltage stabilized source (electrophoresis is used)	Sky, Shanghai energy	EPS-300
SDS-PAGE protein electrophoresis instrument	Sky, Shanghai energy	VE-180
			Albumen changes the film instrument	Sky, Shanghai energy	VE-186
The desk-top high-speed refrigerated centrifuge of 5417R	EppendorfCompany	5417R

The applicant crosses expression lentiviral vectors called after pGC-FU-GSK-3 β with rat GSK-3 β goal gene.

, slow-virus transfection rat WB-F344 cell

Preceding 24 h of transfection with the 293T cell of tryptic digestion logarithmic phase, adjust cell density 1.2 x 10 with the substratum that contains 10% serum ⁷Cell/20 ml is re-seeded into 15 cm Tissue Culture Dishs, places 5%CO under 37 ℃ of temperature ₂Cultivate in the incubator.24h treats that cell density reaches at 70%～80% o'clock and promptly can be used for transfection.It is important that cell state is filled to the pass for virus packets, therefore needs to guarantee good cell state and less passage number.The MOI=30 transfectional cell, the 72h cell is taken pictures, and photo is seen Figure 19 and Figure 20.

During transfection, cross expression lentiviral vectors transfection rat WB-F344 cell with physiological saline, empty virus vector and rat GSK-3 β goal gene respectively, finish respectively and be 1#, 2# and 3#; Under fluorescent microscope, observe the expression of fluorescin after the transfection.

, the genetic expression of Western Blotting testing goal

1. total protein of cell extracting

(1) from incubator, takes out cell, discard cell culture fluid, PBS washing 2 times;

(2) discard PBS, add 2 * Lysis Buffer of an amount of precooling, it is as follows to fill a prescription:

Component	Add-on
		1MTris-HCl（pH6.8）	100mM
Mercaptoethanol
		2%
Glycerine			20%
	SDS
		4%

(3) scrape cell with cell, sample transfer is gone in the Ep pipe, at lysing cell 10～15 min on ice;

(4) Ultrasonic Cell Disruptor smudge cells (200W totally 4 times, each 5 seconds, 2 seconds at interval)

(5) 4 ℃, 12000g, centrifugal 15min

(6) get supernatant, behind the survey protein concentration, each sample protein final concentration all is adjusted into 2 μ g/ μ l, preserves standby under-80 ℃ of temperature.

2. going up all product prepares

(1) each sample is got identical total protein concentration, adds the 2X loading buffer sample-loading buffer of equal volume, and it is as follows to fill a prescription:

Component	Add-on
		1MTris-HCl（pH6.8）	100mM
Mercaptoethanol
		2%
Bromjophenol blue			0.02%
	Glycerine	20%
SDS
		4%

(2) behind the mixing, boiling water bath boils 5～10 min, deposits standby under 4 ℃.

③SDS-PAGE

(1) glue: according to the glue of target protein molecular weight size preparation different concns, concrete system is as follows:

Glue: according to the glue of target protein molecular weight size preparation different concns, concrete system is as follows:

Separation gel (8mL system)

?	8%	9%	10%	12%	13%	15%
							H2O	3.7	3.4	3.1	2.6	2.3	1.8
30%PAGE	2.1	2.4	2.7	3.2	3.5	4
							1.5mol/LTris(pH8.8)	2	2	2	2	2	2
10%SDS	0.08	0.08	0.08	0.08	0.08	0.08
							10%APS	0.08	0.08	0.08	0.08	0.08	0.08
TEMED	0.005	0.004	0.004	0.004	0.004	0.004

Separation gel (10mL system)

?	8%	9%	10%	12%	13%	15%
							H2O	4.6	4.3	4	3.3	2.9	2.3
30%PAGE	2.7	3.0	3.3	4.0	4.4	5.0
							1.5mol/LTris(pH8.8)	2.5	2.5	2.5	2.5	2.5	2.5
10%SDS	0.1	0.1	0.1	0.1	0.1	0.1
							10%APS	0.1	0.1	0.1	0.1	0.1	0.1
TEMED	0.006	0.004	0.004	0.004	0.004	0.004

Concentrate glue (5%)

?	3ml	4ml	5ml
				H2O	2.1	2.7	3.4
30%PAGE	0.5	0.67	0.83
				1.0mol/LTris(pH6.8)	0.38	0.5	0.63
10%SDS	0.03	0.04	0.05
				10%APS	0.03	0.04	0.05
TEMED	0.003	0.004	0.005

(2) go up sample: after waiting gelling good admittedly, take out comb, electrophoretic buffer cleans goes up the sample hole, with sample on the ready sample.

(3) carry out electrophoresis: in 30mA electrophoresis 2h.

4. immunoblotting (wet change)

After electrophoresis finishes, use the electrophoretic blotting device,,, albumen is transferred on the PVDF film in the electric down 120min that changes of 400mA constant current conditions at 4 ℃.

5. immunity colour developing

(1) sealing: seal PVDF film 1h or under 4 ℃ of temperature, spend the night with confining liquid (the TBST solution that contains 5% skimmed milk) room temperature.

(2) one anti-hatching: confining liquid dilution antibody, spend the night with the good PVDF film incubated at room 2h of sealing or 4 ℃ then.

(3) wash film: TBST washes film 3 times, each 10min.

(4) two anti-hatching: dilute corresponding two with confining liquid and resist, hatch PVDF film 2h under the room temperature.

(5) wash film: TBST washes film 3 times, each 10min.

(6) adopt the Amersham ECL+plusTM Western blotting system of company test kit to develop the color.

(7) X photodevelopment: the film that in dark place, obtains to show band.

The concrete steps that add ECL, exposure, development, photographic fixing are as follows:

(a), the PVDF film is placed on the good preservative film of tiling,, mixed solution is evenly dripped on pvdf membrane lucifuge reaction 3～5min with mixed A liquid and the B liquid of 1:40.

(b) film is taken out, drain unnecessary ECL substrate reactions liquid a little, put into magazine, spread preservative film (avoiding producing bubble), put X mating plate (avoiding moving of X mating plate), shut magazine, exposure 1～2min.

(c), take out the X mating plate, put into developing solution, take out behind about 1min, rinsing several seconds in clear water, after put into stop bath 2min at least.

(d) take out the X mating plate, dry, analyze.

As Figure 21 and shown in Figure 22, the result shows, infects back 96 h, and Gsk3 β crosses expression slow virus group and presents high expression level trend with the relatively more visible Gsk3 β albumen of empty carrier group, control group.

Wherein 1 group is the blank group, and 2 groups is slow virus empty carrier group, and 3 groups is slow virus PGC-FU-Gsk3 β group.

Sequence table

＜110〉Dan Yunfeng

＜120〉rat GSK-3 β goal gene is crossed the expression lentiviral vectors and is implemented in evaluation

<160>7

<210>?1

<211>?1260

<212>?DNA

＜213〉PCR method is angled and is got

＜223〉GSK-3 β goal gene

<400>?1

ATGTCGGGGCGACCGAGAACCACCTCCTTTGCGGAGAGCTGCAAGCCAGTGCAGCAGCCT 60

TCAGCTTTTGGTAGCATGAAAGTTAGCAGAGATAAAGATGGCAGCAAGGTAACCACAGTG 120

GTGGCAACTCCTGGACAGGGTCCTGACAGGCCACAGGAAGTCAGTTACACAGACACTAAA 180

GTCATTGGAAATGGGTCATTTGGTGTGGTATATCAAGCCAAACTTTGTGACTCAGGAGAA 240

CTGGTGGCCATCAAGAAAGTTCTTCAGGACAAGCGATTTAAGAACCGAGAGCTCCAGATC 300

ATGAGAAAGCTAGATCACTGTAACATAGTCCGATTGCGGTATTTCTTCTACTCGAGTGGC 360

GAGAAGAAAGATGAGGTCTACCTTAACCTGGTGCTGGACTATGTTCCGGAAACAGTGTAC 420

AGAGTCGCCAGACACTATAGTCGAGCCAAGCAGACACTCCCTGTGATCTATGTCAAGTTG 480

TATATGTACCAGCTGTTCAGAAGTCTAGCCTATATCCATTCCTTTGGGATCTGCCATCGA 540

GACATTAAACCACAGAACCTCTTGCTGGATCCTGATACAGCTGTATTAAAACTCTGCGAC 600

TTTGGAAGTGCAAAGCAGCTGGTCCGAGGAGAGCCCAATGTTTCATATATCTGTTCTCGG 660

TACTACAGGGCACCAGAGCTGATCTTTGGAGCCACCGATTACACGTCTAGTATAGATGTA 720

TGGTCTGCAGGCTGTGTGTTGGCTGAATTGTTGCTAGGACAACCAATATTTCCTGGGGAC 780

AGTGGTGTGGATCAGTTGGTGGAAATAATAAAGGTCCTAGGAACACCAACAAGGGAGCAA 840

ATTAGAGAAATGAACCCAAATTATACAGAATTCAAATTCCCCCAAATCAAGGCACATCCT 900

TGGACGAAGGTCTTTCGGCCCCGAACTCCACCAGAGGCAATCGCACTGTGTAGCCGTCTC 960

CTGGAGTACACGCCGACCGCCCGGCTAACACCACTGGAAGCTTGTGCACATTCATTTTTT 1020

GATGAATTACGGGACCCAAATGTCAAACTACCAAATGGGCGAGACACACCTGCCCTCTTC 1080

AACTTTACCACTCAAGAACTGTCAAGTAACCCACCTCTGGCCACCATCCTTATCCCTCCT 1140

CACGCTCGGATTCAGGCAGCTGCTTCACCGCCTGCAAACGCCACAGCAGCCTCAGATACT 1200

AATGCTGGAGACCGTGGACAGACCAATAACGCCGCTTCTGCATCAGCCTCCAACTCTACC 1260

<210>?2

<211>?48

<212>?DNA

＜213〉synthetic

＜223〉Gsk3b-Age I-F primer

<400>?2

GAGGATCCCCGGGTACCGGTCGCCACCATGTCGGGGCGACCGAGAACC 48

<210>?3

<211>?39

<212>?DNA

＜213〉synthetic

＜223〉Gsk3b-Age I-R primer

<400>?3

TCACCATGGTGGCGACCGGGGTAGAGTTGGAGGCTGATG 39

<210>?4

<211>?20

<212>?DNA

＜213〉synthetic

＜223〉Gsk3b-SEQF primer

<400>?4

CGCACTGTGTAGCCGTCTCC 20

<210>?5

<211>?22

<212>?DNA

＜213〉synthetic

＜223〉EGFP-N-R primer

<400>?5

CGTCGCCGTCCAGCTCGACCAG 22

<210>?6

<211>?23

<212>?DNA

＜213〉synthetic

＜223〉Ubi-F primer

<400>?6

GGGTCAATATGTAATTTTCAGTG 23

<210>?7

<211>?1360

<212>?DNA

＜213〉synthetic

＜223〉purpose plasmid

<400>?7

ATGTCGGGGCGACCGAGAACCACCTCCTTTGCGGAGAGCTGCAAGCCAGTGCAGCAGCCT 60

TCAGCTTTTGGTAGCATGAAAGTTAGCAGAGATAAAGATGGCAGCAAGGTAACCACAGTG 120

GTGGCAACTCCTGGACAGGGTCCTGACAGGCCACAGGAAGTCAGTTACACAGACACTAAA 180

GTCATTGGAAATGGGTCATTTGGTGTGGTATATCAAGCCAAACTTTGTGACTCAGGAGAA 240

CTGGTGGCCATCAAGAAAGTTCTTCAGGACAAGCGATTTAAGAACCGAGAGCTCCAGATC 300

ATGAGAAAGCTAGATCACTGTAACATAGTCCGATTGCGGTATTTCTTCTACTCGAGTGGC 360

GAGAAGAAAGATGAGGTCTACCTTAACCTGGTGCTGGACTATGTTCCGGAAACAGTGTAC 420

AGAGTCGCCAGACACTATAGTCGAGCCAAGCAGACACTCCCTGTGATCTATGTCAAGTTG 480

TATATGTACCAGCTGTTCAGAAGTCTAGCCTATATCCATTCCTTTGGGATCTGCCATCGA 540

GACATTAAACCACAGAACCTCTTGCTGGATCCTGATACAGCTGTATTAAAACTCTGCGAC 600

TTTGGAAGTGCAAAGCAGCTGGTCCGAGGAGAGCCCAATGTTTCATATATCTGTTCTCGG 660

TACTACAGGGCACCAGAGCTGATCTTTGGAGCCACCGATTACACGTCTAGTATAGATGTA 720

TGGTCTGCAGGCTGTGTGTTGGCTGAATTGTTGCTAGGACAACCAATATTTCCTGGGGAC 780

AGTGGTGTGGATCAGTTGGTGGAAATAATAAAGGTCCTAGGAACACCAACAAGGGAGCAA 840

ATTAGAGAAATGAACCCAAATTATACAGAATTCAAATTCCCCCAAATCAAGGCACATCCT 900

TGGACGAAGGTCTTTCGGCCCCGAACTCCACCAGAGGCAATCGCACTGTGTAGCCGTCTC 960

CTGGAGTACACGCCGACCGCCCGGCTAACACCACTGGAAGCTTGTGCACATTCATTTTTT 1020

GATGAATTACGGGACCCAAATGTCAAACTACCAAATGGGCGAGACACACCTGCCCTCTTC 1080

AACTTTACCACTCAAGAACTGTCAAGTAACCCACCTCTGGCCACCATCCTTATCCCTCCT 1140

CACGCTCGGATTCAGGCAGCTGCTTCACCTCCTGCAAACGCCACAGCAGCCTCAGATACT 1200

AATGCTGGAGACCGTGGACAGACCAATAACGCCGCTTCTGCATCAGCCTCCAACTCTACC 1360

Claims

1. a structure rat GSK-3 β goal gene is crossed expression lentiviral vectors transformation dna sequence dna, and it is characterized in that: described dna sequence dna comprises the dna sequence dna of GSK-3 β goal gene, and GSK-3 β target gene sequences is shown in sequence 1.

2. be used to make up rat GSK-3 β goal gene and cross the carrier of expressing lentiviral vectors, it is characterized in that: described plasmid vector adopts the pGC-FU carrier, and described pGC-FU carrier contains the EGFP gene.

3. be used for rat GSK-3 β goal gene and cross the purpose plasmid packaging lentiviral vectors of expressing lentiviral vectors, it is characterized in that: this slow virus carrier system is made of pGC-LV carrier, pHelper 1.0 carriers and pHelper 2.0 carriers three plasmids, and described pGC-LV carrier has the GFP mark.

4. a rat GSK-3 β goal gene is crossed the structure of expressing lentiviral vectors, it is characterized in that this construction process comprises the DNA that uses the described carrier pGC-FU of Age I enzymic digestion claim 2, design contains the gene primer of Age I restriction enzyme site, adopt the PCR method Accessory Right to require 1 described transformation to get GSK-3 β goal gene with angling in the dna sequence dna, the GSK-3 β target gene PCR product and the carrier of linearization for enzyme restriction are carried out the orientation exchange to be connected, and with its product transformed competence colibacillus cell, extracting and purifying, carrying out PCR again identifies, obtain the purpose plasmid of structure, at last the purpose plasmid that builds is utilized lentiviral vectors as claimed in claim 3 to carry out slow virus plasmid packing, carry out the ultrapure intracellular toxin that goes at last and extract, design of graphics is seen Fig. 4.

5. rat GSK-3 β goal gene according to claim 3 is crossed the expression lentiviral vectors and is made up, and it is characterized in that this construction process may further comprise the steps:

1. the linearization for enzyme restriction lentiviral vectors of slow virus plasmid vector adopts the pGC-FU carrier, cuts digestion lentiviral vectors pGC-FU with restriction enzyme A ge I enzyme, reclaims the pGC-FU fragment;

2. primer is synthetic: Synthetic 2 bar primer, and sequence is as follows:

The primer title Primer sequence Gsk3b-Age I-F GAGGATCCCCGGGTACCGGTCGCCACCATGTCGGGGCGACCGAGAACC Gsk3b- Age I-R TCACCATGGTGGCGACCGGGGTAGAGTTGGAGGCTGATG

Contain the exchange pairing base among the primer Gsk3b-Age I-F, ACCGGT is an Age I restriction enzyme site, and CGCCACC contains the exchange pairing base for expressing enhancement sequences among the primer Gsk3b-Age I-R, and ACCGG is an Age I restriction enzyme site,

6. cross expression lentiviral vectors structure according to claim 4 or 5 described rat GSK-3 β goal gene, it is characterized in that: described GSK-3 β goal gene is crossed in the structure of the purpose plasmid of expressing lentiviral vectors, the carrier of GSK-3 β target gene PCR product and linearization for enzyme restriction carries out directed exchange and is connected under 25 the temperature and carries out, convertase is the In-Fusion convertase, the permutoid reaction time is 30 minutes, under 42 ℃ temperature, reacted 15 minutes again after finishing, prepare exchange liquid.

7. cross expression lentiviral vectors structure according to claim 4 or 5 described rat GSK-3 β goal gene, it is characterized in that: described GSK-3 β goal gene is crossed in the structure of the purpose plasmid of expressing lentiviral vectors, and competent escherichia coli cell is by CaCl ₂Prepare, exchange product transformed into escherichia coli competent cell comprises the exchange liquid adding competent escherichia coli cell that exchanges product with containing, the uniform mixing content, in ice, placed 30 minutes, again mixture is carried out 42 ℃ water-bath, take out to leave standstill after 90 seconds mixture is transferred in the ice bath fast, cooled off 1～2 minute, the LB substratum that adds 800ul, recovery is 45 minutes on 37 ℃ of shaking tables; 150 μ l are transferred on the LB nutrient agar of AMP resistance, place greenhouse to liquid to be absorbed, in 37 ℃ of cultivations 16 hours, select transformant again, cultivate again.

8. a rat GSK-3 β goal gene is crossed the expression lentiviral vectors, it is characterized in that: this carrier is made up by claim 4 or 5 described methods and obtains.

9. a rat GSK-3 β goal gene that obtains according to claim 4 or 5 construction processs is crossed the evaluation of expressing lentiviral vectors, it is characterized in that this authentication method crosses the expression lentiviral vectors with rat GSK-3 β goal gene, empty virus vector and physiological saline is transfection rat WB-F344 cell respectively, after reaching best infection multiplicity, under fluorescent microscope, observe the expression of fluorescin, adopt the method testing goal expression of gene situation of Western Blot, extract albumen, utilize BCA method protein quantification protein concentration, to not on the same group the albumen of concentration carry out SDS-PAGE, analytical results.

10. rat GSK-3 β goal gene according to claim 8 is crossed the evaluation of expressing lentiviral vectors, it is characterized in that this authentication method may further comprise the steps:

1. before the transfection rat WB-F344 cell transfecting, with the 293T cell of tryptic digestion logarithmic phase, adjust cell density, cell density to be treated reaches at 70%～80% o'clock and promptly can be used for transfection; During transfection, cross expression lentiviral vectors transfection rat WB-F344 cell with physiological saline, empty virus vector and rat GSK-3 β goal gene respectively, be numbered 1#, 2# and 3# respectively; Under fluorescent microscope, observe the expression of fluorescin after the transfection;

2. after Western Blot testing goal expression of gene reaches best infection multiplicity, at first extract total protein of cell, survey protein concentration, the albumen ultimate density of each sample is adjusted into 2 μ g/ μ l; Each sample is got identical total protein concentration, add sample-loading buffer, make all product, carry out SDS-PAGE again, carry out immunoblotting and immunity colour developing after the end.