CN107641653B

CN107641653B - Application of MACC1-AS1 probe in preparation of diagnostic reagent for predicting clinical prognosis of gastric cancer

Info

Publication number: CN107641653B
Application number: CN201710983316.0A
Authority: CN
Inventors: 石敏; 赵洋; 刘雅静; 何婉明; 黄琼
Original assignee: Southern Hospital Southern Medical University
Current assignee: Southern Hospital Southern Medical University
Priority date: 2017-10-20
Filing date: 2017-10-20
Publication date: 2021-02-19
Anticipated expiration: 2037-10-20
Also published as: CN107641653A

Abstract

The invention belongs to the field of functions and applications of genes and RNA, and relates to an application of a MACC1-AS1 probe in preparation of a diagnostic reagent for predicting clinical prognosis of gastric cancer. The invention also provides a diagnostic kit for predicting the clinical prognosis of gastric cancer, which comprises the MACC1-AS1 probe. The invention discloses that MACC1-AS1 is positively correlated with prognosis of a patient with gastric cancer, clinical staging of the patient and TNM staging in the gastric cancer for the first time; is an important molecule for generating antioxidant substances to maintain redox balance, promoting glycolysis to maintain glycometabolism, maintaining survival and reducing apoptosis when gastric cancer cells are subjected to sugar-free stress. Therefore, the invention provides theoretical basis and clinical basis for researching relevant factors of clinical prognosis of gastric cancer patients and clinical application of non-coding RNA.

Description

Application of MACC1-AS1 probe in preparation of diagnostic reagent for predicting clinical prognosis of gastric cancer

Technical Field

The invention belongs to the field of functions and applications of genes and RNA, relates to an application of MACC1-AS1, and particularly relates to an application of a MACC1-AS1 probe in preparation of a diagnostic reagent for predicting clinical prognosis of gastric cancer.

Background

Gastric cancer is the second most serious tumor of mortality in the world, and the incidence and mortality of gastric cancer are the top three ranks of malignant tumors in China. And since early symptoms of gastric cancer are not obvious, gastric cancer patients over 2/3 are in an advanced stage at the time of initial diagnosis. The current chemotherapy drugs for gastric cancer are of a wide variety, for example: alkylating agents, antimetabolites, topoisomerase inhibitors, and the like. However, the total response rate (ORR) of the traditional chemotherapy for the advanced gastric cancer is only more than or equal to 40 percent, the median survival time is 8-10 months, and even if the traditional chemotherapy is combined with targeted therapy, the median survival time is only prolonged to 13.8 months. Meanwhile, the heterogeneity of the curative effect of the gastric cancer chemotherapy is high, and although part of tumor markers can reflect the tumor load of the gastric cancer and the curative effect, indexes for predicting the clinical prognosis of gastric cancer patients and detection methods thereof are still to be found at present. Therefore, a simple early diagnosis and prognosis method is searched, and the development of new anti-gastric cancer drugs is still a problem to be solved urgently at present.

Energy metabolic recombination is one of 10 major features that distinguish malignant tumor cells from normal cells. In normal cells, glucose is the most important energy supplying substance, and aerobic oxidation of sugars is the most important energy supplying pathway. In many malignant cells, aerobic glycolysis (Warburg effect) produces ATP at levels as high as 60% and 20-30 times higher than normal cells. Because of the immortal proliferation characteristics of malignant tumor cells, the local relatively hypoxic environment of tumors promotes metabolic recombination of tumor cells to cope with energy-deficient stress conditions. AMPK (AMP-activated protein kinase) is an important intracellular energy receptor, and is activated when the AMP/ATP ratio in cells increases, prompting cells to initiate catabolic processes for ATP synthesis, such as glycolysis, and also regulating the pentose phosphate pathway to produce NADPH to balance redox states. It has been reported in the literature that AMPK can regulate gastric cancer cells to gain energy through glycolysis pathway through MACC1(metastasis-associated in colon cancer-1) under the condition of glucose deprivation, which further suggests that metabolic-related markers may be one of the indexes for prognosis evaluation of clinical gastric cancer patients.

MACC1-AS1(NR _046756) is a long non-coding RNA (incRNA) located in the antisense strand of MACC1, and the function of the incRNA in malignant tumors has not been reported.

Disclosure of Invention

The invention aims to provide a novel application of a MACC1-AS1 probe, in particular to an application of the MACC1-AS1 probe in preparing a diagnostic reagent for predicting the clinical prognosis of gastric cancer.

Preferably, the MACC1-AS1 probe comprises the nucleotide sequence shown AS SEQ ID NO. 1.

Preferably, the MACC1-AS1 probe is a MACC1-AS1 digoxin labeled nucleic acid probe.

According to a further feature of the use of the invention, the use comprises detecting by in situ hybridization a MACC1-AS1 staining score from a test sample, said MACC1-AS1 staining score positively correlated with the clinical prognosis and clinical stage of a gastric cancer patient.

In the invention, the inventor carries out in situ hybridization experiments on paraffin tissue specimens of 124 gastric cancer patients to detect the expression level of MACC1-AS1, and carries out immunohistochemical staining on continuous sections to detect the expression level of MACC1 and the in-tissue localization condition of the MACC 1. The results show that MACC1-AS1 is expressed in gastric cancer tissues higher than in paracarcinoma tissues, and that the higher the clinical stage, the higher the TNM stage, and the higher the expression level of MACC1-AS 1. Animal experiments also suggest that MACC1-AS1 promotes lung metastasis of gastric cancer cells. In functional experiments, MACC1-AS1 is verified to resist apoptosis of gastric cancer cells and maintain the promotion effect of proliferation when glucose is stripped or the concentration of glucose is low. The two experiments can prove the great value of the hybridization probe of MACC1-AS1 AS a clinical prognosis detection reagent for gastric cancer patients. On the molecular mechanism level, the change of the expression level of MACC1-AS1 in gastric cancer cell strains after sugar-free or low-sugar and oxidative stress treatment is detected, and the change of the expression and activity of gastric cancer cell glycolytic related enzymes, the change of intracellular reducing substances (NADPH and GSH) and the change of the ATP amount produced by cells after the treatment and the over-expression of MACC1-AS1 are detected. In the gastric cancer cell experiment, the expression of MACC1-AS1 in cells is obviously increased after sugar-free or low-sugar stimulation, and no obvious change of MACC1-AS1 is observed after the cells are treated by an antioxidant. The gastric cancer cells after the treatment of over-expressing MACC1-AS1 can maintain the proliferation capacity and reduce the apoptosis under the sugar-free or low sugar environment. The molecular experiments can prove that the MACC1-AS1 plays an important role in the glycolysis pathway energy production process of the gastric cancer cell and is an important molecule for helping the gastric cancer cell to maintain survival under the conditions of relative lack of glucose and oxidative stress. Therefore, it is considered that MACC1-AS1 may be a key molecule for regulating metabolic recombination in cells under stress conditions. Therefore, the invention provides theoretical basis and clinical basis for researching and judging the detection probe for the prognosis of the gastric cancer patient, thereby proving that the MACC1-AS1 probe can predict the mechanism of the prognosis of the gastric cancer patient.

It is another object of the present invention to provide a diagnostic kit for predicting the clinical prognosis of gastric cancer, which comprises the MACC1-AS1 probe. According to a further feature of the diagnostic kit of the present invention, the diagnostic kit is an in situ hybridization assay kit.

The diagnostic kit is performed according to standard procedures of in situ hybridization kits. The kit mainly comprises MACC1-AS1 probes and comprises the following conventional components: 40% deionized formamide, 10% dextran, 1 XDenhardt's, 0.02% Ficoll, 0.02% polyvinylpyrrolidone (polyvinylpyrrolindone). The staining depth was divided into 0 point (colorless), 1 point (pale purple (in situ hybridization staining)), 2 points (purple), and 3 points (dark purple), and the area occupied by each staining was divided into 0 point (no cell staining), 1 point (25% staining), 2 points (50% staining), 3 points (75% staining), and 4 points (100% staining). The staining depth scores and the corresponding staining area scores were then multiplied and added together to give the final MACC1-AS1 staining score. Wherein, the score 0-2 is defined as negative expression, the score 3-7 is defined as weak positive expression, and the score 8-12 is defined as strong positive expression. By calculating MACC1-AS1 staining scores, the sensitivity for diagnosing the stage of TNM of gastric cancer was seen to be: 52.63%, specificity: 63.53%, and the higher the score the worse the prognosis of the patient.

The invention discloses that MACC1-AS1 is related to prognosis of patients with clinical gastric cancer for the first time, and is related to the stage and clinical stage of TNM of the patients. Animal experiments also suggest that MACC1-AS1 can promote lung metastasis of gastric cancer cells, and simultaneously, the important function of MACC1-AS1 in the glycolysis process of the gastric cancer cells is verified for the first time, so that a mechanism that MACC1-AS1 has the gastric cancer prognosis value is disclosed.

Drawings

FIG. 1A is a statistical chart showing the results of detecting the difference in expression levels of MACC1-AS1 in gastric cancer tissues and paracancerous tissues by in situ hybridization.

FIG. 1B is a graph showing the expression and distribution of MACC1-AS1 in slices of cancer tissue and paracancerous tissue of patients of different clinical stages detected by in situ hybridization, at magnification: 400.

FIG. 1C is a graph showing the statistics of MACC1-AS1 expression in different TNM groups.

FIG. 1D is a representation of the in-tissue distribution of MACC1 and MACC1-AS1 following immunohistochemical staining or in situ hybridization of serial sections.

FIG. 1E is a graph of the statistics of the co-expression of MACC1 and MACC1-AS1 in serial sections, at magnification: 400. 1000.

FIGS. 1F-H are Kaplan-Meier plots of the effect of different expression levels of MACC1-AS1 on the prognosis of stage I-III gastric cancer patients.

FIGS. 1I-K are Kaplan-Meier plots of prognosis analysis of stage IV gastric cancer patients, grouped according to whether MACC1-AS co-expressed with MACC 1.

FIG. 1L shows tables 1-1: the expression of MACC1-AS1 and MACC1 correlates with the stage and prognosis of gastric cancer patients.

FIG. 1M shows tables 1-2: clinical case data for TNM stages I-III and IV and expression of MACC1-AS 1.

FIG. 2A-B shows the pulmonary metastasis of gastric cancer cell lines over-expressed by MACC1-AS1 injected into the tail vein of nude mice

The general representation and immunohistochemical representation of (A).

FIG. 3A is a schematic diagram of the structure of MACC1-AS 1.

FIG. 3B is a statistical chart of the PCR results of MACC1-AS1 expression levels in normal gastric epithelial cells and various gastric cancer cell lines. (# P <0.01)

FIG. 3C is a graph showing the results of fluorescence in situ hybridization and immunofluorescent staining, showing the intracellular localization of MACC1-AS1 and MACC1, respectively. Magnification: 3000.

FIG. 3D shows the PCR technique for detecting the nuclear mass distribution of MACC1-AS1 in gastric cancer cells.

FIGS. 4A-B show the results of ROS (reactive oxygen species) measurements (+ P <0.001) after treatment of gastric cancer cells with N-acetylcysteine without sugar challenge.

FIGS. 4C-E show the use of sugarless media (C), H₂O₂(D, ROS inducer), 2-DG (E, 2-Deoxy-D-glucose, glycolysis inhibitor) treatmentThe statistical result chart of the change of MACC1-AS1 expression level detected by PCR after gastric cancer cells. (. P)<0.05，#P<0.01，+P<0.001)

FIG. 4F is a graph showing the statistics of the expression level change of MACC1-AS1 detected by PCR after gastric cancer cells were treated with N-acetylcysteine without sugar stimulation. (# P <0.01)

FIG. 4G is a graph showing the statistical results of PCR detection of MACC1-AS1 expression levels after gastric cancer cells were cultured in a low sugar medium. (# P <0.01, + P <0.001)

FIG. 4H shows the detection of changes in the expression levels of glycolytic related proteins by Western blot after gastric cancer cells were cultured in a low sugar medium.

FIG. 5A is a graph showing the results of PCR validation of gastric cancer cell lines overexpressing MACC1-AS1 constructed from transient transfection plasmids. (+ P <0.001)

FIG. 5B is a statistical plot of the results of MTT assays testing the survival of cell lines overexpressing MACC1-AS1 under sugar deprivation conditions. (+ P <0.001)

FIG. 5C is a graph showing the results of a colony formation experiment of a gastric cancer cell line overexpressing MACC1-AS1 in a culture of different concentrations of a low sugar medium.

FIG. 5D is a Western blot representation of several apoptosis-related proteins overexpressing MACC1-AS1 cell line.

FIGS. 5E-F are graphs showing the results of the flow-based cell cycle detection of gastric cancer cell lines overexpressing MACC1-AS1 after sugar-free stimulation.

FIGS. 5G-H are graphs showing the result of the proliferation potency of a gastric cancer cell line overexpressing MACC1-AS1 under sugarless stress detected by EDU (5-ethyl-2' -deoxyuridine) experiment. (. P <0.05)

FIGS. 5I-J are graphs showing the results of flow detection of apoptosis of gastric cancer cell line overexpressing MACC1-AS1 under sugarless stress. (. P <0.05)

FIG. 6A is a statistical chart of the results of PCR experiments demonstrating the expression of mRNA of glycolytic related genes in gastric cancer cell lines overexpressing MACC1-AS 1. (. P <0.05)

FIGS. 6B-C show the expression of glycolytic related protein in gastric cancer cell line overexpressing MACC1-AS1, AS a result of Western blot (B) and immunofluorescence staining (C). Magnification: 1200.

FIGS. 6D-E are graphs showing the results of flow-based assay of the uptake of 2- [ N- (7-nitrobenznz-2-oxa-1, 3-diazol-4-yl) amino ] -2-deoxy-D-glucose (glucose analog) by the MACC1-AS1 gastric cancer cell line 2-NBDG under sugar-free stimulation. (. P <0.05)

FIGS. 6F-G are graphs showing statistics of the change in ATP (F) and lactate (G) content of gastric cancer cell lines overexpressing MACC1-AS1 after treatment with no or low sugar. (. P <0.05, + P <0.001)

FIG. 6H-I is a statistical chart of the results of detection of hexokinase activity (H) and lactate dehydrogenase activity (I) in gastric cancer cell lines overexpressing MACC1-AS 1. (. P <0.05)

FIG. 7A is a schematic representation of glycolysis and pentose phosphate pathway metabolism in cells.

FIG. 7B is a quantitative graph of the detection results of the over-expression of MACC1-AS1 gastric cancer cell line ROS under the stimulation of no sugar. (+ P <0.001)

FIGS. 7C-E show the use of sugarless media (C), H₂O₂(D, ROS inducer) and 2-DG (E, 2-Deoxy-D-glucose, glycolysis inhibitor) are respectively processed to over-express MACC1-AS1 gastric cancer cell strain, and then a statistical result chart of cell growth inhibition rate is detected. The group treated with N-acetylcysteine was used as a positive control group. (. P)<0.05，#P<0.01，+P<0.001)

FIGS. 7F-G are the statistics of the detection results of MACC1-AS1 gastric cancer cell lines NADPH (F), NADP +/NADPH (G) over-expressed without sugar stimulation. (. P <0.05, # P <0.01, + P <0.001)

FIG. 7H-I is a statistical chart of the results of the detection of MACC1-AS1 gastric cancer cell line GSH (GSH), GSSG/GSH (H) under the condition of no sugar stimulation. (# P <0.01)

Detailed Description

Patient and tumor tissue specimen

All experiments referred to in the present invention were performed under the approval of the southern hospital ethics committee of southern medical university, and all tumor tissue specimens were obtained with patient consent. The paraffin-embedded specimens are surgical specimens from 124 gastric cancer patients, and the material drawing time is from 2004 to 2010. All enrolled patients were graded according to the AJCC 2010 standard.

Immunohistochemistry and in situ hybridization staining

The specific steps of immunohistochemistry and staining scoring system can be referred to the previous publications by the team of the inventors (Wang, L., et al., metals-associated in color Cancer-1 alignment markers a. door registration of structural Cancer, and proteins tumor cell promotion and evolution. International Journal of Cancer, 2013.133 (6): p.1419-1430.). In situ hybridization staining was performed using standard procedures of in situ hybridization kits. Immunohistochemical staining identified MACC1 protein, and in situ hybridization identified MACC1-AS 1. The main component of the in situ hybridization kit is a MACC1-AS1 probe which is a digoxin labeled nucleic acid probe, and the specific nucleic acid sequence is AS follows: 5 'DigN/TCAATGCAGATCTAATACTCCT/3' Dig _ N (SEQ ID NO: 1). The conventional components are as follows: hybridization buffer: 40% deionized formamide, 10% dextran, 1 XDenhardt's, 0.02% Ficoll, 0.02% polyvinylpyrrolidone (polyvinylpyrrolindone). The MACC1 antibody used for immunohistochemical staining was purchased from Abcam corporation (San Francisco, Calif., USA), the HRP-labeled secondary antibody was purchased from China fir gold bridge, and the DAB staining kit was purchased from CWBIO.

In-situ hybridization staining: first, the reagents were prepared according to the in situ hybridization kit instructions. The paraffin embedded tissue was sliced with a microtome to approximately 4 μm thick tissue sections, baked at 60 ℃ for 1 hour, deparaffinized with xylene (deparaffinized with xylene 10min x 3 times, 100% ethanol 3min x 2 times, 95% ethanol 3min, washed in PBS x 2 times), spun-dried, 300 μ L of proteinase K solution was dropped onto the tissue to completely cover the tissue sections, catalyzed at 37 ℃ for 10 minutes, the slide was placed in PBS to stop, the sections were dehydrated (70% ethanol 1 minute, 95% ethanol 1 minute, 100% ethanol 1 minute), laid flat, 25 μ L of the prepared hybridization mixture (probe concentration 80nM) was dropped onto the sections, and placed in a thermostat at 50 ℃ for 2 hours. The sections were washed with SSC buffer (5 XSSC 5 X1 times, 1 XSSC 5 X2 times, 0.2 XSSC 5 X3 times), incubated in blocking solution for 15 minutes, added with anti-DIG (1:800) reagent for 60 minutes, washed with PBST X3 times, 3 minutes each time, added with AP substrate NBT/BCIP, incubated at 30 ℃ in the dark for 2 hours, KTBT buffer was incubated, and the reaction was stopped. Re-staining with 0.2% nuclear fast red for 2 min, washing with water for 10min, dehydrating the slices (5 min. times.2 times with 70% ethanol, 5 min. times.2 times with 95% ethanol, 5 min. times.2 times with 100% ethanol), dropping a blocking agent, covering with a glass slide, blocking, observing with an upright optical microscope, and scoring with staining.

The staining depth was divided into 0 point (colorless), 1 point (yellowish (immunohistochemical staining), pale purple (in situ hybridization staining)), 2 points (yellow, purple), 3 points (tan, dark purple), and the area occupied by each staining was divided into 0 point (no cell staining), 1 point (25% staining), 2 points (50% staining), 3 points (75% staining), and 4 points (100% staining). The staining depth scores and the corresponding staining area scores were then multiplied and added together to give the final MACC1 staining score. Wherein, the score 0-2 is defined as negative expression, the score 3-7 is defined as weak positive expression, and the score 8-12 is defined as strong positive expression.

Cell culture: human gastric cancer cell lines BGC803, BGC823, MKN45, SGC 7901, MGC 803 and the normal gastric mucosal epithelial cell line GES-1 were purchased from Foleibao (Shanghai, China). The cell culture was RPMI 1640 culture supplemented with 10% fetal bovine serum, both purchased from HyClone (utah, usa). The culture conditions were 37 ℃ and 5% CO₂. Sugarless medium 1640, purchased from GIBCO (usa), was used in the construction of sugarless stress conditions.

Vector construction and transient transfection: the over-expression MACC1-AS1 plasmid was constructed by PCR amplification of the MACC1-AS1cDNA, XbaI and EcoRI sites by Invitrogen. The medium used for transfection was Lipofectamine 2000 kit, purchased from Invitrogen, according to the instructions in the kit.

Lentivirus transfection: MACC1-AS1 overexpressing lentivirus was constructed by GeneChem (Shanghai, China) to transfect BGC803 and MKN45 gastric cancer cells at a multiplicity of infection of 200. After 2 weeks of selection with 1. mu.g/mL puromycin, cell lines stably overexpressed by MACC1-AS1 were obtained AS verified by PCR. The above procedure was also used to construct MACC1 stably silenced gastric cancer cells.

Animal experiments: over-expressing MACC1-AS1 gastric cancer cell line MKN45 at 5 × 10⁵The amount of the compound is injected into 4-week-old nude mice through tail veins, the nude mice are killed by neck breakage after 6 weeks of injection, the intact lung tissues are taken out for photographing and are embedded with paraffin, and HE staining and immunohistochemical staining are carried out.

Western blotting (Western blot): total cellular protein extraction was performed according to a previously published article by the group of inventors (Yang, T., et al, MACC1 media-induced induction and differentiation by human scientific cells. oncotarget, 2016).

Using antibodies: abcam (Cambridge, Mass., USA) Inc.: GLUT1, HK2 monoclonal antibody; ImmunoWay (New York, Delawa, USA) Inc.: a GAPDH monoclonal antibody; proteitech Group (Chicago, Illinois, USA): LDH, beta-actin, histone H3 monoclonal antibody; abclonal (Cambridge, Mass., USA) Inc.: caspase3, BAX, CDK1, CDKN monoclonal antibody. Horseradish peroxidase-labeled goat anti-rabbit secondary antibody and goat anti-mouse secondary antibody were purchased from Bioss (beijing, china). Semi-quantitation of protein levels was performed using Image J software, with β -actin and histone H3 being internal references.

RNA extraction and real-time quantitative fluorescent PCR

Total intracellular RNA was extracted using TRIZOL reagent (Invitrogen) according to the protocol. cDNA Synthesis First Strand cDNA kit (Takara) was used. Fluorescent quantitative PCR was performed using SYBR Green dye kit (purchased from Roche, pentgegberg, germany). The sequences of the primers used in the experiments are shown in the table below. Relative expression levels were determined using snRNA U6 or beta-actin as reference 2^-ΔΔCtAnd (6) operation.

MACC1-AS1：

F-GCCAGTCAGAAAATGAGGAAC(21nt)

R-CCAGTTGGGTGAACAGGAC(19nt)

Glucose transporter 1(GLUT 1):

F-GGTTGTGCCATACTCATGACC(21nt)

R-CAGATAGGACATCCAGGGTAGC(22nt)

hexokinase 2(HK 2):

F-TCCCCTGCCACCAGACTA(18nt)

R-TGGACTTGAATCCCTTGGTC(20nt)

monocarboxylic acid transporter 1(MCT 1):

F-CATGCCACCACCAGCGAAG(19nt)

R-TGACAAGCAGCCACCAACAATC(22nt)

glucose 6 phosphate dehydrogenase (G6 PD):

F-ACAGAGTGAGCCCTTCTTCAA(21nt)

R-GGAGGCTGCATCATCGTACT(20nt)

β -actin (β -actin):

F-TGGCACCCAGCACAATGAA(19nt)

R-CTAAGTCATAGTCCGCCTAGAAGCA(25nt)

U6：

F-CTCGCTTCGGCAGCACA(17nt)

R-AACGCTTCACGAATTTGCGT(20nt)

18s-RNA：

F-GCCCGAAGCGTTTACTTTGA(20nt)

R-TCCATTATTCCTAGCTGCGGTATC(24nt)

fluorescence in situ hybridization and immunofluorescence staining

The Cy3 probe was synthesized for fluorescent in situ hybridization to reveal MACC1-AS1, and the cells to be stained were fixed by washing with PBS and then infiltrating with paraformaldehyde (Solebao Co., China) for 15 minutes at room temperature. After paraformaldehyde washing, the petri dish was placed on ice and soaked in 0.5% Triton X-100 for 10 minutes to increase cell permeability. PBS was washed 3 times again, and the Hybridization process was performed according to Fluorocent in Situ Hybridization kit instructions from Ruibo corporation (Guangzhou, China) in a light-protected and moist chamber at 37 ℃ for 12 hours. After hybridization, the cells were washed with a series of sodium citrate buffer (SSC). To show co-localization of MACC1-AS1 and MACC1, the same dish of cells was fixed again with paraformaldehyde, incubated with 1% Triton solution for 20min, and blocked with 3% BSA solution for 30 min. The dilution ratio of MACC1 primary antibody was adjusted according to the product instructions and the primary antibody was incubated overnight at 4 ℃. Thereafter, the cell nuclei were stained with 4',6-diamidino-2-phenylindole (4',6-diamidino-2-phenylindole, DAPI) using a fluorescent secondary antibody (purchased from Beyotime, shanghai, china) incubated at room temperature for 1 h. The photographs were finally observed using a confocal microscope (Olympus Optical, tokyo, japan).

Nuclear cytoplasmic RNA and protein isolation

Cells were washed 3 times with PBS on ice and then manipulated according to the parcis kit (life technologies, carlsbad, ca, usa). Briefly, cells were lysed with a cell lysis buffer, incubated on ice for 10 minutes, centrifuged at 500g at 4 ℃ for 5 minutes, the supernatant was taken as a cytoplasmic fraction after centrifugation, and a cell disruption buffer was added to the remaining nuclear fraction

And (3) continuously cracking, extracting RNA and protein of the obtained cytoplasm part and nucleus part according to the instruction, and finally verifying and separating effects of the obtained product through PCR and Western blot.

Metabolite, ROS, and enzyme activity detection

The cells to be tested were at 2X 10⁵The density of wells was plated in six-well plates, transfected with the over-expressed MACC1-AS1 plasmid, 48 hours later the sugar-free stimulation group changed the medium to sugar-free medium, cultured for 12-24 hours, collected the cell culture medium for measuring lactate concentration (the kit was purchased from Nanjing institute for bioengineering, China), and lysed for measuring ATP (the kit was purchased from Bycy, Haimen, China), hexokinase2 (2, HK2) and Lactate Dehydrogenase (LDH) activities (the kit was purchased from Koming Biotech, Suzhou, China). ROS detection is carried out by fluorescence 2',7' -dichlorofluorescein diacetate (DCF-DA) according to the instruction of a kit (purchased from Nanjing institute of bioengineering, China).

NADP +/NADPH and GSH/GSSG detection

After the cells to be tested were cultured in a sugar-free medium for 12 hours, the cells were collected with pancreatin and then subjected to the operation according to the instructions in a kit for quantitative determination of NADP +/NADPH and GSH/GSSG (purchased from Biovision, Calif., USA).

Apoptosis, survival and cell cycle detection

Apoptosis was detected by flow cytometry using the Annexin/PI kit (Kaiky Biotechnology, Inc., Nanjing, China) as described in the flow cytometry (BD Biosciences, san Jose, Calif., USA). The cell cycle was performed according to the instructions of the cell cycle test kit (Kaiky Biotechnology Co., Ltd., Nanjing, China). The cell viability was determined by MTT assay and EDU (5-ethyl-2' -deoxyuridine, 5-Ethynyl-2-deoxyuridine) assay (kit from Ruibo Biotechnology Ltd, Guangzhou, China) according to the protocol.

Clone formation experiments

Gastric cancer cell line overexpressing MACC1-AS1 after stable transfection at 1 × 10³The density per well was inoculated into 6-well plates for 2 days, and the low sugar stimulated group was replaced with the corresponding glucose medium for 2 weeks. Cells were washed 2 times with PBS, fixed with paraformaldehyde, and stained with 0.5% crystal violet solution. And taking a picture and recording after cleaning.

Data analysis

GraphPad Prism software was used for all data analyses. The T test and the one-way ANOVA test were used to evaluate whether there was a statistical difference between the data groups in the text. The Kaplan-Meier survival curve can vividly show the difference of survival time among different groups, and the statistical difference is calculated by Wilcoxon rank sum test. COX regression analysis is used to determine the prognostic independence factor for gastric cancer patients, events are defined as cancer-related death events. Spearman correlation analysis was used to calculate the correlation between clinical staging of gastric cancer patients and MACC1-AS1 staining scores. Pearson correlation analysis was used to calculate the coefficient of determination R for MACC1-AS1 and MACC1². A P value less than 0.05 is considered statistically different.

Reagent: 2-Deoxy-D-glucose (2-Deoxy-D-glucose, 2-DG), Cycloheximide (CHX), actinomycin D (dactinomycin D) was obtained from MedChem Express (Princeton, Mass., USA), MTT (3- (4, 5-dimethylthiazolo-2-yl) -2, 5-diphenyltetrazolium bromide, 3- (4, 5-dimethylthiazol-2) -2, 5-diphenyltetrazolium bromide) was obtained from Gekko Biotech Limited (Wuhan, China). 2-NBDG (2- [ N- (7-nitrobenzez-2-oxa-1, 3-diazol-4-yl) amino)]-2-deoxy-D-glucose, glucose analogues) and DAPI (4',6-diamidino-2-phenylindole, 4', 6-diamidino-2-phenylindole) were purchased from Invitrogen. H₂O₂NAC (N-acetyl-L-cysteine ) was purchased from Sigma-Aldrich, Inc. (USA); living body imaging fluorescein VivoGlo Luciferin was purchased from Promega corporation (Madison, Wis., USA). pGEM-T vector, T4DNA ligase, restriction enzyme SacII, SP6RNA Polymerase were also purchased from Promega; purchasing TIANGEN from plasmid extraction kit and DNA purification kit; a labeling kit for labeling cRNA probe with DIG is a product of Boehringer Mannheim. Other reagents are mentioned above.

The first embodiment is as follows: high expression of MACC1-AS1 was associated with poor prognosis in patients with gastric cancer.

In Situ Hybridization (ISH) was used to evaluate the expression level of MACC1-AS1 in paraffin tissue specimens from 124 patients with gastric cancer. The results show that MACC1-AS1 has significantly higher expression level in gastric cancer tissues than in paracarcinoma tissues (FIG. 1A). AS the clinical stage of the patient increased, MACC1-AS1 staining score also increased (fig. 1B).

All patients were divided into 3 groups, negative (0-2), weakly positive (3-7), and strongly positive (8-12) according to the staining depth of MACC1-AS 1. Of the 124 gastric cancer patients, there were 8 negative patients in total, 116 positive MACC1-AS1, 64 of which were weak positive and 52 of which were strong positive. The pathological diagnosis is taken AS a gold standard, and the sensitivity of the double digoxin labeled nucleic acid probe of MACC1-AS1 in diagnosing the stage of stomach cancer TNM is shown AS follows: 52.63%, specificity: 63.53 percent. (calculation formula: sensitivity: high-expression population/total population in IV phase × 100%; specificity: no-expression and low-expression population/total population in I-III phase × 100%)

All patients were grouped by T-stage, N-stage, M-stage, respectively, and expression of MACC1-AS1 was found to correlate with T-stage (P)<0.001), N stage (P)<0.001), M stages (P)<0.001) and TNM staging in positive correlation (fig. 1C). As can be seen by the MACC1 immunohistochemical staining of the serial sections, the co-localization expression phenomenon of MACC1-AS1 and MACC1 (FIG. 1D) and the positive correlation of the expression level of MACC1-AS1 and MACC1 (R is shown in the figure 1D)²＝0.413，p<0.001) (fig. 1E). Kaplan-Meier survival analysis shows that the high expression of MACC1-AS1 is shorter in disease-free survival and overall survival in the subgroup analysis of patients in clinical stages I-III (FIG. 1F-H) and IV (FIG. 1I-K), and the prognosis of patients co-expressing MACC1-AS1 and MACC1 is worse. Tables 1 to 1: correlation between expression of MACC1-AS1 and MACC1 and stage and prognosis of gastric cancer patientsLine (see FIG. 1L). Tables 1 to 2: clinical case data for TNM stages I-III and IV were correlated with expression of MACC1-AS1 (see FIG. 1M).

From the above clinical observations, it is believed that MACC1-AS1 is associated with a poor prognosis in patients with gastric cancer. Thus, it was demonstrated that clinical biopsy or surgical gastric cancer specimens, after in situ hybridization staining according to the standard procedures of in situ hybridization kits, were scored according to the MACC1-AS1 staining standard in materials and methods, with higher scores leading to poorer prognosis for the patients.

In combination with the results of the research on the sugar metabolism of MACC1 by MACC1-AS1 gene location and team, MACC1-AS1 was considered to influence the survival of gastric cancer cells probably through sugar metabolism, and then to be related to the prognosis of patients.

Example two: in vivo experiments prove that MACC1-AS1 obviously promotes lung metastasis of gastric cancer cells

Over-expressing MACC1-AS1 gastric cancer cell line MKN45 at 5 × 10⁵The number of the tumor cells is injected into 4-week-old nude mice through tail veins, the nude mice are killed by breaking the neck after 6 weeks of injection, the lungs are taken out for photographing (figure 2A), paraffin is embedded, HE staining and immunohistochemical staining are carried out, MACC1, Ki67 (proliferation index) and 8-OHdG (oxidative stress level index) are detected (figure 2B), and the result shows that the number and the volume of the lung metastasis foci of the MACC1-AS1 overexpression group are larger than those of the no-load control group, the MACC1 and Ki67 expression are higher, and the 8-OHdG expression is obviously reduced, which indicates that MACC1-AS1 promotes the lung metastasis of gastric cancer cells, promotes the proliferation of the gastric cancer cells and resists the oxidative reduction.

Example three: compared with normal gastric mucosal epithelial cells, MACC1-AS1 is significantly highly expressed in gastric cancer cells.

From the NCBI database, it was determined that MACC1-AS1 was located in the antisense strand of the MACC1 gene (FIG. 3A). By detecting the expression level of MACC1-AS1 in normal gastric mucosal cells and multiple gastric cancer cell lines, it can be found that MACC1-AS1 is highly expressed in gastric cancer cells (FIG. 3B). Two gastric cancer cell lines, BGC803 and MKN45, were selected for subsequent experiments.

Since the intracellular localization of lncRNA can help to determine the functional way, the distribution of MACC1-AS1 in gastric cancer cells was detected by Fluorescence In Situ Hybridization (FISH) and RNA extraction after nuclear and cytoplasmic separation, and MACC1-AS1 was mainly distributed in cytoplasm (FIG. 3C-D). Immunofluorescent staining also revealed that MACC1 co-localized with MACC1-AS1, co-localized to the cytoplasm (FIG. 3C).

The experimental results laterally reflect that MACC1-AS1 may participate in the post-transcriptional level regulation of MACC1 and influence the protective effect of MACC1 on cells under sugar-free stress.

Example four: increased expression of MACC1-AS in a sugar deprivation-induced ROS-generating environment.

Flow-through results demonstrated that ROS levels increased significantly at 0h, 6h, and 12h of sugar deprivation, and that ROS levels fell back at the corresponding time points after the addition of the antioxidant NAC the longer the time period was (fig. 4A-B).

The results of PCR measurements showed that the sugar-free medium (FIG. 4C), H was used₂O₂(ROS inducer, FIG. 4D), 2-DG (2-Deoxy-D-glucose, glycolysis inhibitor, FIG. 4E) gastric cancer cells were treated for 0, 8, 16, 24h respectively, and then the expression levels of MACC1-AS1 were measured to increase with time. Under the low sugar culture condition, the expression of MACC1-AS1 is also increased (FIG. 4G). To explore whether increased levels of MACC1-AS1 were promoted by ROS, PCR assays were performed after gastric cancer cells were treated with sugar-free challenge, NAC (antioxidant), and NAC was found to significantly reduce MACC1-AS1 expression under sugar-free challenge (FIG. 4F). Next, it was investigated whether MACC1-AS1, which was significantly increased in the absence of sugar or in the presence of low sugar, was involved in sugar metabolism, and thus Western blot was performed to examine the increase in the expression level of key enzymes HK2 and GLUT1 in glycolytic processes under low sugar stimulation (FIG. 4H).

Taken together, it was shown that MACC1-AS expression was increased in the context of sugar deprivation induced ROS production and affected glycolytic related enzyme expression.

Example five: MACC1-AS1 can help gastric cancer cells resist sugar deprivation induced apoptosis

To clarify the function of MACC1-AS1 in gastric cancer cells, MACC1-AS1 overexpression plasmid was constructed and BGC803 and MKN45 cells were transfected (FIG. 5A). The MTT experiment demonstrated that under sugar deprivation conditions, the over-expressing group died significantly less cells than the control group (FIG. 5B). As for the investigation of the effect of MACC1-AS1 on gastric cancer cell lines for a longer period of time, the cloning experiments were carried out, and it was also demonstrated that the over-expressed group formed more and larger cell masses under the low sugar culture conditions (FIG. 5C). Then, Western blot and flow cytometry were used to detect apoptosis and cell cycle change, and it was found that the overexpression of apoptosis-related proteins, cleared caspase-3 and Bax, was decreased (FIG. 5D), which means that MACC1-AS1 overexpression apoptosis was decreased. Flow cytometry also found that under sugar-deprivation conditions, the overexpression group had reduced S-phase arrest compared to the control group (FIGS. 5E-F), and decreased apoptosis (FIGS. 5I-J). Through EDU experiments, the MACC1-AS1 overexpression group was found to have better survival and proliferation under sugar deprivation than the control group (FIGS. 5G-H). The results of cell function experiments suggest that MACC1-AS1 can maintain the survival of the cells and reduce apoptosis when the gastric cancer cells are subjected to sugar-free stress.

Example six: MACC1-AS1 promotes cell survival through the glycolytic pathway.

PCR experiments show that the expression levels of glycolysis related genes GLUT1, HK2, G6PD and MCT1 in gastric cancer cells over-expressing MACC1-AS1 are all increased (FIG. 6A). Western blot (FIG. 6B) and immunofluorescence staining (FIG. 6C) showed that MKN45 and BGC803 cells overexpressing MACC1-AS1 all showed elevated expression levels of HK2, GLUT1 and LDHA. The 2-NBDG (2- [ N- (7-nitrobenzez-2-oxa-1, 3-diazol-4-yl) amino ] -2-deoxy-D-glucose, glucose analogue) uptake of MACC1-AS1 gastric cancer cell strain is obviously increased under the condition of no sugar stimulation, and MACC1-AS1 is suggested to increase the glucose uptake capacity of cells (figure 6D-E).

To further confirm that MACC1-AS1 is involved in the glycolysis process. After sugar-free or low-sugar treatment, the ATP (FIG. 6F) and lactic acid (FIG. 6G) contents of the gastric cancer cell line over-expressing MACC1-AS1 were measured, and it was found that the ATP content was increased and the lactic acid level was decreased AS the glucose concentration was decreased, and the over-expressing MACC1-AS1 group was higher than the control group. At the same time, the hexokinase activity (FIG. 6H) and the lactate dehydrogenase activity (FIG. 6I) in gastric cancer cells over-expressing MACC1-AS1 were also increased.

In conclusion, it can be considered that MACC1-AS1 promotes cell survival through the glycolytic pathway.

Example seven: MACC1-AS1 flow cytometry detection after sugar deprivation treatment to maintain intracellular redox balance by promoting glycolysis and producing NADPHIntracellular ROS production was significantly increased, but the increase in overexpressed ROS was less (fig. 7B). When administered with sugar-free stimulation (FIG. 7C), H₂O₂Increased inhibition of cell growth was seen in both (FIG. 7D) and glycolytic inhibitor 2-DG (FIG. 7E) treated gastric cancer cells, whereas overexpression of MACC1-AS1 may control the increased inhibition in part like NAC.

One of the ways to remediate growth inhibition by scavenging ROS inside the cell is to increase the levels of antioxidant substances such as NADPH and GSH. After the sugar-free stimulation, the NADPH and the GSH of an overexpression group and a control group are detected to find that: NADPH decreased significantly after no sugar stimulation (FIG. 7F) and NADP +/NADPH increased significantly (FIG. 7G), but the overexpression group increased intracellular NADPH significantly, balancing the NADP +/NADPH ratio. Similarly, MACC1-AS1 overexpression panel also increased intracellular GSH levels following sugarless stimulation (FIG. 7H), and decreased GSSG/GSH (FIG. 7I), to combat the cytotoxicity of sugarless ROS accumulated in cells.

The results suggest that MACC1-AS1 can reduce the toxicity of ROS to cells by generating antioxidant substances when gastric cancer cells are subjected to sugar-free stress, and probably one of the pathways of MACC1-AS1 for promoting gastric cancer cells to generate glycolysis. Taken together with examples five to seven, MACC1-AS1 was demonstrated to be an important molecule that helps gastric cancer cells respond to sugarless stress, the main pathway being the maintenance of redox balance by the production of antioxidants and the promotion of glycolytic processes. Therefore, the theoretical basis and mechanism of the MACC1-AS1 probe AS a gastric cancer prognosis detection method are proved.

In conclusion, the invention firstly defines the important significance of MACC1-AS1 AS the clinical prognosis index of the gastric cancer patient, the high expression of MACC1-AS1 indicates the poorer prognosis of the gastric cancer patient, and the higher the score is, the worse the prognosis of the patient is by in situ hybridization staining and calculating the staining score of MACC1-AS 1. In vivo experiments prove that MACC1-AS1 has the promotion effect on lung metastasis of gastric cancer cells. In the following cytofunctional experiments and molecular mechanism experiments, it is proved that under the condition of sugar-free or low-sugar stress, MACC1-AS1 can resist the cytotoxicity of ROS by increasing reducing substances such AS NADPH and GSH in gastric cancer cells, and further play a role in promoting glycolytic metabolism of cells to maintain energy supply, so that the survival and proliferation of gastric cancer cells are maintained, and the apoptosis is reduced. The mechanism of MACC1-AS1 related to gastric cancer prognosis is demonstrated in conclusion.

The invention firstly proves the positive correlation between MACC1-AS1 and the clinical prognosis and clinical stage of a gastric cancer patient and the prediction significance of the positive correlation to the poor prognosis of the gastric cancer patient, so that the dual-digoxin labeled nucleic acid probe of MACC1-AS1 is used for the first time to carry out in-situ hybridization and staining on the gastric cancer tissue and the tissue beside the cancer. The MACC1-AS1 staining score was calculated according to the criteria in the materials and methods, and it was found that the sensitivity for diagnosing the staging of gastric cancer TNM was 52.63%, the specificity was 63.53%, and the higher the score, the worse the prognosis of the patients. Secondly, the expression of MACC1-AS1 is increased when gastric cancer cells are subjected to sugar-free stress, and then the expression of MACC1-AS1 is found to resist oxidative stress by increasing the content of NADPH and GSH in the cells, promote the energy supply of glycolysis pathways and reduce the apoptosis of the gastric cancer cells. It can therefore be concluded that MACC1-AS1 is an important molecule for maintaining normal carbohydrate metabolism in gastric cancer cells and demonstrates its cause AS a prognostic marker for gastric cancer.

Sequence listing

<110> southern hospital of southern medical university

Application of <120> MACC1-AS1 probe in preparation of diagnostic reagent for predicting clinical prognosis of gastric cancer

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial sequence ()

<400> 1

tcaatgcaga tctaatactc ct 22

Claims

1. Application of FISH probe for detecting expression level of IncRNA MACC1-AS1 in preparation of diagnostic reagent for predicting clinical prognosis of gastric cancer.

2. Use according to claim 1, characterized in that: the FISH probe for detecting the expression level of IncRNA MACC1-AS1 comprises a nucleotide sequence shown AS SEQ ID NO. 1.

3. Use according to claim 1, characterized in that: the FISH probe for detecting the expression level of the lncRNA MACC1-AS1 is a digoxin labeled nucleic acid probe.

4. Use according to claim 1, characterized in that: the application comprises detecting MACC1-AS1 staining scores from test samples through in situ hybridization, wherein the MACC1-AS1 staining scores are positively correlated with the clinical prognosis and the clinical stage of gastric cancer patients.