CN107641653A - MACC1 AS1 probes are preparing the application in being used to predict the diagnostic reagent of stomach cancer clinical prognosis - Google Patents

Abstract

The invention belongs to the function and application field of gene and RNA, is related to MACC1 AS1 probes and is preparing the application in being used to predict the diagnostic reagent of stomach cancer clinical prognosis.The present invention also provides a kind of diagnostic kit for being used to predict stomach cancer clinical prognosis, and the kit includes MACC1 AS1 probes.The invention firstly discloses in stomach cancer, MACC1 AS1 are related to patients with gastric cancer prognosis, with patient clinical by stages, TNM stage positive correlation；Be stomach cancer cell sugar-free stress when, produce polyphenoils maintain redox equilibrium, promote glycolysis carry out maintenance glycometabolism, survive reduce apoptosis important molecule.Therefore, the present invention provides theoretical foundation and Clinical Basis for research patients with gastric cancer clinical prognosis correlative factor, for the clinical practice of non-coding RNA.

Description

MACC1-AS1 probes are being prepared for predicting in the diagnostic reagent of stomach cancer clinical prognosis Application

Technical field

The invention belongs to the function and application field of gene and RNA, it is related to MACC1-AS1 application, more particularly to MACC1-AS1 probes are preparing the application in being used to predict the diagnostic reagent of stomach cancer clinical prognosis.

Background technology

Stomach cancer is the malignant tumour of the death rate second in global range, and evil is occupied in the morbidity and mortality of Chinese stomach cancer Property tumour ranking front three.And due to early gastric caacer symptom unobvious, the Patients with Gastric Cancer more than 2/3 has been late in first visit Phase.It is various currently for the medicament categories of chemotherapy of gastric cancer, such as：Alkylating agent, antimetabolite and topoisomerase enzyme inhibitor etc..But The classic chemotherapy Regimen Chemotherapy overall reaction rate (overall response rate, ORR) of late gastric cancer only >=40%, give birth to by middle position Phase 8- is deposited 10 months, even if joint targeted therapy, median survival interval only extend to 13.8 months.Meanwhile chemotherapy of gastric cancer curative effect is different Matter is higher, although Partial tumors mark can react gastric cancer tumor load and treatment curative effect, still remain to be discovered prediction at present The index and its detection method of patients with gastric cancer clinical prognosis.So finding early diagnosis and the method for prognosis of simplicity, excavate new Anti-gastric cancer medicament is still to capture stomach cancer urgent problem to be solved at present.

Energetic supersession restructuring is that malignant cell is different from one of 10 big features of normal cell.In normal cell, Glucose is most important Energy supply material, and sugared aerobic oxidation is most important energy supply approach.And in many malignant cells In, ATP caused by aerobic glycolysis (Warburg effects) is even as high as 60%, and its glycolysis level is the 20- of normal cell 30 times.Because malignant cell has the feature of infinite multiplication, the environment of tumor by local relatively hypoxia promotes tumour cell Metabolism is recombinated to tackle the stress situation of energy deficiency.AMPK (AMP-activated protein kinase) is intracellular weight The energy receptor wanted, AMPK can be activated when intracellular AMP/ATP ratios raise, promote cell to start synthesis ATP decomposition Metabolic process, such as glycolysis, also controllable pentose phosphate pathway is so as to producing NADPH with balance oxidation reducing condition.Existing text Report is offered, under the conditions of glucose deprivation, AMPK can pass through MACC1 (metastasis-associated in colon Cancer-1 stomach cancer cell) is regulated and controled by glycolytic pathway capacitation, this further prompts related-metabolism index is possible can conduct Clinical patients with gastric cancer assesses one of index of prognosis.

MACC1-AS1 (NR_046756) is long-chain non-coding RNA (the long noncoding positioned at MACC1 antisense strands RNA, lnc RNA), there is not yet this lnc RNA correlation function research reports in malignant tumour.

The content of the invention

It is an object of the invention to provide the new opplication of MACC1-AS1 probes, specifically MACC1-AS1 probes are preparing use Application in the diagnostic reagent of prediction stomach cancer clinical prognosis.

Preferably, the MACC1-AS1 probes include such as SEQ ID NO:Nucleotide sequence shown in 1.

Preferably, the MACC1-AS1 probes are the double Digoxigenin labeled probes of MACC1-AS1.

According to the further feature of application of the present invention, the application is included by situ hybridization detection from tested MACC1-AS1 dyeing scorings in sample, the MACC1-AS1 dyeing scoring are in patients with gastric cancer clinical prognosis and clinical stages Positive correlation.

In the present invention, inventor carries out hybridization in situ experiment detection to the paraffin organization sample of 124 patients with gastric cancer MACC1-AS1 expression quantity, and serial section row immunohistochemical staining is detected and positioned in MACC1 expression quantity and both tissues Situation.As a result show, expression of the MACC1-AS1 in stomach organization is higher than cancer beside organism, and clinical stages is higher, TNM stage Higher, MACC1-AS1 expressions are higher.Animal experiment is also prompted, and MACC1-AS1 can promote stomach cancer cell lung to shift. In function assessment experiment, checking MACC1-AS1 is stripped off in glucose or is resisted apoptosis to stomach cancer cell during glucose low concentration, is maintained The facilitation of propagation.The hybridization probe that above two parts test provable MACC1-AS1 is examined as patients with gastric cancer clinical prognosis The substantial worth of test agent.It is horizontal in molecular mechanism, it have detected after sugar-free or low sugar, oxidative stress processing in stomach cancer cell line MACC1-AS1 expression quantity changes, and have detected and joint is processed as above is overexpressed stomach cancer cell glycolysis relevant enzyme after MACC1-AS1 Expression changes and activity change, intracellular reducing substances (NADPH, GSH) content change and the change of cell generation ATP amount Change.In stomach cancer cell experiment, the intracellular obvious increase of MACC1-AS1 expression after sugar-free or low sugar stimulation, while give anti-oxidant Agent handles visible MACC1-AS1 without significant change.The stomach cancer cell after MACC1-AS1 processing is overexpressed in sugar-free or low sugar environment Under can maintain multiplication capacity, apoptosis reduce.Above-mentioned molecules experiment can prove MACC1-AS1 in stomach cancer cell row glycolysis The important function played during approach production capacity, it is to aid in stomach cancer cell and is under the conditions of the relative shortage of glucose, oxidative stress The important molecule survived.It is understood that MACC1-AS1 is probably cell generation metabolism restructuring under regulation and control stressed condition Key molecule.Therefore, the present invention judges that the detection probe of patients with gastric cancer prognosis provides theoretical foundation and clinical base for research Plinth, so as to prove that MACC1-AS1 probes can predict the mechanism of patients with gastric cancer prognosis.

It is a further object to provide a kind of diagnostic kit for being used to predict stomach cancer clinical prognosis, the kit Including MACC1-AS1 probes.According to the further feature of diagnostic kit of the present invention, the diagnostic kit is original position Hybridization check kit.

The diagnostic kit is carried out according to the standard step of in situ hybridization kit.Main component is in kit MACC1- AS1 probes, conventional ingredient are：40% deionized formamide, 10% glucan, 1 × Denhardt's, 0.02% Ficoll, 0.02% polyvinylpyrrolidone (polyvinylpyrrolidone).Dye level is divided into 0 point of (colourless), 1 Divide (lavender (In situ hybridization)), 2 points (purples), 3 points (darkviolets), every kind of dyeing occupied area is then according to 0 point of (nothing Cell dyeing), 1 point (25% dyeing), 2 points (50% dyeing), 3 points (75% dyeing) and 4 points (100% dyeing).Then dye Depth scoring is added after being multiplied with the scoring of corresponding stained area, has both obtained last MACC1-AS1 dyeing scorings.Wherein 0- 2 points are defined as radiolucent table and reach, and 3-7 points are defined as weakly positive expression, and 8-12 points are defined as strong positive expression.Pass through calculating MACC1-AS1 dyeing scorings, it is seen that the sensitivity of diagnosis of gastric cancer TNM stage is：52.63%, specificity is：63.53%, and comment Divide higher patient's prognosis poorer.

It is related to clinical patients with gastric cancer prognosis the invention firstly discloses MACC1-AS1, with patient's TNM stage and clinical point Phase is related.Animal experiment is also prompted, and MACC1-AS1 can promote stomach cancer cell lung to shift, while also demonstrate MACC1- first Critical functions of the AS1 in stomach cancer cell glycolytic cycle, disclosing MACC1-AS1 has the mechanism of stomach cancer prognostic value.

Brief description of the drawings

Figure 1A is to detect MACC1-AS1 in stomach organization and the knot of cancer beside organism's expression difference by hybridization in situ technique Fruit statistical chart.

Figure 1B is to be detected by hybridization in situ technique in different clinical stages patient cancerous tissues and cancer beside organism's section MACC1- AS1 are expressed and distribution situation representative graph, multiplication factor：400.

Fig. 1 C are the MACC1-AS1 expression statistical results charts in different TNM groups.

Fig. 1 D are after serial section row immunohistochemical staining or in situ hybridization, are distributed in MACC1 and MACC1-AS1 tissues Representative graph.

Fig. 1 E are MACC1 and MACC1-AS1 coexpressions situation statistical results chart, multiplication factor in serial section： 400、 1000。

Fig. 1 F-H are the Kaplan- of influence of the MACC1-AS1 different expressions to I-III phase patients with gastric cancer prognosis Meier curve maps.

Fig. 1 I-K are the Kaplan-Meier curve maps of the prognostic analysis of IV phase Patients with Gastric Cancer, according to MACC1-AS with Whether MACC1, which co-expresses, is grouped.

Fig. 1 L show table 1-1：MACC1-AS1 and MACC1 expression and the patients with gastric cancer relation with prognosis by stages.

Fig. 1 M show table 1-2：TNM I-III phases and the clinical case data of IV phases and MACC1-AS1 expression.

Fig. 2A-B are that nude mice tail vein injection is overexpressed lung's transfer stove after MACC1-AS1 stomach cancer cell line

Substantially representative graph and SABC representative graph.

Fig. 3 A are MACC1-AS1 structural representations.

Fig. 3 B are the PCR result statistical charts of MACC1-AS1 expression quantity in normal gastric epithelial cell and each stomach cancer cell line. (#P<0.01)

Fig. 3 C are FISH and fluorescence immunization coloration result figure, show that MACC1-AS1 and MACC1 cell are default respectively Position.Multiplication factor：3000.

Fig. 3 D are the caryoplasm distribution situations that MACC1-AS1 is expressed in round pcr detection stomach cancer cell.

Fig. 4 A-B are to give ROS (Reactive oxygen after sugar-free stimulation, N-acetylcystein processing stomach cancer cell Species) testing result (+P<0.001).

Fig. 4 C-E are using sugar-free training base (C), H₂O₂(D, ROS derivant), 2-DG (E, 2-Deoxy-D- glucose, sugar Glycolysis inhibitor) PCR detection MACC1-AS1 expression quantity changes after processing stomach cancer cell statistical results chart. (*P<0.05, #P< 0.01 ,+P<0.001)

Fig. 4 F are to give PCR detection MACC1-AS1 expression quantity change systems after sugar-free stimulation, N-acetylcystein processing stomach cancer cell Count result figure.(#P<0.01)

Fig. 4 G are to give PCR detection MACC1-AS1 expression quantity change statistical results charts after low sugar training base culture stomach cancer cell. (#P< 0.01 ,+P<0.001)

Fig. 4 H are to give the horizontal change of Western blot detection glycolysis correlative protein expressions after low sugar training base culture stomach cancer cell.

Fig. 5 A are the PCR the result figures of the stomach cancer cell line for the overexpression MACC1-AS1 for transiently transfecting plasmid construction. (+P<0.001)

Fig. 5 B are the result statistical charts for the survival condition that MACC1-AS1 cell lines are overexpressed under the conditions of MTT experiment detection sugar is deprived. (+P<0.001)

Fig. 5 C are the overexpression MACC1-AS1 stomach cancer cell line colony formations under the low sugar training base culture of various concentrations Result figure.

Fig. 5 D are to be overexpressed the multiple apoptosis-related protein Western blot representative graphs of MACC1-AS1 cell lines.

Fig. 5 E-F are the results that the MACC1-AS1 stomach cancer cell plant flow cytometer detection cell cycles are overexpressed after sugar-free stimulates Figure.

Fig. 5 G-H be EDU (5-Ethynyl-2'-deoxyuridine) experiment detection sugar-free stress when be overexpressed MACC1- AS1 stomach cancer cell line multiplication capacity result figures.(*P<0.05)

Fig. 5 I-J be flow cytometer detection sugar-free stress when be overexpressed MACC1-AS1 stomach cancer cell line apoptosis situation result figures.(*P< 0.05)

Fig. 6 A are that PCR experiment proves to be overexpressed glycolysis mRNA expression of gene associated situation knot in MACC1-AS1 stomach cancer cell lines Fruit statistical chart.(*P<0.05)

Fig. 6 B-C displays are overexpressed glycolysis correlative protein expression situation in MACC1-AS1 stomach cancer cell lines, are Western Blot (B) and immunofluorescence dyeing (C) result figure.Multiplication factor：1200.

Fig. 6 D-E are that sugar-free stimulates lower overexpression MACC1-AS1 stomach cancer cell lines 2-NBDG (2- [N- (7-nitrobenz- 2- oxa-1,3-diazol-4-yl) amino] -2-deoxy-D-glucose, glucalogue) intake flow cytometer detection knot Fruit is schemed. (*P<0.05)

Fig. 6 F-G be sugar-free or low sugar processing after detection be overexpressed MACC1-AS1 stomach cancer cell lines ATP (F) and lactic acid (G) contain Amount change statistical results chart.(*P<0.05 ,+P<0.001)

Fig. 6 H-I are to be overexpressed hexokinase activity (H) and lactic acid dehydrogenase activity (I) detection in MACC1-AS1 stomach cancer cell lines As a result statistical chart.(*P<0.05)

Fig. 7 A are endocellular sugar glycolysis and pentose phosphate pathway metabolism schematic diagram.

Fig. 7 B are that sugar-free stimulates the lower testing result for being overexpressed MACC1-AS1 stomach cancer cell lines ROS quantitatively to scheme. (+P< 0.001)

Fig. 7 C-E are using sugar-free training base (C), H₂O₂(D, ROS derivant), 2-DG (E, 2-Deoxy-D-glucose, glycolysis Inhibitor) detection inhibitory rate of cell growth statistical results chart after overexpression MACC1-AS1 stomach cancer cell lines is handled respectively.Wherein plus It is positive controls to enter N-acetylcystein treatment group.(*P<0.05, #P<0.01 ,+P<0.001)

Fig. 7 F-G are that sugar-free stimulates lower MACC1-AS1 stomach cancer cell lines NADPH (F), the NADP+/NADPH (G) of being overexpressed to detect knot Fruit statistical chart.(*P<0.05, #P<0.01 ,+P<0.001)

Fig. 7 H-I are that sugar-free stimulates lower overexpression MACC1-AS1 stomach cancer cell lines GSH (G), GSSG/GSH (H) testing result statistics Figure.(#P<0.01)

Embodiment

Patient and tumor tissues sample

All experiments involved in the present invention are carried out under the license of Hospital of Southern Medical University Ethics Committee, institute Some tumor tissues specimen samplings all have passed through patient's agreement.FFPE sample is derived from 124 patients with gastric cancer specimens from pri, The time drew materials from 2004 to 2010.All patients included are classified according to the standards of AJCC 2010.

SABC and In situ hybridization

The article that team where the specific steps and dyeing points-scoring system of SABC can refer to inventor is delivered before this (Wang,L.,et al.,Metastasis‐associated in colon cancer-1upregulation predicts a poor prognosis of gastric cancer,and promotes tumor cell proliferation and invasion.International Journal of Cancer,2013. 133(6):p.1419-1430.).In situ hybridization Dyeing is carried out using the standard step of in situ hybridization kit.Immunohistochemical staining identifies MACC1 albumen, in situ hybridization mark MACC1-AS1.The main component of in situ hybridization kit is MACC1-AS1 probes, is double Digoxigenin labeled probes, Specifically nucleotide sequence is：5’ DigN/TCAATGCAGATCTAATACTCCT/3’Dig_N(SEQ ID NO:1).Conventional ingredient For：Hybridization buffer：40% deionized formamide, 10% glucan, 1 × Denhardt's, 0.02%Ficoll, 0.02% gather Vinylpyrrolidone (polyvinylpyrrolidone).Immunohistochemical staining uses MACC1 antibody to be purchased from Abcam companies (San Francisco, California, the U.S.), HRP mark secondary antibodies are purchased from company of Zhong Shan Golden Bridge, and DAB staining kits are purchased from CWBIO Company.

In situ hybridization step：It is first according in situ hybridization kit specification and carries out preparation of reagents.Will with slicer The good tissue of FFPE is made the histotomy of about 4 μ m thicks, and 60 DEG C of roasting pieces 1 hour, (dimethylbenzene dewaxes for dimethylbenzene dewaxing 10min × 3 time, 100% ethanol 3min × 2 time, 95% ethanol 3min, it is placed in PBS and cleans × 2 times), section is dried, in 300 μ L Proteinase K Solution is added dropwise at tissue, histotomy is completely covered, is catalyzed 10 minutes in 37 DEG C, slide is placed in PBS Middle termination, section dehydration (70% ethanol 1 minute, 95% ethanol 1 minute, 100% ethanol 1 minute), will cut into slices flat placement, drop The hybrid mixed liquid (concentration and probe concentration 80nM) for adding 25 μ L to prepare, is placed in insulating box 50 DEG C 2 hours.SSC buffer solution for cleaning is cut into slices (5 × SSC 5 divides × 1 time, and 1 × SSC 5 divides × 2 times, and 0.2 × SSC 5 divides × 3 times), confining liquid are incubated 15 minutes, are added dropwise anti-DIG(1:800) reagent reacting 60 minutes, PBST clean × 3 times, 3 minutes every time, are added dropwise AP substrates NBT/BCIP, 30 DEG C Lucifuge 2 hours, KTBT buffer solutions are incubated, terminating reaction.0.2% core fast red is redyed 2 minutes, and water rinses 10 minutes, section dehydration (70% ethanol 5 divides × 2 times, and 95% ethanol 5 divides × 2 times, and 100% ethanol 5 divides × 2 times), mountant lid cover glass envelope is added dropwise Piece, using just putting, light microscope is carried out observing film making and dyeing is scored.

Dye level is divided into 0 point (colourless), 1 point ((in situ hybridization contaminates for faint yellow (immunohistochemical staining), lavender Color)), 2 points (yellow, purples), 3 points (brown color, darkviolets), it is every kind of dyeing occupied area then according to 0 point (acellular dyeing), 1 point (25% dyeing), 2 points (50% dyeing), 3 points (75% dyeing) and 4 points (100% dyeing).Then dye level scoring and Corresponding stained area scoring is added after being multiplied, and has both obtained last MACC1 dyeing scorings.Wherein 0-2 points are defined as feminine gender Expression, 3-7 points are defined as weakly positive expression, and 8-12 points are defined as strong positive expression.

Cell culture：Human Gastric carcinoma's cell line BGC803, BGC823, MKN45, SGC 7901, MGC 803 and normal gastric stick Film epithelial cell line GES-1 is purchased from Foleibao (Shanghai, China).Cell training base is that RPMI 1640 trains base, wherein adding 10% Hyclone, it is purchased from HyClone (Utah State, the U.S.).Condition of culture is 37 DEG C, 5%CO₂.When building sugar-free stressed condition Base 1640 is trained using sugar-free, purchased from GIBCO (U.S.).

Vector construction and transient transfection：It is to be expanded by Invitrogen companies by PCR to be overexpressed MACC1-AS1 plasmids What MACC1-AS1cDNA, XbaI and EcoRI site were built after being subcloned.Transfecting the medium used is The kits of Lipofectamine 2000, purchased from Invitrogen companies, operated according to specification in kit.

Slow-virus transfection：MACC1-AS1 is overexpressed slow virus by GeneChem companies (Shanghai, China) structure, with infection Plural number 200 transfects two plants of stomach cancer cells of BGC803 and MKN45.After 1 μ g/mL puromycins screen 2 weeks, obtained by PCR checkings Obtain the stable cell lines being overexpressed of MACC1-AS1.Above-mentioned steps are also used for building the stable silence strain stomach cancer cells of MACC1.

Zoopery：MACC1-AS1 stomach cancer cell lines MKN45 will be overexpressed with 5 × 10⁵Quantity is injected 4 weeks through tail vein In age nude mouse, injection gives disconnected neck to put to death after 6 weeks, takes out complete lung tissue and takes pictures and its FFPE, row HE are dyed and exempted from Epidemic disease histochemical staining.

Immunoblotting (Western blot)：The text that total protein of cell extraction is delivered before this according to inventor team Chapter (Yang, T., et al., MACC1mediates acetylcholine-induced invasion and migration by human gastric cancer cells.Oncotarget,2016)。

Use antibody：Abcam (Cambridge, Massachusetts, the U.S.) company：GLUT1, HK2 monoclonal antibody； ImmunoWay (New York, Delaware state, the U.S.) company：GAPDH monoclonal antibodies；Proteintech Group (Chicago, she Li Nuozhou, the U.S.) company：LDH, β-actin, histone H 3 monoclonal antibody；(Cambridge, Massachusetts are beautiful by Abclonal State) company：Caspase3, BAX, CDK1, CDKN monoclonal antibody.The goat antirabbit secondary antibody of horseradish peroxidase-labeled and mountain Sheep anti mouse secondary antibody is purchased from Bioss (Beijing, China).Protein level sxemiquantitative, β-actin and group are carried out using Image J softwares Albumen H3 is internal reference.

RNA is extracted and real-time quantitative fluorescence PCR

Intracellular Total RNAs extraction is to use TRIZOL reagents (Invitrogen companies), and concrete operations flow is according to the description of product Book.CDNA synthesis uses First Strand cDNA kits (Takara).Quantitative fluorescent PCR uses SYBR Green dye Kit (being purchased from Roche, Peng Cibeige, Germany) is completed.The primer sequence is as shown in the table in experiment.Relative expression quantity with SnRNA U6 or β-actin are with reference to progress 2^-ΔΔCtComputing.

MACC1-AS1：

F-GCCAGTCAGAAAATGAGGAAC(21nt)

R-CCAGTTGGGTGAACAGGAC(19nt)

Glucose transporter-1 (GLUT1)：

F-GGTTGTGCCATACTCATGACC(21nt)

R-CAGATAGGACATCCAGGGTAGC(22nt)

Hexokinase 2 (HK2)：

F-TCCCCTGCCACCAGACTA(18nt)

R-TGGACTTGAATCCCTTGGTC(20nt)

Monocarboxylate transporter body 1 (MCT1)：

F-CATGCCACCACCAGCGAAG(19nt)

R-TGACAAGCAGCCACCAACAATC(22nt)

6 glucose phosphate dehydrogenases (G6PD)：

F-ACAGAGTGAGCCCTTCTTCAA(21nt)

R-GGAGGCTGCATCATCGTACT(20nt)

Beta-actin (β-actin)：

F-TGGCACCCAGCACAATGAA(19nt)

R-CTAAGTCATAGTCCGCCTAGAAGCA(25nt)

U6：

F-CTCGCTTCGGCAGCACA(17nt)

R-AACGCTTCACGAATTTGCGT(20nt)

18s-RNA：

F-GCCCGAAGCGTTTACTTTGA(20nt)

R-TCCATTATTCCTAGCTGCGGTATC(24nt)

FISH and immunofluorescence dyeing

Synthesize Cy3 probes and be used for FISH to show MACC1-AS1, cell to be contaminated is through PBS after paraformaldehyde (Suo Laibao companies, China) descending fixation in 15 minutes at room temperature of infiltration.Paraformaldehyde cleaning after, will training ware be placed on ice, in Infiltrated 10 minutes in 0.5%Triton X-100, increase cell permeability.It is (wide according to Rui Bo companies after PBS cleans 3 times again State, China) Fluorescent in Situ Hybridization kit specification row crossover process, hybridization environment be The moist small interior of lucifuge, 37 DEG C 12 hours.Sodium citrate buffer solution (the saline- of series concentration is given in hybridization after terminating Sodium citrate, SSC) cleaning.For display MACC1-AS1 and MACC1 common location situations, same ware cell is again through poly After formaldehyde is fixed, 1%Triton solution is incubated 20min, and 30min is closed using 3%BSA solution.MACC1 primary antibody dilution ratio roots Adjusted according to product description, 4 DEG C of overnight incubations of primary antibody.Afterwards, using fluorescence secondary antibody (being purchased from Beyotime, Chinese Shanghai) room temperature 1h is incubated, gives 4', 6- diamidinos -2-phenylindone (4', 6-diamidino-2-phenylindole, DAPI) dye nucleus. Finally using Laser Scanning Confocal Microscope (Olympus Optical, Tokyo) observation shooting.

Nucleus cytoplasm rna and Protein Separation

Cell is on ice after PBS 3 times, according to PARIS kits (Life Technologies, Inc., Carlsbad, Jia Lifuni Sub- state, the U.S.) specification operation.In simple terms, cell cracks through dissociating buffer (cell fractionation buffer) Afterwards, it is incubated on ice 10 minutes, 4 DEG C of 500g are centrifuged 5 minutes, and it is cytoplasmic components that supernatant is taken after centrifugation, are added in remaining karyon composition Enter clasmatosis buffer solution (cell disruption buffer)

Continue to crack, the cytosolic fractions of acquisition and karyon part carry out RNA and Protein Extraction according still further to specification, obtain product Finally separating effect is verified through PCR and Western blot.

Metabolin, ROS and Enzyme assay

Cell to be measured is with 2 × 10⁵The density kind in/hole is overexpressed MACC1-AS1 plasmids, sugar-free after 48 hours in six hole versions, transfection Stimulation group will train base and be replaced by sugar-free training base, cultivate 12-24 hours, collects cell training base and is used to measure lactic acid concn (kit Build up Bioengineering Research Institute purchased from Nanjing, China), cell through cracking be used to measuring ATP (kit is purchased from the green skies, Haimen, China), Hexokinase 2 (hexokinase2, HK2) activity and lactic dehydrogenase (lactate dehydrogenase, LDH) Activity (kit is purchased from Ke Ming Bioisystech Co., Ltd, Suzhou, China).ROS detections are (to be purchased from Nanjing according to kit Bioengineering Research Institute is built up, China) specification operation, pass through fluorescence 2', 7'- dichlorofluorescein diacetate esters (fluorescent 2 ', 7 '-dichlorofluorescin diacetate, DCF-DA) is detected.

NADP+/NADPH and GSH/GSSG detections

Cell to be measured is after 12 hours sugar-frees train base culture, after with pancreatin, cell is collected, according to NADP+/NADPH and GSH/ GSSG immue quantitative detection reagent boxes (being purchased from Biovision companies, California, the U.S.) interior specification is operated.

Apoptosis, survival rate and cell cycle detection

Apoptosis is carried out according to Annexin/PI kits (Kai Ji Bioisystech Co., Ltd, Nanjing, China) specification Operation, is detected by stream type cell analyzer (BD Biosciences companies, San Jose, California, the U.S.). Cell cycle is grasped according to cell cycle detection kit (Kai Ji Bioisystech Co., Ltd, Nanjing, China) specification Make.Cell survival rate is that (5-Ethynyl-2'-deoxyuridine, 5- acetenyl -2- deoxidations are urinated by MTT experiment and EDU Glycosides) operation is detected to specifications for experiment (kit is purchased from Rui Bo bio tech ltd, Guangzhou, China).

Colony formation

MACC1-AS1 stomach cancer cell line is overexpressed after stable transfection with 1 × 10³The density in/hole is inoculated in 6 orifice plate culture 2 days, Low sugar stimulation group is replaced by corresponding concentration of glucose training base and carries out culture 2 weeks.With PBS cell 2 times, fixed through paraformaldehyde Afterwards, dyed with 0.5% crystal violet solution.Photographed to record after cleaning up.

Data analysis

All data analyses use GraphPad Prism softwares.T is examined and one-way ANOVA are examined for data in text Comparative evaluation whether there is significant difference between group.Kaplan-Meier survivorship curves can survive between the displaying different grouping of image The difference of time, significant difference are calculated by Wilcoxon rank tests.COX regression analyses are used to determine that patients with gastric cancer is pre- Independent factor afterwards, event are defined as the death incident relevant with cancer.Spearman correlation analysis is used to calculate patients with gastric cancer Clinical stages and the correlation degree of MACC1-AS1 dyeing scorings.Pearson correlation analyses be used for calculate MACC1-AS1 and MACC1 coefficient of determination R².P values think significant difference be present less than 0.05.

Reagent：2-deoxy-D-glucose (2-Deoxy-D-glucose, 2-DG), cycloheximide (Cycloheximide, CHX), (Princeton, Massachusetts are beautiful purchased from MedChem Express companies for actinomycin D (Dactinomycin D) State), MTT (3- (4,5-dimethylthiazol-2-yl) -2,5-diphenyl tetrazolium bromide, 3- (4,5- Dimethylthiazole -2) -2,5- diphenyltetrazolium bromide bromides) purchased from lid skies Bioisystech Co., Ltd (Wuhan, China).2- NBDG (2- [N- (7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino] -2-deoxy-D-glucose, glucose Analog) and DAPI (4 ', 6-diamidino-2-phenylindole, 4 ', 6- diamidinos -2-phenylindone) be purchased from Invitrogen companies. H₂O₂, NAC (N-acetyl-L-cysteine, N-acetyl-L-cysteine) be purchased from Sigma- Aldrich (U.S.)；Living imaging fluorescein VivoGlo Luciferin are purchased from Promega companies (Madison, prestige Si Kangxin states, the U.S.).PGEM-carrier T, T4DNA ligases, restriction enzyme SacII, SP6RNA Polymerase It is purchased from Promega companies；Plasmid extraction kit and DNA purification kits purchase white TIANGEN；DIG marks the mark of cRNA probes Remember kit, be Boehringer Mannheim Products.Other reagents have been mentioned above.

Embodiment one：MACC1-AS1 is high, and expression is related to patients with gastric cancer poor prognosis.

MACC1-AS1 expression quantity is carried out using in situ hybridization (ISH) to the paraffin organization sample of 124 patients with gastric cancer to comment Estimate.As a result show, MACC1-AS1 is significantly higher than cancer beside organism (Figure 1A) in the expression quantity of stomach organization.With patient clinical by stages Increase, MACC1-AS1 dyeing scoring also increase (Figure 1B).

According to MACC1-AS1 dye levels, all patients are divided into 3 groups, are negative group of (0~2 point), weakly positive group respectively (3~7 points), strong positive group (8-12 points).In 124 patients with gastric cancer, a total of 8 negative patients, 116 are MACC1- AS1 is positive, wherein 64 are weakly positive, 52 are strong positive.Using pathological diagnosis as goldstandard, it is seen that MACC1-AS1 double ground The sensitivity of Gaoxin labeling nucleic acid probe diagnostics classifying gastric cancer TNM is：52.63%, specificity is：63.53%.(calculate public Formula：Sensitivity=IV phase height expression number/IV phase total number of persons × 100%；Specificity=I-III phases are without expression and low expression people Number/I-III phases total number of persons × 100%)

All patients respectively by T by stages, N by stages, M be grouped by stages, find MACC1-AS1 expression and T (P by stages< 0.001), N (P by stages<0.001), M (P by stages<0.001) and TNM stage is proportionate (Fig. 1 C).By carrying out serial section MACC1 immunohistochemical stainings it is visible, MACC1-AS1 and MACC1 are into common location expression phenomenon (Fig. 1 D), and MACC1-AS1 tables Up to amount and MACC1 positive correlations (R²=0.413, p<0.001) (Fig. 1 E).Kaplan- Meier survival analysises are visible, MACC1- AS1 high expression DFS phase in the analysis of the subgroup of phase clinical stages I-III (Fig. 1 F-H) and IV phases patient (Fig. 1 I-K) And Overall survival is shorter, MACC1-AS1 and MACC1 coexpression patient's prognosis is worse.Table 1-1：MACC1-AS1 and MACC1 table Up to the patients with gastric cancer relation with prognosis by stages (see Fig. 1 L).Table 1-2：The clinical case data of TNM I-III phases and IV phases with MACC1-AS1 expression (see Fig. 1 M).

According to above-mentioned clinical observation result, it is believed that MACC1-AS1 is related to patient's poor prognosis in stomach cancer.By This proof, the stomach cancer sample of clinical biopsy or operation, after carrying out In situ hybridization by the standard step of in situ hybridization kit, Scoring is dyed by the criterion calculation MACC1-AS1 in materials and methods, the higher patient's prognosis of scoring is poorer.

With reference to MACC1-AS1 gene locations and team to MACC1 the result of study in terms of glycometabolism, consider MACC1-AS1 Stomach cancer cell may be influenceed by glycometabolism to survive, it is then related to patient's prognosis.

Embodiment two：Experiment in vivo confirms that MACC1-AS1 remarkably promotes the transfer of stomach cancer cell lung

MACC1-AS1 stomach cancer cell lines MKN45 will be overexpressed with 5 × 10⁵Quantity is injected in 4 week old nude mouses through tail vein, note The neck that breaks after penetrating 6 weeks is put to death, and is taken out lung and is taken pictures (Fig. 2A) and by its FFPE, row HE dyeing and immunohistochemical staining, detection MACC1, Ki67 (proliferative index) and 8-OHdG (oxidative stress index) (Fig. 2 B), as a result visible MACC1-AS1 be overexpressed Group is larger relative to the lung's transfer stove quantity and volume of unloaded control group, and MACC1 and Ki67 expression are higher, and 8-OHdG expression is bright It is aobvious to decline, illustrate that MACC1-AS1 promotes the transfer of stomach cancer cell lung, promote proliferation of human gastric cancer cell, resistance redox stress.

Embodiment three：Compared to normal gastric mucosa epithelial cell, MACC1-AS1 significantly high expression in stomach cancer cell.

According to ncbi database, determine that MACC1-AS1 is positioned at the antisense strand (Fig. 3 A) of MACC1 genes.By detecting just MACC1-AS1 expression quantity in normal Gastric Mucosal Cells and more plants of stomach cancer cell lines, it can be found that to be expressed in stomach cancer thin for MACC1-AS1 height In born of the same parents (Fig. 3 B).Choose two plants of stomach cancer cell lines of BGC803 and MKN45 therein and carry out subsequent experimental.

Because the positioning of lncRNA in the cell can aid in determining that it plays the mode of function, therefore row FISH RNA performing PCRs are extracted to detect MACC1-AS1 distribution situations in stomach cancer cell after experiment (FISH) and caryoplasm separation, it is seen that MACC1-AS1 is distributed mainly on cytoplasm (Fig. 3 C-D).Immunofluorescence dyeing is, it was also found that MACC1 and MACC1-AS1 is present altogether Positioning phenomenon, kytoplasm (Fig. 3 C) is positioned at jointly.

Above-mentioned experimental result side, which reflects MACC1-AS1, may participate in MACC1 post-transcriptional level regulation and control, influence MACC1 sugar-free stress when protective effect to cell.

Example IV：MACC1-AS expression increases in sugar is deprived and induces ROS build environments.

Streaming result verification, sugar deprive 0h, 6h, 12h ROS horizontal obvious increase, and the time is longer, and ROS levels are higher, The level at corresponding time point ROS can fall after rise (Fig. 4 A-B) after addition antioxidant NAC.

PCR testing results are shown, are using sugar-free training base (Fig. 4 C), H₂O₂(ROS derivants, Fig. 4 D), 2- DG (2- Deoxy-D-glucose, glycolytic inhibitor, Fig. 4 E) handle respectively stomach cancer cell 0,8,16, detect MACC1-AS1 after 24h Expression quantity increase over time.Under low sugar condition of culture, MACC1-AS1 expression has also raised (Fig. 4 G).In order to visit Whether rope is that ROS promotes increasing for MACC1-AS1 levels, gives sugar-free to stimulate, row after NAC (antioxidant) processing stomach cancer cells PCR is detected, it is found that NAC can significantly reduce the MACC1-AS1 expression (Fig. 4 F) under sugar-free stimulates.Next research, sugar-free or low Whether the MACC1-AS1 dramatically increased during sugar culture is related to glycometabolism, and then row Western blot are detected on protein level, Low sugar stimulates lower glycolytic cycle key enzyme HK2, GLUT1 expression quantity increase (Fig. 4 H).

To sum up show, the MACC1-AS expression increase in the deprivation induced ROS build environments of sugar, and influence glycolysis correlation Expression of enzymes.

Embodiment five：MACC1-AS1 can help the sugared apoptosis for depriving induction of stomach cancer cell resistance

For the function that clear and definite MACC1-AS1 is played in stomach cancer cell, construct MACC1-AS1 and be overexpressed plasmid, and it is right Two plants of cells of BGC803 and MKN45 are transfected (Fig. 5 A).MTT experiment proves that under the conditions of sugar is deprived overexpression group cell is dead Die considerably less than control group (Fig. 5 B).Probed into as influences of the MACC1-AS1 to the stomach cancer cell line long period, carry out clone's shape Into experiment, it is also demonstrated that under low sugar condition of culture, overexpression group can form more bigger cell masses (Fig. 5 C).Next utilize Western blot and flow cytomery Apoptosis and cell cycle situation of change, find overexpression group apoptosis correlation egg White Cleaved caspase-3 and Bax expression reduces (Fig. 5 D), it is meant that MACC1-AS1 overexpression groups apoptosis is reduced.Streaming is thin Under the conditions of born of the same parents' instrument is detected it is again seen that sugar deprives, the overexpression group S phases blocks reduces (Fig. 5 E-F) compared with control group, and apoptosis, which is reduced, (schemes 5I-J).Tested by EDU, it is found that MACC1-AS1 overexpressions group is survived in the case of sugar is deprived and proliferative conditions are better than control group (Fig. 5 G-H).Cell function experimental result prompted MACC1-AS1 stomach cancer cell occur sugar-free stress when can maintain cell Existence, reduce apoptosis.

Embodiment six：MACC1-AS1 promotes the survival of cell by glycolytic pathway.

PCR experiment find be overexpressed MACC1-AS1 stomach cancer cells in glycolysis related gene GLUT1, HK2, G6PD, MCT1 expression quantity raises (Fig. 6 A).Western blot (Fig. 6 B) and immunofluorescence dyeing (Fig. 6 C) result are shown, are overexpressed HK2, GLUT1, LDHA expression quantity raise in MACC1-AS1 MKN45, BGC803 cell.Sugar-free stimulates lower be overexpressed MACC1-AS1 stomach cancer cell lines 2-NBDG (2- [N- (7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino] -2- Deoxy-D-glucose, glucalogue) intake substantially increases, and prompt MACC1-AS1 to increase grape cell Sugar intake Ability (Fig. 6 D-E).

In order to further confirm that MACC1-AS1 is relevant with glycolytic cycle.Overexpression is detected after giving sugar-free or low sugar processing The ATP (Fig. 6 F) and lactic acid (Fig. 6 G) content of MACC1-AS1 stomach cancer cell lines, it is found that ATP contains as concentration of glucose reduces Amount rise, lactate level reduces, and is overexpressed MACC1-AS1 groups and is above control group.Meanwhile it is overexpressed MACC1-AS1 stomaches Hexokinase activity (Fig. 6 H) and lactic acid dehydrogenase activity (Fig. 6 I) also raise in cancer cell.

In summary, it is believed that MACC1-AS1 promotes the survival of cell by glycolytic pathway.

Embodiment seven：MACC1-AS1 maintains cellular redox balance to give sugar by promoting glycolysis and producing NADPH After depriving processing, the intracellular ROS of flow cytomery produces obvious increase, but the less (figure of overexpression group ROS incrementss 7B).(Fig. 7 C), H are stimulated when giving sugar-free respectively₂O₂(Fig. 7 D) and glycolytic inhibitor 2-DG (Fig. 7 E) handle stomach cancer cell, The increase of visible cell growth inhibition ratio, and the similar NAC in the part increased suppression of effect control can be played by being overexpressed MACC1-AS1 Rate processed.

ROS is removed in the cell, and the one of method for saving growth inhibition ratio is increase polyphenoils such as NADPH And GSH level.Then the NADPH and GSH of detection overexpression group and control group can have found after giving sugar-free stimulation：After sugar-free stimulates NADPH is significantly reduced (Fig. 7 F), and NADP+/NADPH increased (Fig. 7 G), but overexpression group can substantially increase into the cell NADPH, balance NADP+/NADPH ratios.Similar, MACC1-AS1 overexpressions group can also increase intracellular after sugar-free stimulates GSH levels (Fig. 7 H), GSSG/GSH (Fig. 7 I) is reduced, to resist the cytotoxicity that sugar-free causes the ROS of intracellular accumulation.

To sum up result prompt, stomach cancer cell occur sugar-free stress when, MACC1-AS1 by produce polyphenoils mitigate Toxicity of the ROS to cell, it may be possible to which MACC1-AS1 promotes stomach cancer cell that one of approach of glycolysis occurs.Integrated embodiment five To seven, it was demonstrated that MACC1-AS1 be to aid in stomach cancer cell reply sugar-free stress important molecule, main path is by producing antioxygen Compound maintains redox equilibrium and promotes glycolytic cycle.Hence it is demonstrated that MACC1-AS1 probes detect as stomach cancer prognosis The theoretical foundation and mechanism of method.

In summary, significances of the present invention MACC1-AS1 clear and definite first as patients with gastric cancer clinical prognosis index, The high expression of MACC1-AS1 by In situ hybridization and calculates MACC1-AS1 dyeing and commented predictive of the poor prognosis of patients with gastric cancer Point, the higher patient's prognosis of scoring is poorer.Experiment in vivo confirms that the promotion that MACC1-AS1 shifts to stomach cancer cell lung is made With.In cell function experiment and molecular mechanism experiment below, it was demonstrated that sugar-free or low sugar stress in the case of, MACC1-AS1 is that reducing substances such as NADPH, GSH are to resist ROS cytotoxicity in stomach cancer cell by increasing, further Promotion cell glycolysis metabolism is played to maintain the effect that energy supplies, to maintain the existence of stomach cancer cell and propagation, reduction is withered Die.To sum up demonstrate the MACC1-AS1 mechanism related to stomach cancer prognosis.

The present invention proves MACC1-AS1 with patients with gastric cancer clinical prognosis and the positive correlation of clinical stages and its to stomach first The prediction significance of cancer patient's poor prognosis, so as to use MACC1-AS1 double Digoxigenin labeled probes first, to stomach cancer group Knit and cancer beside organism's row In situ hybridization.Scoring is dyed by the criterion calculation MACC1-AS1 in materials and methods, it is seen that diagnosis The sensitivity of classifying gastric cancer TNM is 52.63%, specificity 63.53%, and higher patient's prognosis of scoring is poorer.Secondly, hair Present stomach cancer cell experience sugar-free stress when MACC1-AS1 expression increases, and then find it can by increase intracellular NADPH, GSH contents resist oxidative stress, promote glycolytic pathway energy supply, reduce apoptosis in gastric cancer.It can be inferred that in stomach cancer cell In, MACC1-AS1 is the important molecule for safeguarding normal sugar metabolism, and demonstrates the reason for it is as stomach cancer prognostic marker.

Sequence table

<110>Hospital of Southern Medical University

<120>MACC1-AS1 probes are preparing the application in being used to predict the diagnostic reagent of stomach cancer clinical prognosis

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213>Artificial sequence ()

<400> 1

tcaatgcaga tctaatactc ct 22

Claims (8)

1.MACC1-AS1 probes are preparing the application in being used to predict the diagnostic reagent of stomach cancer clinical prognosis.

2. application according to claim 1, it is characterised in that：The MACC1-AS1 probes include such as SEQ ID NO:1 institute The nucleotide sequence shown.

3. application according to claim 1, it is characterised in that：The MACC1-AS1 probes are the double digoxin of MACC1-AS1 Labeling nucleic acid probe.

4. application according to claim 1, it is characterised in that：The application is included by situ hybridization detection from tested MACC1-AS1 dyeing scorings in sample, the MACC1-AS1 dyeing scoring are in patients with gastric cancer clinical prognosis and clinical stages Positive correlation.

A kind of 5. diagnostic kit for being used to predict stomach cancer clinical prognosis, it is characterised in that：Including MACC1-AS1 probes.

6. diagnostic kit according to claim 4, it is characterised in that：The MACC1-AS1 probes include such as SEQ ID NO:Nucleotide sequence shown in 1.

7. diagnostic kit according to claim 4, it is characterised in that：The MACC1-AS1 probes are MACC1-AS1 double Digoxigenin labeled probe.

8. diagnostic kit according to claim 4, it is characterised in that：The diagnostic kit is in situ hybridization detection examination Agent box.