CN107641625A - A kind of targeted inhibition agent of MTF1 genes and application thereof - Google Patents
A kind of targeted inhibition agent of MTF1 genes and application thereof Download PDFInfo
- Publication number
- CN107641625A CN107641625A CN201710994178.6A CN201710994178A CN107641625A CN 107641625 A CN107641625 A CN 107641625A CN 201710994178 A CN201710994178 A CN 201710994178A CN 107641625 A CN107641625 A CN 107641625A
- Authority
- CN
- China
- Prior art keywords
- mtf1
- inhibition agent
- targeted inhibition
- cell
- genes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention belongs to pharmaceutical technology field, and in particular to a kind of inhibitor of MTF1 genes and application thereof.A kind of targeted inhibition agent of MTF1 genes, it is characterised in that the gene order of the targeted inhibition agent is：5’‑GGATACAAATCACTCACTTTG‑3’（SEQ ID No.1）.The inhibitor can suppress expression of the MTF1 genes in Glial cells, so as to play a part for the treatment of glioma, be with a wide range of applications.
Description
Technical field
The invention belongs to pharmaceutical technology field, and in particular to a kind of targeted inhibition agent of MTF1 genes and application thereof.
Background technology
Malignant glioma is the most common malignant tumour of cental system, accounts for the 50%-60% of primary brain tumors.Control at present
For treatment means mainly based on operation, chemicotherapy is auxiliary treatment.But because glioma has the biological characteristics of invasive growth
Sign, and glioma rank is higher, and invasion is stronger, is cut entirely under iconography and microscope even if operation reaches, and recurrence still exists
Institute is unavoidable.Statistics shows that its median survival interval is only 12 months after the operation of main flow at present adds postoperative Concurrent radiotherapy, 5 years survival rates
Less than 13%.High-level glioma prognosis is worse, such as glioblastoma multiforme（Glioblastoma
multiforme, GBMs）The effect of it is still very poor, existence median still be no more than 15 months.In order to improve the effective for the treatment of
Property, solve the problems, such as its recurrence and treatment resistance, the pathogenesis of glioma is studied from gene and molecular level, seek
Look for new biological marker and therapy target seems particularly important.
MTF1 (metal regulatory transcription factor 1), is a kind of unique Cys2His2 zinc
Finger protein, from drosophila to human evolution on it is more conservative.Research shows that MTF1 is in lung cancer, cervical carcinoma, breast cancer[And Colon and rectum
High expression, plays the effect of promotion sensitivity gene in cancer.The current expression for not yet finding MTF1 in malignant glioma simultaneously participates in glue
The regulation and control of matter oncocyte biological behaviour.Early stage, we have detected MTF1 expression using real-time PCR methods.Knot
Fruit shows that MTF1 expression is significantly higher than normal star spongiocyte group, the prompting of this result in Glial cells
MTF1 may participate in the function controlling of the generation and development to glioma.
The principle of RNA perturbation techniques is to utilize Dicer cleavage RNA molecules, forms RNA silencing complexes, and targeting combines
The process of target RNA molecule and then degradation of rna molecule.The present invention is desirable with the suppression that RNA perturbation techniques develop MTF1 genes
Agent, played a role in glioma field of gene.
At present, effect and related mechanism of the MTF1 genes in glioma occurrence and development has not been reported, on MTF1
Blank out is gone back in application in terms of glioma gene therapy at present.Therefore, developing a kind of related medicines of MTF1 turns into current
Urgent problem to be solved.
The content of the invention
It is an object of the invention to provide a kind of inhibitor of MTF1 genes, the inhibitor can suppress MTF1 genes in brain
Expression in glioma cell, so as to play a part for the treatment of glioma, it is with a wide range of applications.
To achieve these goals, the present invention uses following technical scheme：The invention provides a kind of target of MTF1 genes
To inhibitor, the gene order of the targeted inhibition agent is：
5’-GGATACAAATCACTCACTTTG-3’（SEQ ID No.1）.
Invention further provides the shRNA sequences that the targeted inhibition agent can suppress MTF1 gene expressions, the shRNA moulds
Plate sequence includes positive-sense strand and antisense strand, and the positive-sense strand and antisense strand are respectively：
Positive-sense strand：
5’-
CACCGGATACAAATCACTCACTTTGTTCAAGAGACAAAGTGAGTGATTTGTATCCTTTTTTG-3’（SEQ ID
No.2）.
Antisense strand：
5’-
GATCCAAAAAAGGATACAAATCACTCACTTTGTCTCTTGAACAAAGTGAGTGATTTGTATCC-3’（SEQ ID
No.3）.
Further, the invention provides a kind of transcription product for transcribing above-mentioned shRNA, sequence to be：
5’-GGATACAAATCACTCACTTTGTTCAAGAGACAAAGTGAGTGATTTGTATCC-3’ （SEQ ID No.4）.
Preferably, the inhibitor is formulation acceptable in any pharmacotherapeutics.
Preferably, the formulation of the inhibitor is ejection preparation.
Preferably, the inhibitor is dosage acceptable in any pharmacotherapeutics.
A kind of MTF1 gene inhibitors are used to treat the application in human glioma medicine as preparation.
Compared with prior art, the present invention has the following technical effect that.
1st, targeted inhibition agent high specificity of the present invention, specificity suppress the expression of MTF1 genes.
2nd, MTF1 gene inhibitors targeted therapy, the resistance problems of traditional treatment medicine can be significantly reduced, are controlled for glioma
Treat and novel targets are provided.
3rd, experiment is proved to apply in cytology level in vitro, and therapeutic effect is definite, has no adverse reaction.
Brief description of the drawings
Fig. 1 is that Real-time PCR methods detect MTF1 in normal spongiocyte（HA）, glioma cell (U251, U87)
In expression block diagram.
Fig. 2 is that Western blot detect MTF1 in normal spongiocyte（HA）, in glioma cell (U251, U87)
Protein expression level electrophoresis and block diagram.
Fig. 3 is after MTF1 gene inhibitors are applied in the detection of CCK-8 cell viabilities method, to suppress U87, U251 glioma cell and increase
The block diagram grown.
After Fig. 4 applies MTF1 gene inhibitors for Transwell detections, suppression glioma cell U87, U251 migration,
The photo and block diagram of invasive ability.
Fig. 5 is promotion glioma cell U87, U251 apoptosis after flow cytomery application MTF1 gene inhibitors
Photo and block diagram.
Embodiment
The main technical scheme is that.
1. shRNA design and the preparation of interference carrier.
2. Western blot
3. the checking of jamming effectiveness.
4. cell proliferation experiment.
5. cell migration, Matrigel.
6. flow cytomery cell apoptosis assay.
Embodiment 1
First, the culture of U87, U251 glioma cell.
(1) U87, U251 cell are with the DMEM high glucose medium cultures containing 10% hyclone.Observed under inverted microscope
Cell, pass on during cell confluency degree 80%-90%；
(2) nutrient solution in former bottle is discarded, is washed 2 times with the PBS of room temperature pre-temperature, PBS is abandoned in suction；
(3) the 0.25% tryptic digestive juice about 1ml of pre-temperature is added, is placed in micro- Microscopic observation.When cell process disappear, carefully
Born of the same parents' shape becomes bowlder, abandons digestive juice immediately, and digestion is terminated with the DMEM high glucose mediums containing 10% hyclone；
(4) cell is blown and beaten into single cell suspension with pipettor, by 1：3 ratios pass on, and are placed in 37 DEG C, 5%CO2It is incubated
Cultivated in case；
(5) cell of recovery can be to carry out subsequent experimental after 3 passages.
2nd, real-time quantitative PCR detection MTF1 expression.
（1）Trizol methods extract normal spongiocyte respectively（HA）, it is total in glioma cell (U251, U87) cell
RNA。
The cell collected is washed with cold PBS, adds the piping and druming of 1 ml Trizol reagents for several times, Microscopic observation cell is into oil
Drop-wise（Fully cracking）, it is rear to move into 1.5 ml EP pipes, 5 minutes are stood, it is fully cracked；0.2 is added into sample
Ml chloroforms, acutely concussion stands 3 minutes at room temperature manually；Centrifuged 15 minutes in 4 DEG C of 12000g, take upper strata aqueous phase to newly
In EP pipes, 0.5 ml isopropanols are added, mixing of turning upside down, stand 10 minutes at room temperature；4 DEG C of 12000g centrifuge 15 points
Supernatant is abandoned after clock, adds the ethanol of 1 ml 75%；4 DEG C of 7500g are centrifuged 5 minutes, and 40 μ l DEPC are added after drying 15 minutes
Water, sample can be frozen in -80 DEG C of refrigerators.
（2）One step dye method qRT-PCR detects MTF1 expression：
CT values are determined, using GAPDH as internal reference, with 2-△△CtMTF1 relative expression quantity is represented, as a result as shown in Figure 1, it was demonstrated that
Expression of the MTF1 in glioma cell is significantly raised.
3rd, Western blot detect MTF1 in normal spongiocyte（HA）, table in glioma cell (U251, U87)
Reach.
(1) cell is collected, adds RIPA protein lysates, concussion shakes up, and stands 30min on ice, under the conditions of 4 DEG C
12000g centrifuges 30min；
(2) obtain and collect supernatant and use the protein concentration of BCA method determination samples；
(3) 40mg albumen is taken to mix (1 with 5x sample-loading buffers:4) 5min denaturation, is boiled；
(4) the albuminate addition 8-10% SDS denaturing polyacrylamide gel electrophoresis not waited is separated；
(5) transferring film：Voltage 100V, electric current 120mA, 90min-200min；
(6) 5% skim milks close 2h；
(7) primary antibody dilution dilutes associated antibodies sealer with certain proportion, and 4 °C overnight；
(8) TTBS washes 5min, 3 times, adds corresponding secondary antibody, 2h is incubated on room temperature shaker；
(9) ECL lights, photograph, quantity one software quantitative analyses.
MTF1 genes are detected in normal astroglia（HA）, glioma cell (U251, U87) protein expression water
It is flat, it was demonstrated that expression of the MTF1 in glioma cell is significantly raised（As shown in Figure 2）.
4th, the preparation and application of MTF1 gene inhibitors.
The interference sequence of MTF1 genes is designed, targeting people MTF1 genes is selected and specificity suppresses the target of MTF1 gene expressions
Gene order is as follows：
5’-GGATACAAATCACTCACTTTG-3’（SEQ ID No.1）
Inputted in NCBI same former sequence alignment analysis nucleotide blast
GGATACAAATCACTCACTTTG sequences are compared, the results showed that other mRNA genes of the sequence and people do not have
There is high homology, the specific sequence of specificity interference MTF1 genes can be made.
It is as follows to suppress the shRNA sequences of MTF1 gene expressions for above target sequence design targeting people MTF1 genes, bag
Positive-sense strand and antisense strand are included, this shRNA sequence is：
Positive-sense strand：
5’-
CACCGGATACAAATCACTCACTTTGTTCAAGAGACAAAGTGAGTGATTTGTATCCTTTTTTG-3’（SEQ ID
No.2）.
Antisense strand：
5’-
GATCCAAAAAAGGATACAAATCACTCACTTTGTCTCTTGAACAAAGTGAGTGATTTGTATCC-3’（SEQ ID
No.3）.
Above-mentioned shRNA transcription product is transcribed, sequence is：
5’-GGATACAAATCACTCACTTTGTTCAAGAGACAAAGTGAGTGATTTGTATCC-3’ （SEQ ID No.4）.
Above sequence information is designed and synthesized into corresponding plasmid, as MTF1 gene inhibitors.MTF1 gene inhibitors turn
Dye：Sh-NC, sh-MTF1 plasmid U6/GFP/Neo, make MTF1 expression silencings, do not contain MTF1 sequences or shRNA empty plasmid
To test negative control；Using 24 well culture plate culture glioma cells, transfected when cell growth reaches 80% or so；
Plasmid, the Opti-MEM that configuration transfection needs®I and LTX and Plus reagent (Life Technologies) transfection examinations
Agent.A is managed：One hole is dissolved in the μ l p3000 of 50 μ l Opti-MEM I+1 according to 1 μ g DNAs, places 5 min, B pipes：Hole
50 μ l Opti-MEM are dissolved according to 1 μ l LTX and Plus®In I；5 min are stood after the pipe of A, B two is mixed；Suction out training
Nutrient solution, the μ L of transfection cocktail 100 are added per hole, add the μ L of EBM-2 nutrient solutions 400；It is 0.4 to be used after 48 h containing concentration
Mg/mL antibiotic G418 culture medium is screened, and is continuously increased G418 concentration, obtains that silence can be stablized after about 4 weeks
MTF1 cell line.It is divided into 3 groups in subsequent experimental, is respectively：Normal group;Transfect the blank control of MTF1 silence empty plasmids
Group；Transfect the inhibitor group of MTF1 silence plasmids.
5th, the CCK-8 detection cell viabilities of normal group, blank control group and inhibitor group are detected respectively.
（1）Method for cell count is same as above.U87 and U251 is laid in 96 well culture plates respectively, per about 2000, hole cell,
Every group of cell spreads five secondary orifices.
（2）Cultivated respectively in 37 DEG C of cell incubators 48 hours, take out culture plate at different time points respectively and add per hole
It is put into after entering the μ l of Cell Counting Kit-8 10 in 37 DEG C of constant incubators 1 hour.
（3）Using ELIASA, wavelength 450nm is chosen, determines the OD values per hole.
Experimental result is as shown in Figure 3：Relative to normal group and blank control group, after MTF1 gene inhibitors, colloid
Tumor cell proliferation is suppressed significantly.
6th, cell Transwell migrations and Matrigel.
1. normal group is detected respectively, blank control group and inhibitor group cell migration ability.
（1）The high sugar cultures of DMEM that 500 μ l contain 10% serum are added per hole in 24 porocyte culture plates
Liquid, the transwell cells that aperture is 8 μm are placed in hole.
（2）After cell count, different groups of cells are blown out into cell with the high sugared nutrient solutions of the DMEM for not containing serum and hanged
Liquid, equably it is layered on respectively inside upper chamber, 100 μ l cell suspensions containing about 10000 cells greatly is added in every hole cell.It is put into 37
Cultivated 24 hours in DEG C constant incubator.
（3）Cell is taken out after 24 hours, upper indoor surface is not migrated into past cell with swab stick cleans, according to methanol:
Glacial acetic acid=3: 1 proportional arrangement fixer.
（4）Cell is put into fixer, the cell of cell bottom surface is fixed 30 minutes.
（5）With being dried behind PBS cell.Prepare Giemsa stain, dye liquor：Working solution 1:9.By Giemsa stain drop with
Cell bottom surface, dye 1 hour.
（6）With PBS twice, in the migration situation of inversion 400 × micro- Microscopic observation cell, every group of cell is taken at random
5 visuals field carry out the statistics of number of cells, the transfer ability of cell is represented with this.
Experimental result is as shown in Figure 4：Relative to normal group and blank control group, detect after applying MTF1 gene inhibitors,
Glioma cell migration is suppressed significantly.
2. normal group is detected respectively, blank control group and inhibitor group cell invasion ability.
（1）The matrigel Matrigel that 50 μ l concentration are 500ng/ μ l is uniformly spread in small indoor surface, is put into 37 DEG C
Make its solidification within 4 hours in insulating box.
（2）Then cell suspension is then covered with, method is same to migrate experiment.
Experimental result is as shown in Figure 4：Relative to normal group and blank control group, detect after applying MTF1 gene inhibitors,
Invasion of glioma cells ability is suppressed significantly.
7th, cell apoptosis assay
（1）With the PBS cell of precooling twice.Digested with the pancreatin without EDTA, cell is gently blown and beaten into cell suspension
After be transferred in 1.5ml centrifuge tubes, 1000rpm centrifuge 3 minutes collect cell.
（2）Continue to clean with PBS, 1000rpm is centrifuged 3 minutes, and supernatant is outwelled after centrifugation.It is repeated twice.
（3）10 × binding of working solution buffer are diluted ten times.Often pipe adds 100 μ l Binding Buffer, hangs
Floating cell.
（4）Often pipe is sequentially added 5 μ l Annexin V-PI and 5 μ l FITC and mixed, room temperature lucifuge 15 minutes.
（5）400 μ l1 × binding buffer are added to every pipe before upper machine, after piping and druming uniformly, flow cytometer detection
The change of Apoptosis.
Experimental result is as shown in Figure 5：Relative to normal group and blank control group, detect after applying MTF1 gene inhibitors,
Glioma cell apoptosis dramatically increases, it was confirmed that MTF1 gene inhibitor induction gum apoptosis of tumor.
SEQUENCE LISTING
<110>Attached Shengjing city hospital of Chinese Medical Sciences University
<120>A kind of targeted inhibition agent of MTF1 genes and application thereof
<130> 4
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213>Artificial sequence
<400> 1
ggatacaaat cactcacttt g 21
<210> 2
<211> 62
<212> DNA
<213>Artificial sequence
<400> 2
caccggatac aaatcactca ctttgttcaa gagacaaagt gagtgatttg tatccttttt 60
tg 62
<210> 3
<211> 62
<212> DNA
<213>Artificial sequence
<400> 3
gatccaaaaa aggatacaaa tcactcactt tgtctcttga acaaagtgag tgatttgtat 60
cc 62
<210> 4
<211> 51
<212> DNA
<213>Artificial sequence
<400> 4
ggatacaaat cactcacttt gttcaagaga caaagtgagt gatttgtatc c 51
Claims (7)
1. a kind of targeted inhibition agent of MTF1 genes, it is characterised in that the gene order of the targeted inhibition agent is：
5’-GGATACAAATCACTCACTTTG-3’（SEQ ID No.1）.
2. the targeted inhibition agent of a kind of MTF1 genes according to claim 1, it is characterised in that the targeted inhibition agent can
Suppress the shRNA sequences of MTF1 gene expressions, the shRNA template sequences include positive-sense strand and antisense strand, the positive-sense strand with
Antisense strand is respectively：
Positive-sense strand：
5’-
CACCGGATACAAATCACTCACTTTGTTCAAGAGACAAAGTGAGTGATTTGTATCCTTTTTTG-3’（SEQ ID
No.2）；
Antisense strand：
5’-
GATCCAAAAAAGGATACAAATCACTCACTTTGTCTCTTGAACAAAGTGAGTGATTTGTATCC-3’（SEQ ID
No.3）.
3. the targeted inhibition agent of a kind of MTF1 genes according to claim 2, it is characterised in that transcribe the shRNA sequences
The transcription product of row, sequence are：
5’-GGATACAAATCACTCACTTTGTTCAAGAGACAAAGTGAGTGATTTGTATCC-3’ （SEQ ID No.4）.
4. the targeted inhibition agent of a kind of MTF1 genes according to claim 1, it is characterised in that the targeted inhibition agent is to appoint
Acceptable formulation in what pharmacotherapeutics.
A kind of 5. targeted inhibition agent of MTF1 genes according to claim 1, it is characterised in that the agent of the targeted inhibition agent
Type is ejection preparation.
6. the targeted inhibition agent of a kind of MTF1 genes according to claim 1, it is characterised in that the targeted inhibition agent is to appoint
Acceptable dosage in what pharmacotherapeutics.
7. a kind of targeted inhibition agent of MTF1 genes as claimed in claim 1 is used to treat human glioma medicine as preparation
In application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710994178.6A CN107641625B (en) | 2017-10-23 | 2017-10-23 | MTF1 gene targeted inhibitor and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710994178.6A CN107641625B (en) | 2017-10-23 | 2017-10-23 | MTF1 gene targeted inhibitor and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107641625A true CN107641625A (en) | 2018-01-30 |
| CN107641625B CN107641625B (en) | 2020-01-21 |
Family
ID=61124283
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710994178.6A Expired - Fee Related CN107641625B (en) | 2017-10-23 | 2017-10-23 | MTF1 gene targeted inhibitor and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107641625B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6232078B1 (en) * | 1997-02-21 | 2001-05-15 | Hong-Kyu Lee | Method for diagnosing preclinical diabetes by quantification of mitochondrial DNA in peripheral blood |
| US20100273865A1 (en) * | 2007-11-02 | 2010-10-28 | Vereniging Voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek En Patientenzorg | Polypeptides involved in neuronal regeneration-associated gene expression |
-
2017
- 2017-10-23 CN CN201710994178.6A patent/CN107641625B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6232078B1 (en) * | 1997-02-21 | 2001-05-15 | Hong-Kyu Lee | Method for diagnosing preclinical diabetes by quantification of mitochondrial DNA in peripheral blood |
| US20100273865A1 (en) * | 2007-11-02 | 2010-10-28 | Vereniging Voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek En Patientenzorg | Polypeptides involved in neuronal regeneration-associated gene expression |
Non-Patent Citations (1)
| Title |
|---|
| HARDYMAN等: "Zinc sensing by metal-responsive transcription factor 1 (MTF1) controls metallothionein and ZnT1 expression to buffer the sensitivity of the transcriptome response to zinc", 《THE ROYAL SOCIETY OF CHEMISTRY》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107641625B (en) | 2020-01-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhu et al. | Suppression of cellular apoptosis susceptibility (CSE1L) inhibits proliferation and induces apoptosis in colorectal cancer cells | |
| Lee et al. | N-myc downstream-regulated gene 1 downregulates cell proliferation, invasiveness, and tumorigenesis in human oral squamous cell carcinoma | |
| Zhou et al. | MicroRNA-134 inhibits tumor stem cell migration and invasion in oral squamous cell carcinomas via downregulation of PI3K-Akt signaling pathway by inhibiting LAMC2 expression | |
| Song et al. | Overexpression of lncRNA PIK3CD-AS1 promotes expression of LATS1 by competitive binding with microRNA-566 to inhibit the growth, invasion and metastasis of hepatocellular carcinoma cells | |
| Zhu et al. | Dual role of twist1 in cancer-associated fibroblasts and tumor cells promoted epithelial-mesenchymal transition of esophageal cancer | |
| CN107362365A (en) | Application of the GPR31 inhibitor in pharmacy | |
| CN107661509B (en) | Linc00673 gene targeted inhibitor and application thereof | |
| Zhu et al. | Transcriptional repression of p53 by PAX3 contributes to gliomagenesis and differentiation of glioma stem cells | |
| CN107142310A (en) | Specific shRNA screenings and its targeting Ang 2 genes suppress the verification method of lung carcinoma cell | |
| Zhang et al. | Tumor-derived exosomal lincRNA ROR promotes angiogenesis in nasopharyngeal carcinoma | |
| CN107828872A (en) | The detection reagent of Pygo2 gene expressions in Wnt signal paths based on peptide nucleic acid probe | |
| WO2020113877A1 (en) | Function and use of e2f6 inhibitor | |
| CN107753956A (en) | A kind of targeted inhibition agent of RAX2 genes and application thereof | |
| CN107523566A (en) | A kind of targeted inhibition agent of MCM3AP AS1 genes and application thereof | |
| Yuan et al. | Dual VEGF/PDGF knockdown suppresses vasculogenic mimicry formation in choroidal melanoma cells via the Wnt5a/β-catenin/AKT signaling pathway | |
| CN107641625A (en) | A kind of targeted inhibition agent of MTF1 genes and application thereof | |
| CN109988765A (en) | A kind of targeted inhibition agent of FENDRR gene and application thereof | |
| CN114032236A (en) | shRNA of TMEM2 and application thereof | |
| CN114231529A (en) | Human PKMYT1AR gene and application thereof | |
| CN113652429A (en) | shRNA for targeted knockdown of long-chain non-coding RNAMIR205HG and application thereof | |
| CN103031334A (en) | Dual-target siRNA eukaryotic expression plasmid capable of inhibiting STAT3 and AFP gene expression, and application of expression plasmid | |
| CN109402253B (en) | Use of ALDH18A1 in the treatment and diagnosis of colorectal cancer | |
| CN113908283A (en) | PRMT5 inhibitor and application thereof in combination with PD-L1 antibody blocking agent in treatment of lung cancer | |
| CN109554364B (en) | TSNAX gene inhibitor and application thereof in tumors | |
| CN109536498B (en) | PABPC5 gene inhibitor and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200121 Termination date: 20211023 |