CN107362365A - Application of the GPR31 inhibitor in pharmacy - Google Patents

Application of the GPR31 inhibitor in pharmacy Download PDF

Info

Publication number
CN107362365A
CN107362365A CN201710719318.9A CN201710719318A CN107362365A CN 107362365 A CN107362365 A CN 107362365A CN 201710719318 A CN201710719318 A CN 201710719318A CN 107362365 A CN107362365 A CN 107362365A
Authority
CN
China
Prior art keywords
gpr31
preferred
relevant disease
heart
disease
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710719318.9A
Other languages
Chinese (zh)
Other versions
CN107362365B (en
Inventor
李红良
张晓晶
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wuhan huikangda Technology Co.,Ltd.
Original Assignee
Wuhan University WHU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to CN201911134026.4A priority Critical patent/CN110772636B/en
Priority to CN201911134452.8A priority patent/CN110947003B/en
Priority to CN201710719318.9A priority patent/CN107362365B/en
Priority to CN201911135432.2A priority patent/CN110935022A/en
Priority to CN201910864807.2A priority patent/CN110694071B/en
Application filed by Wuhan University WHU filed Critical Wuhan University WHU
Priority to CN201910865919.XA priority patent/CN110538327B/en
Priority to PCT/CN2017/106949 priority patent/WO2019037222A1/en
Publication of CN107362365A publication Critical patent/CN107362365A/en
Application granted granted Critical
Publication of CN107362365B publication Critical patent/CN107362365B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
    • C12N2740/15041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Virology (AREA)
  • Urology & Nephrology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Vascular Medicine (AREA)
  • Cardiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention experimental studies have found that, with the extension of tissue ischemia time, the expression quantity of GPR31 albumen gradually increases, and there is positively related relation between the tissue ischemia reperfusion injury order of severity.GPR31, which is overexpressed, can aggravate liver cell, cardiac muscle cell, the activity of kidney cell caused by H/R processing.In addition, cytolipin caused by the reduction that GPR31 is expressed in liver cell can suppress palmitate and oleic acid stimulation deposits.GPR31 is overexpressed in cardiac muscle cell, can aggravate myocardial hypertrophy caused by angiotensinⅡ.Therefore, GPR31 inhibitor can be used for preparing medicine, and the medicine is used to treat ischemical reperfusion injury relevant disease；Myocardial hypertrophy and relevant disease；Liver metabolism disease.

Description

Application of the GPR31 inhibitor in pharmacy
Technical field
The invention belongs to biomedicine technical field, and in particular to purposes of the GPR31 inhibitor in medicine is prepared, it is described Medicine is used to treat ischemical reperfusion injury and its relevant disease, myocardial hypertrophy and its relevant disease, the diseases associated with inflammation of heart, Fat metabolism exception and relevant disease etc..
Background technology
G protein coupled receptor (G protein-coupled receptor, GPCR) is that one kind has 7 transmembrane structures Memebrane protein, 800 family members are had more than, be a kind of memebrane protein maximum in mammalian genome.In human body, GPCR is wide General expression participates in growing and a variety of pathologic, physiologics in the histoorgans such as cardiovascular system, immune system, nervous system Process.Because its is widely distributed, vdiverse in function, GPCR family molecules are considered as current most potential drug development target spot, About 20-30% is using GPCR as action target in the marketed drug of FDA approvals.
Orphan receptor GPR31 is GPCR family molecules, is found most earlier than 1997 by Alessandra Zingoni et al. (Zingoni,A.et al.Isolation and chromosomal localization of GPR31,a human gene encoding a putative G protein-coupled receptor.Genomics 42,519-523,doi: 10.1006/geno.1997.4754(1997)).At present, the research to GPR31 is concentrated mainly on cancer field, and to it at it He is still not clear the function of pathologic process.GPR31 albumen includes 319 amino acid, molecular weight 35KDa, in blood platelet, is immunized carefully High expression in born of the same parents and kinds cancer cell, including transitional cell bladder carcinoma cell line, breast cancer cell, chronic lymphoblastic leukaemia are thin (Feinmark, S.J.et al.The Orphan Receptor GPR31Is the Platelet the and HUVEC such as born of the same parents Receptor for 12(S)-HETE.Blood 114(2008).).Research shows that GPR31 is in clinical patient colon cancer tissue Middle expression is proportionate apparently higher than Carcinoma side normal tissue, and with cancer metastasis rate, with 5 annual survival rates it is negatively correlated (Zou, Y.et al.[Expression and clinical significance of G protein-coupled receptor 31in colorectal cancer tissue].Zhonghua Wei Chang Wai Ke Za Zhi 18,935-940 (2015).).GPR31 can combine with RAS family molecules such as KRAS, HRAS, NRAS etc., and regulate and control KRAS cell membrane localization, from And participate in occurrence and development (Fehrenbacher N, et al.The G protein-the coupled receptor of cancer GPR31promotes membrane association of KRAS[J].J Cell Biol,2017: jcb.201609096.)。
Ischemical reperfusion injury (Ischemia-Reperfusion Injury, IRI) is that nineteen sixty Jennings is carried first The concept gone out, refer to blood reperfusion after histoorgan ischemic, can not only recover tissue organ function, aggravate tissue on the contrary The dysfunction and structural damage of organ.Ischemical reperfusion injury includes the heart, liver, lung, kidney, intestines and stomach etc. in many vitals It can occur.
Hepatic ischemia-reperfusion injury (Hepatic Ischemia Reperfusion Injury, HIRI) is outside liver Common pathologic process in section's operation, it is more common in shock, needs to block liver surgery and transplantation of liver of liver blood flow etc. In pathophysiological process.In recent years, with the development of clinic application, liver transfer operation, thromboembolism treatment and hepatic portal occlusion art etc. The development of operation is more and more, although liver protecting, Surgical technique and intrtqoperative care are updated, liver caused by ischemia-reperfusion Damage is still and causes postoperative internal organs nonfunctional, graft failure even death the main reason for.Liver undergoes Ischemia Reperfusion After note, a series of metabolism, the damage of 26S Proteasome Structure and Function occur for liver organization cell, easily induce liver failure, are to influence disease One of the main reason for prognosis, success rate of operation and patient's survival rate.
Acute coronary obstructive disease is one of main cause of death of current cardiovascular and cerebrovascular disease.Although heart is taken The treatments such as bridge art, intervention and thrombolysis make great progress, but the death rate of acute myocardial infarction patient is still higher, and one of them is very The reason for important is exactly that there is no effective way to suppress the ischemical reperfusion injury that ischemic myocardium recovers caused during blood flow.It is coronal dynamic Arteries and veins thrombolysis art, percutaneous transluminal coronary angioplasty, coronary artery intramedullary expansion art, coronary artery bypass surgery, cardiac muscle can all occur and fill again Note damage.Its mechanism of myocardial reperfusion injury mainly has free radical, calcium overload, the neutrophil leucocyte of cell adhesion molecule mediation to glue It is attached, assemble, ooze out, Apoptosis, nitric oxide, complement system, renin angiotensin, nuclear Factor-Kappa B etc..
Kidney is similarly high perfusion organ, sensitive to ischemic and ischemia-reperfusion.Ischemia-reperfusion injury of kidney It is the important damage link of ischemic Acute Renal Failure, and the restriction that transplanted kidney early function recovers is influenceed in kidney transplant Factor.Cause the correlative factor of ischemical reperfusion injury a lot, wherein, cascade of response of inflammation caused by ischemia-reperfusion and activity Oxygen oxidative damage is people's two principal elements of interest.The control strategy of renal ischemic reperfusion injury is mainly wrapped at present Include：Suppress leukocyte activation and Leukocyte-endothelium interaction, neutralization activity oxygen, anti-endothelin.
The mechanism of ischemic brain damage at least also relates to the following aspects：Excitatory toxicity, periinfarct depolarising, Inflammation and apoptosis.
Myocardial hypertrophy is the heart increase of caused cardiac muscle cell's volume, weight increase for the various stimulations of adaptation.Its pathology Change includes many changes such as cardiac myocyte hypertrophy, myocardial interstitial cells propagation and the reconstruction of heart cell epimatrix, i.e., Myocardial remodelling.Traditional view thinks that adult cardiomyocytes terminate differentiation, loses mitotic capabilities, it is impossible into the cell cycle； But at present evidence show two kinds of processes of the apoptosis that cardiac muscle cell in heart development and pathologic process be present and propagation, with dimension Hold the steady-state level of cardiac function.Clinically causing the disease of myocardial hypertrophy has many, such as primary or secondary hypertension, the heart Flesh infarct, valvular heart disease, congenital heart disease etc..Although early stage myocardial hypertrophy is advantageous to maintain normal heart function, due to the heart Flesh is plump itself can also to increase myocardial oxygen consumption, reduce myocardial compliance, therefore can cause heart failure for a long time, increase sudden death hair Raw rate.Research is thought at present, mechanicalness and neurohumor sexual factor induction myocardial hypertrophy, including renin-angiotensin system Composition, catecholamines, IGF, nitric oxide synthesis system etc..From cell and molecular level, cardiac muscle The process of cellular mast mainly includes four processes：Stimulus signal occurs, cell transmembrane signaling, and primary-response gene swashs at once Living, the gene of expressive function or structural protein is to " embryo type " Phenotypic Change.Wherein MAPK families signal path, Ca2+And its Signal path, phosphatidylinositol 3-kinase and its signal path of mediation, the JAK/STAT approach of dependence have been found that and take part in the heart The plump signal transmission of flesh, and the contact of countless ties between individual channel again be present, form complicated signal network and (wear Text is built, myocardial hypertrophy Advances in research on molecular mechanism, angiocardiology progress, the 1st phase of volume 30 in 2009,47-50).
Liver occupies critical role in body fat metabolism, and it participates in multiple important steps in Regulating Lipid Metabolism, Intake and synthesis including aliphatic acid, processing, storage, oxidation Decomposition and the output of lipid.The amount that aliphatic acid is obtained when liver surpasses Its disposal ability is crossed, causes lipid to be deposited in the form of triglycerides in liver cell, causes hepatic cell fattydegeneration, turns into single Pure property hepatic steatosis and then develop into nonalcoholic fatty liver disease, it is hard that some patientss can progress to liver fibrosis, liver Change, even (so etc., disorders of lipid metabolism causes the pathogenesis of non-alcohol fatty liver to liver cancer, and clinical liver and bladder disease is miscellaneous on road Will, the 7th phase of volume 31 in 2015,1050-1054).Similar situation, when free fatty acid levels increase or cell lactones in blood Fat content increases, more than the storage capacity of adipose tissue and each tissue to the oxidability of free fatty, excessive free fat Fat acid is deposited on target tissue such as adipose tissue, muscle and the liver of insulin action in the form of triglycerides, will result in pancreas Insulin resistance, so as to trigger a series of metabolic disorder and relevant disease, such as type ii diabetes, metabolic syndrome, cardiovascular and cerebrovascular Disease etc. (Developments of Chen Jinzhong etc., disorders of lipid metabolism and insulin resistance, the practical medicine of China, 2008 volume 3 7th phase, 147-149).
The content of the invention
The present invention's experimental studies have found that, with the extension of tissue ischemia time, in tissue the expression quantity of GPR31 albumen by It is cumulative to add, there is positively related relation between the tissue ischemia reperfusion injury order of severity, show that GPR31 is likely to be one Kind tissue or the new regulatory factor of Ischemia-reperfusion damage.
GPR31, which is overexpressed, can aggravate liver cell caused by anoxic and reoxygenation processing, cardiac muscle cell, the activity drop of kidney cell It is low, promote the inflammatory reaction of corresponding cell, show that GPR31 can promote the internal organs ischemical reperfusion injury such as liver, the heart and kidney, with And the occurrence and development of other inflammatory reactions occurred in these internal organs.
In addition, cytolipin caused by the reduction that GPR31 is expressed in liver cell can suppress palmitate and oleic acid stimulation sinks Product, show that GPR31 is expected to the target spot of the regulation and control liver cell fat accumulation new as one, applied to fat metabolism exception and phase In the treatment of related disorders.
GPR31 is overexpressed in cardiac muscle cell, myocardial hypertrophy caused by aggravating angiotensinⅡ, illustrates that GPR31 can promote Enter the occurrence and development of myocardial hypertrophy relevant disease.
On this basis, GPR31 can be used as ischemical reperfusion injury and its relevant disease, myocardial hypertrophy and its related disease The therapy target of disease, the diseases associated with inflammation of heart, fat metabolism exception and its relevant disease.
Technical scheme is as follows：
The first aspect of the invention is to provide, purposes of the GPR31 inhibitor in medicine is prepared, and the medicine is used to control Treat ischemical reperfusion injury and its relevant disease, myocardial hypertrophy and its relevant disease, the diseases associated with inflammation of heart, or fat metabolism Exception and relevant disease.
According to the present invention, the ischemical reperfusion injury and its relevant disease are selected from hepatic ischemia-reperfusion injury and its phase Related disorders, heart ischemia reperfusion damage and its relevant disease, ischemia-reperfusion injury of kidney and its relevant disease, and/or brain Ischemical reperfusion injury and its relevant disease.The ischemical reperfusion injury can be by organ transplant, tissue part or whole Excision, blood vessel embolism cause what many reasons such as tissue ischemia triggered.
The priming factorses of hepatic ischemia-reperfusion injury and its relevant disease include but is not limited to：Liver tumour, liver move Plant, thromboembolism treatment, hepatic portal occlusion art.
Heart ischemia reperfusion damages and its priming factorses of relevant disease include but is not limited to：Miocardial infarction, heart infarction are again Logical damage, heart transplant, coronary artery thrombolysis art, percutaneous transluminal coronary angioplasty, coronary artery intramedullary expansion art, by coronary artery Lu Shu.
The priming factorses of ischemia-reperfusion injury of kidney and its relevant disease include but is not limited to：Kidney transplant, kidney capsule Swollen, renal blood vessels operation.
Cerebral ischemia re-pouring injured and its relevant disease priming factorses include but is not limited to：Cerebral apoplexy, cerebrovascular operation Deng.
It is preferred that the ischemical reperfusion injury and its relevant disease are hepatic ischemia-reperfusion injury, heart ischemia reperfusion Damage, ischemia-reperfusion injury of kidney, and/or it is cerebral ischemia re-pouring injured.
According to the present invention, the myocardial hypertrophy and relevant disease include but is not limited to：Myocardial hypertrophy, heart failure, the rhythm of the heart Not normal, arterial embolism, coronary heart diseases and angina pectoris, heart block etc..
Causing the disease of myocardial hypertrophy has many, such as primary or secondary hypertension, myocardial infarction, valvular heart disease, congenital Property heart disease etc..
It is preferred that the myocardial hypertrophy and relevant disease are myocardial hypertrophy, heart failure.
The diseases associated with inflammation of heart includes but is not limited to：Myocarditis, endocarditis.
According to the present invention, the fat metabolism exception and relevant disease include but is not limited to：Insulin resistance, Metabolic syndrome Sign, non-alcohol fatty liver, obesity, diabetes, hyperglycaemia, hyperlipemia etc..
The spectrum of disease of non-alcohol fatty liver includes：Pure hepatic steatosis, nonalcoholic fatty liver disease, Liver fibrosis, hepatic sclerosis, liver cancer.
It is preferred that the fat metabolism exception and relevant disease are non-alcohol fatty liver, obesity, hyperlipemia, pancreas islet Element resistance, more preferably：Pure hepatic steatosis, nonalcoholic fatty liver disease, obesity, hyperlipidemia.
According to the present invention, GPR31 inhibitor can be suppress GPR31 protein actives or protein level inhibitor, Or suppress the inhibitor of GPR31 mRNA level in-site.The inhibitory activity can be reversible or irreversible.
The inhibitor for suppressing GPR31 protein actives or protein level includes but is not limited to GPR31 antibody, suppressed It is the protein of GPR31 protein actives or protein level, polypeptide, enzyme, native compound, synthesis compound, organic matter, inorganic Thing.The inhibitor of the suppression GPR31 protein actives or protein level refers to that GPR31 can be combined but not produced when combining The material of raw biological response.The inhibitor can block, suppress or weaken the response mediated by activator, and can be with activator Competition binding GPR31.
Suppress GPR31 mRNA level in-site inhibitor can be its anti sense nucleotide sequence, siRNA, miRNA, shRNA, DsRNA, or the protein of other mRNA level in-sites that can suppress GPR31, polypeptide, enzyme, compound.
According to the present invention, the antibody includes but is not limited to monoclonal antibody, synthetic antibody, polyclonal antibody, how special Property antibody, human antibody, humanized antibody, chimeric antibody, scFv (scFv) (including bispecific scFv), single-chain antibody, Fab Fragment, F (ab') fragment, the Fv (sdFv) of disulfide bond and any of above epitope binding fragments.Especially, for this hair Bright antibody includes the immunoactive portions of immunoglobulin molecules and immunoglobulin molecules.Immune globulin for the present invention White molecule can be any types (for example, IgG, IgE, IgM, IgD, IgA and IgY), the classification (example of immunoglobulin molecules Such as, IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass.Preferably, antibody is people or Humanized monoclonal antibodies.Such as Used herein, " people " antibody includes the antibody of the amino acid sequence with human immunoglobulin(HIg), and including from people's immune globulin Text of an annotated book storehouse or the antibody separated from the mouse by human gene expression antibody or other animals.
In an embodiment of the invention, the inhibitor be GPR31 mRNA shRNA, its disturb targeting Sequence is CACTCTCCTGCCTTCAGTTTG.
It is preferred that the shRNA sequences are：Positive oligonucleotide:5’- CCGGCACTCTCCTGCCTTCAGTTTGCTCGAGCAAACTGAAGGCAGGAGAGTGTTTTTG-3’；Reverse oligonucleotide: 5’-AATTCAAAAACACTCTCCTGCCTTCAGTTTG
CTCGAGCAAACTGAAGGCAGGAGAGTG-3’。
According to the present invention, the medicine further includes pharmaceutically acceptable auxiliary material.
The pharmaceutically acceptable auxiliary material is to be commonly used in pharmaceutical field or known various auxiliary materials, is included but is not limited to： Diluent, adhesive, antioxidant, pH adjusting agent, preservative, lubricant, disintegrant etc..
The diluent is for example：Lactose, starch, cellulose derivative, inorganic calcium salt, sorbierite etc..Described adhesive example Such as：Starch, gelatin, sodium carboxymethylcellulose, polyvinylpyrrolidone etc..The antioxidant is for example：Vitamin E, sulfurous acid Hydrogen sodium, sodium sulfite, butyl anisole etc..The pH adjusting agent is for example：Hydrochloric acid, sodium hydroxide, citric acid, tartaric acid, Tris, acetic acid, sodium dihydrogen phosphate, disodium hydrogen phosphate etc..The preservative is for example：Methyl p-hydroxybenzoate, para hydroxybenzene first Acetoacetic ester, metacresol, benzalkonium chloride etc..The lubricant is for example：Magnesium stearate, superfine silica gel powder, talcum powder etc..The disintegrant Such as：Starch, methylcellulose, xanthans, Ac-Di-Sol etc..
The formulation of medicine of the present invention can be the form of oral agents, such as tablet, capsule, pill, pulvis, granule, outstanding Floating agent, syrup etc.；Can also be the formulation of drug administration by injection, such as parenteral solution, powder-injection etc., pass through intravenous, intraperitoneal, skin Lower or intramuscular approach.All dosage forms used are all known to pharmaceutical field those of ordinary skill.
The medicine of the present invention can be applied to subject with approach known in the art, include but is not limited to orally, parenteral, Subcutaneously, intramuscular, intravenously, intraperitoneal, in liver, in cardiac muscle, in kidney, vagina, rectum, cheek is sublingual, intranasal, transdermal means etc..
Applied dose is combined depending on the age of recipient, health and body weight the species of medicine, therapeutic frequency, given Medicine approach etc..Medicine can be applied with single daily dose, or total daily dose is with twice daily, and three times or the separate doses of four times are applied With.Dosage can apply it is one or many, spraying time can be with odd-numbered day to some months or longer time.
According to the present invention, the medicine can also can improve or suppress the medicine of ischemical reperfusion injury relevant disease with other Thing is used in combination.
According to the present invention, the medicine can also can improve or suppress the medicine connection of myocardial hypertrophy and relevant disease with other Close and use.
According to the present invention, the medicine can also can improve or suppress the medication combined of the diseases associated with inflammation of heart with other Use.
According to the present invention, the medicine can also can improve or suppress medication combined the making of fat metabolism exception with other With.
The second aspect of the invention is to provide, and the carrier that expression targets GPR31 mRNA shRNA is preparing medicine In application, the medicine be used for treat ischemical reperfusion injury and its relevant disease, myocardial hypertrophy and its relevant disease, heart Diseases associated with inflammation, or fat metabolism exception and relevant disease.
The disease is as defined above.
The targeting sequence of the shRNA interference is CACTCTCCTGCCTTCAGTTTG.
It is preferred that the shRNA sequences are：Positive oligonucleotide:5’- CCGGCACTCTCCTGCCTTCAGTTTGCTCGAGCAAACTGAAGGCAGGAGAGTGTTTTTG-3’；Reverse oligonucleotide: 5’-AATTCAAAAACACTCTCCTGCCTTCAGTTTG
CTCGAGCAAACTGAAGGCAGGAGAGTG-3’。
The carrier can be expression vector.It can include in expression vector and be operably connected with above-mentioned shRNA sequences Promoter and transcription terminator.
The expression vector can be eukaryotic expression vector.
The eukaryotic expression vector can be plasmid expression vector or virus expression carrier.
The plasmid expression vector can be but not limited to pcDNA3.1+/-, pcDNA4/HisMax B, pSecTag2A, PVAX1, pBudCE4.1, pTracer CMV2, pcDNA3.1 (-)/myc-His A, pcDNA6-Myc/His B, pCEP4, PIRES, pIRESneo, pIRES hyg3, pCMV-myc, pCMV-HA, pIRES-puro3, pIRES-neo3, pCAGGS, PSilencer1.0, pSilencer2.1-U6hygro, pSilencer3.1-H1hygro, pSilencer3.1-H1neo, pSilencer4.1-CMV neo。
The virus expression carrier can be slow virus carrier, adenovirus vector, glandular associated virus expression vector or other Type viral vector, including but not limited to pLKO.1, pLVX-IRES-ZsGreen1, pCDH-EF1-Luc2-T2A- TdTomato, pCDH-MSCV-MCS-EF1-Puro, pCDH-MSCV-MCS-EF1-copGFP, pLVX-ZsGreen1-C1, PAdEasy-1, pShuttle-CMV, pShuttle, pAdTrack, pAdTrack-CMV, pShuttle-IRES-hrGFP-1, PShuttle-IRES-hrGFP-2, pShuttle-CMV-lacZ, pShuttle-CMV-EGFP-C, pXC1, pBHGE3, pAAV- MCS, pAAV-RC, pHelper, pAAV-LacZ, preferably pLKO.1 carriers.
The third aspect of the invention is to provide, and the slow virus carrier of the shRNA containing the mRNA for targeting GPR31 is being made Application in standby medicine, the medicine are used to treat ischemical reperfusion injury and its relevant disease, myocardial hypertrophy disease related to its Disease, the diseases associated with inflammation of heart, or fat metabolism exception and relevant disease.
The disease is as defined above.
The targeting sequence of the shRNA interference is CACTCTCCTGCCTTCAGTTTG or other may interfere with GPR31 expression Target sequence.
It is preferred that the shRNA sequences are：Positive oligonucleotide:5’- CCGGCACTCTCCTGCCTTCAGTTTGCTCGAGCAAACTGAAGGCAGGAGAGTGTTTTTG-3’；Reverse oligonucleotide: 5’-AATTCAAAAACACTCTCCTGCCTTCAGTTTGCTCGAGCAAACTGAAGGCAGGAGAGTG-3’。
It is preferred that the slow virus carrier is pLKO.1 carriers.
Can be used to preparing described second and the 3rd aspect described in medicine pharmaceutical carrier, can be conventional in this area The parenteral solution carrier used, such as isotonic NaCl solution, isotonic glucose solution, or isotonic contain the molten of buffer system Liquid, such as PBS solution.Can also according to preparation needs, selective addition prevent slow virus occur physically or chemically change and The protective agent of inactivation, such as divalent cation salt or surfactant etc..
Brief description of the drawings
Fig. 1：Under the different ischemic time, the western-blot detection figures of GPR31 expressing quantities in liver organization.In figure GAPDH is reference standards.
Fig. 2：L02 cells GPR31 protein expression situation qualification figures after GFP and GPR31 is overexpressed slow-virus transfection.In figure GAPDH is reference standards.
Fig. 3：L02 cells are respectively in the case where being overexpressed with normal expression GPR31, and after anoxic and reoxygenation processing, LDH is released Putting testing result statistical chart, (n.s. represents P >=0.05, and * * represent P<0.01).
Fig. 4：L02 cells respectively be overexpressed and normal expression GPR31 in the case of, anoxic and reoxygenation processing after, inflammation (* represents 0.01≤P to factor Il-6, Tnf- α, Chemokines CC xcl2 mRNA content RT-PCR testing results statistical chart< 0.05, * * represents P<0.01).
Fig. 5：H9C2 cells GPR31 protein expression situation qualification figures after GFP and GPR31 is overexpressed slow-virus transfection.
Fig. 6：H9C2 cells respectively be overexpressed and normal expression GPR31 in the case of, anoxic and reoxygenation processing after, cell (n.s. represents P >=0.05 to the result statistical chart of activity, and * represents 0.01≤P<0.05, * * represents P<0.01).
Fig. 7：HK2 cells GPR31 protein expression situation qualification figures after GFP and GPR31 is overexpressed slow-virus transfection.
Fig. 8：HK2 cells respectively be overexpressed and normal expression GPR31 in the case of, anoxic and reoxygenation processing after, cell (n.s. represents P >=0.05 to the result statistical chart of LDH release detections, and * * represent P<0.01).
Fig. 9：(* * are represented GPR31 gene mRNAs content qualification figure L02 cells after shRNA and shGPR31 slow-virus transfections P<0.01)。
Figure 10：L02 cells are respectively in the case of low expression and normal expression GPR31, with palmitate (PA) and oleic acid (OA) after (PA 0.5mM+OA 1mM) is stimulated, the microscopy figure of liver cell oil red O stain." PA+OA " represents palmitate and oleic acid Stimulation group.
Figure 11 A：H9C2 cells in the case where being overexpressed with normal expression GPR31, are handled with angiotensinⅡ respectively Afterwards, cell microscopy figure.
Figure 11 B：H9C2 cells in the case where being overexpressed with normal expression GPR31, are handled with angiotensinⅡ respectively Afterwards, (n.s. represents P >=0.05 to the statistical chart of cell surface product, and * * represent P<0.01).
Figure 11 C：H9C2 cells in the case where being overexpressed with normal expression GPR31, are handled with angiotensinⅡ respectively Afterwards, cellular mast marker gene Anp and Myh7 mrna expression amount RT-PCR testing results statistical chart (n.s. represent P >= 0.05, * * represents P<0.01).
Embodiment
The present invention is described further with reference to embodiments.It should be noted that embodiment cannot function as to this hair The limitation of bright protection domain, it will be understood by those skilled in the art that, any improvements introduced on the basis of the present invention and change all exist Within protection scope of the present invention.
Chemical reagent used in following examples is all conventional reagent, commercially available.The experiment side of specified otherwise is not done Method is all to use conventional method known in the art.
Used animal model and each research refer to object detection method in the examples below：
Experimental animal：From 8-10 week old, body weight in 24g-27g, the wild-type mice that background is male C57BL/6 strains (being purchased from Beijing HFK Bio-Technology Co., Ltd.) is experimental subjects.
Animal feeding:All experiment mices are raised in Wuhan University SPF level Experimental Animal Centers.Rearing conditions：Room temperature Between 22-24 DEG C, humidity is between 40-70%, and light and shade alternating lighting hours is 12h, and free water is ingested.
HEK293T, human embryonic kidney cells, purchased from Chinese Academy of Sciences's cell bank, catalog number (Cat.No.) GNHu43.
L02, human liver cell system, purchased from Chinese Academy of Sciences's cell bank, catalog number (Cat.No.) GNHu6.
H9C2, rat myocardial cell, purchased from Chinese Academy of Sciences's cell bank, catalog number (Cat.No.) GNR5.
HK2, people's renal proximal tubular cell, purchased from Chinese Academy of Sciences's cell bank, catalog number (Cat.No.) SCSP-511.
Cell is incubated in DMEM high glucose mediums (containing 10%FBS, 1% Pen .- Strep).Culture environment：37 DEG C, 5%CO2。
Mouse law during ischemia/reperfusion (ischemia/reperfusion, I/R) damage model is built：
1) operation consent 12h gives mouse fasting, can free water.
2) operation consent is lieed down fixed limb, with shaver by mouse with after 3% yellow Jackets success anesthetized mice Belly art area hair is shaved, and art area is sterilized with 10% tincture of iodine and 75% ethanol.
3) median abdominal incision is taken to enter abdomen, exposure liver is left, the hepatic pedicle in middle period.
4) portal vein and arteria hepatica of middle period and lobus sinister are closed with noninvasive blood vessel clip folder, makes about 70% hepatic ischemia/reperfusion injury, After 0.5min, compared with non-blacked lobus dexter, it is seen that block leaf to bleach, illustrate to block successfully, maintain ischemic 60min (Sham groups Mouse and operation group mouse operation repetitive, but without bloodstream blocking).
5) blood vessel clip is removed after ischemic 60min, recovers the liver blood flow of ischemic, close abdominal cavity, Post operation mouse is put individually Raising, observation.
Materials：Sham-operation group (Sham) and ischemia-reperfusion group mouse, the excessive fiber crops of 3% yellow Jackets are taken in postoperative 1h It is liquor-saturated, take ischemic region hepatic tissue, be immediately placed in more than 30min in liquid nitrogen, be stored in afterwards in -80 DEG C of refrigerators, for RT-PCR and Western blot are analyzed.
RT-PCR
1) in cell RNA extraction
1. collect cell simultaneously wash 2 times with PBS, after the completion of add 1ml TRizol, with sample injector piping and druming uniformly, Suck in 1.5ml centrifuge tubes, eddy blending machine concussion 30s, be stored at room temperature 5min, nucleoprotein is dissociated completely from nucleic acid.
2. 4 DEG C of 12000r/min centrifuge 5min, supernatant is taken, chlorination imitate 200 μ l, and eddy blending machine shakes 30s, on ice chest Stand 10min；
3. 4 DEG C of 12000r/min centrifuge 15min, supernatant is taken, 0.5ml isopropanols is added, fully mixes, stood on ice chest 10min, RNA is set fully to precipitate；
4. 4 DEG C of 12000r/min centrifuge 15min, supernatant discarding, 75% ethanol of addition 1ml precoolings, eddy blending machine shake Swing 30s washing RNA precipitates；
5. 4 DEG C of 12000r/min centrifuge 5min, abandoning supernatant, Quick-air-drying is precipitated.Extraction RNA adds appropriate DEPC to go Ionized water dissolves.
2) reverse transcription
Using Transcriptor First Strand cDNA Synthesis Kit (04896866001, Roche, Basel, Switzerland) reverse transcription reagent box, reverse transcription experiment is carried out according to kit specification.
Western blot
1) histone extracts
1. being put into 3-4 steel ball into the EP pipes of the precooling in dry ice, and add the tissue samples after quantifying of weighing.
2. adding PMSF into lysate, add in sample after mixing, shake up rapidly.
3. the ground sample in -80 DEG C of precooling beveller adapters, abrasive parameters are arranged to 30Hz/s, 90s.
4. after grinding terminates, placing 10min on ice, steel ball is taken out.
5. ultrasonic degradation instrument lysed sample (5KHz/ times, each 1s, be spaced 1s, be repeated 10 times), puts on ice after the completion of ultrasonic Put 10min.
6. sample is put into the centrifuge of 4 DEG C of precoolings, 12000rpm/min centrifugations 30min.
7. draw supernatant to be transferred in new EP pipes, 4 DEG C, 14000rpm/min centrifugations 10min.
Continue to centrifuge 8. drawing supernatant and being transferred in new EP pipes, 4 DEG C, 14000rpm/min centrifugations 5min.
Determine 9. accurately drawing clear liquid and carrying out albumen using BCA Protein Assay Kit (PierecTM, 23225) Amount.
2) protein extraction in cell
Cell adds lysate, centrifuging and taking supernatant after the completion of cracking, with BCA ProteinAssay Kit quantitative collections Protein sample.
3) loading and electrophoresis
Running gel has been configured, and electrophoresis liquid is added in electrophoresis tank.Protein sample is loaded to SDS-PAGE glue sample-adding In hole, start electrophoresis after the completion of point sample.
4) transferring film
1. transferring film liquid is prepared, in 4 DEG C of precoolings.
2. pvdf membrane is standby in transferring film liquid using being put into after the preceding 15s of immersion in methyl alcohol.
3. taking out the gel in gel slab, with transferring film liquid detergent gel, pvdf membrane is covered thereon.
4. transferring film voltage is set to 250V, electric current is set to 0.2A, shifts 1.5h.
After 5. transfer terminates, take out pvdf membrane.
5) close
Protein film is placed into preprepared TBST, washes away the transferring film liquid on film.Protein film is put into confining liquid, Slowly shaken on shaking table, room temperature closing 1-4h.
6) primary antibody is incubated
1. wash protein film 3 times with TBST, each 5min.
2. sealing machine encloses film in hybridization bag, plus primary antibody, sealing.
3. hybridization bag is put into 4 DEG C of shaking tables, overnight.
7) secondary antibody is incubated
Washed 3 times, each 5min with TBST 1. film is taken out, reclaim primary antibody.
2. film is put into the corresponding secondary antibody dilution added with secondary antibody, lucifuge is incubated 1h.
8) Protein Detection
Washed 3 times with TBST after incubation, each 5min.Examined using Bio-Rad Chemi DocXRS+ gel imaging systems Survey purpose band.
GPR31 is overexpressed plasmid construction：
1) PCR expands GPR31 genes, and primer is：
It is positive：5’-ACACCGGCGGCCACGCGTATGCCATTCCCAAACTGCTC-3’；
Reversely：5’-GGAGGTACCTCCGGATCCTTACTTATCGTCGTCATCCTTG-3’；
2) PCR primer enters row agarose gel electrophoresis, then carries out DNA pieces using DNA gel QIAquick Gel Extraction Kit (Tiangeng) The recovery of section；
3) by gained DNA product and restriction endonuclease FastDigest restrictionenzymes (Thermo)、Buffer orGreen buffer、ddH2O is well mixed (50 μ l systems), reacts under the conditions of being placed in 37 DEG C.UseAxyPrepTM PCR Clean-Up Kit(Axygen) Reclaim digestion products.
4) useThe step directed cloning kits (Novoprotein) of PCR mono-, according to kit specification Carry out recombining reaction；
5) competent escherichia coli cell is made, above-mentioned connection product is subjected to transformation experiment, coated plate, is placed in 37 DEG C of cultures Case, it is incubated overnight；
6) flat board being incubated overnight is taken out from 37 DEG C of incubators, clone is chosen and shakes bacterium, and detects bacterium colony PCR positive colonies.
7) the bacterium solution absorption 5-10 μ l that PCR is accredited as to the positive are seeded in 5ml LB (containing resistance) culture medium, 220rpm, it is incubated overnight in 37 DEG C of shaking tables.
8) bacterium solution being incubated overnight is taken out, carrying out plasmid extraction to muddy bacterium solution, (Tiangeng DNA is small to carry reagent Box).
9) plasmid after extracting can be directly used for turning in GPR31 winks or structure slow virus surely turns cell line.
GPR31 interference plasmids are built
1) it is CACTCTCCTGCCTTCAGTTTG that GPR31, which targets interference sequence, designs the oligomerization core for being adapted to pLKO.1 carriers Thuja acid；Positive oligonucleotide:5’CCGGCACTCTCCTGCCTTCAGTTTGCTCGAGCAAACTGAAGGCAGGAGAGTGTTT TTG 3’；Reverse oligonucleotide:5’AATTCAAAAACACTCTCCTGCCTTCAGTTTGCTCGAGCAAACTGAAGGCAGGA GAGTG 3’；Negative control siRNA sequence is：CAACAAGATGAAGAGCACCAA；
2) by above-mentioned two oligonucleotides point half plus sterilized water dissolving, final concentration of 100mM, merged；
3) according to " GPR31 expression plasmids structure " step carry out endonuclease reaction, the recovery of digestion products, coupled reaction, turn Change, choose monoclonal and sequencing, extraction plasmid；
4) gained plasmid can be used for the GPR31 of lentivirus mediated to strike low cell line structure.
Slow virus carrier is built and packaging
1) digested with pancreatin and the 293T cells that count, by 1 × 106Individual 293T/ holes are reached in 6 orifice plates.
2) cell confluency degree to 80% when start to transfect.
3) 1.5ml sterilizing EP pipes are taken, add 2 packaging plasmids (pSpax and pMD2G) and overexpression or each 1 μ of interference plasmid G is dissolved in 100 μ l serum free medium.It is soft to mix, it is incubated at room temperature 5min.
4) 1.5ml sterilizing EP pipes are taken, take 3 μ l PEI (1.6 μ g/ μ l) to be dissolved in 100 μ l serum free mediums.It is soft mixed It is even, it is incubated at room temperature 5min.
5) DNA solution and PEI solution are softly mixed.It is incubated at room temperature 15min.
6) by above-mentioned DNA-PEI mixed liquors, it is added dropwise in 6 orifice plates.
7) after transfecting 6h, fresh culture is changed.
8) supernatant of the 48-72h harvests containing virus after transfecting.3000rpm centrifuges 10min, removes precipitation, and with 0.45 μm Membrane filtration.
9) virus after filtering can be immediately available for infection or -80 DEG C of storages.
Cell hypoxia reoxygenation (H/R)：
1) to logarithmic phase, pre-temperature PBS is washed 2 times, is discarded for cell culture.
2) cell is divided into Normal group and H/R experimental groups, control group changes complete medium, puts 37 DEG C, 5%CO2Training Support, experimental group changes the DMEM culture mediums of sugar-free serum-free, and puts O2/CO2In the incubator of cell culture system (37 DEG C, 5% CO2, 1%O2) anoxic culture, after anoxic different time, experimental group changes complete medium reoxygenation culture.
3) after reoxygenation to predetermined reoxygenation incubation time, supernatant discarding, washed 2 times with PBS, collect cell and be stored in -80 DEG C It is standby.
LDH discharges and cytoactive (cell viability) detection：
Use LDH cytotoxicity colorimetric test kits (G1782, Promega, Madison, WI, USA) detection LDH's Burst size.Use on-radiation CCK-8 kits (CK04；Dojindo, Kumamoto, Japan) detection cytoactive.According to Specification carries out coherent detection.
Oil red O stain：
1) sample sets and control group are washed 2 times with 1 × PBS, are added the paraformaldehydes of 300 μ l 3% and are fixed 20min；
2) after 1 × PBS of addition is washed 2 times, 60% isopropyl alcohol 10s is added；
3) add 1 × PBS to wash 2 times, fume hood drying；
4) oil red O stain 1h is added per the μ l of hole 500；
5) add 1 × PBS to wash 2 times, 60% isopropanol is sorted, and is added 1 × PBS and is washed 2 times；Microscopy, take pictures.
Cardiac muscle cell's immunofluorescence dyeing：
1) cell is fixed with 4% paraformaldehyde；
2) PBS is washed 3 times, each 5min；
3) 0.2%Triton is added, 5min is shaken on shaking table；
4) PBS is washed 3 times, each 5min；
5) 8% sheep blood serum is added dropwise, shaking table is incubated at room temperature 60min in wet box, for closing；
6) discard confining liquid not wash, primary antibody (Anti- α-Actinin, Millipore, #05-384) (1% sheep blood serum is added dropwise 1:100 dilutions), 37 DEG C 2h or 4 DEG C is overnight；
7) primary antibody is discarded, PBS is washed 4 times, each 5min；
8) secondary antibody (Alexa added after 30 μ l dilutions488donkey anti-mouse IgG, Invitrogen, A21202,1 is pressed with PBS:200 dilution proportions), 37 DEG C of incubation 60min；
9) secondary antibody is discarded, PBS is washed 5 times, each 5min；
10) SlowFade Gold antifade reagent with DAPI mountings are used, are taken pictures in viewed under fluoroscopy.
Embodiment 1GPR31 expresses change in ischemic different time liver organization
C57 mouse are randomly divided into 6 groups, and respectively Sham groups and operation group (is divided into 5 different time points：Ischemic 5min, 10min, 20min, 40min, 60min), take operation group mouse and Sham group mouse liver tissues, Western blot detections GPR31 protein contents situation of change in each group liver organization (3 independent repetitions are tested).Primary antibody used in wherein WB is：Anti- GPCR GPR31antibody(ab75579；Abcam), secondary antibody is：PeroxidaseAffiniPure goat anti- rabbit-IgG(H+L)(#111-035-003；JacksonLaboratory).The reference standard detected using GAPDH as expression quantity Product.
As a result as shown in figure 1, the almost invisible GPR31 bands of Sham group WB results, operation group are prolonged with Ischemia Time Long, GPR31 protein bands are more and more obvious.This result shows that expression and the hepatic ischemia reperfusion of GPR31 albumen damage Hinder between the order of severity that there is positively related relation.
Embodiment 2GPR31 is overexpressed the L02 cellular damages to H/R processing inductions and the influence of inflammatory reaction
L02 cells are divided into 4 groups：GFP control groups, GPR31 control groups, GFP H/R groups, GPR31H/R groups.Adherent L02 cells Turn corresponding plasmid wink respectively, H/R processing (anoxic 6h, reoxygenation 6h) is carried out after 24h.After the completion of plasmid transfection, the total egg of cell is extracted In vain, Western blot detect GPR31 overexpression situation (3 independent repetitions are tested, 3 repetitions every time).H/R processing is completed The burst size (every group of 6 repetitions) of LDH in culture medium is detected afterwards, and the hepatocellular injury induced H/R is overexpressed to evaluate GPR31 Influence；Extract RNA and carry out RT-PCR analyses (2 times independent repeat to test, 3 repetitions every time), detection inflammation relevant cell because Son and chemokine mRNA changes of contents, to evaluate the influence that GPR31 is overexpressed the liver cell inflammatory reaction to H/R inductions.LDH Discharge testing result and class value is compareed as 1 using GFP, calculate remaining each group and its ratio.
RT-RCR the primer sequences are as follows：
Gene Forward primer Reverse primer
Il6 TCTGGATTCAATGAGGAGACTTG GTTGGGTCAGGGGTGGTTAT
Tnfα TACTCCCAGGTCCTCTTCAAGG TTGATGGCAGAGAGGAGGTTG
Cxcl2 GCGCCCAAACCGAAGTCATA TTTCTTAACCATGGGCGATGC
GPR31 is overexpressed WB testing results as shown in Fig. 2 compared to GFP groups, and it is notable that GPR31 is overexpressed histone band Enhancing, i.e., GPR31 is overexpressed notable in L02 cells.
LDH discharges testing result as shown in figure 3, GPR31 control groups LDH is discharged compared with GFP control groups without significant difference. After H/R processing is carried out, LDH burst size dramatically increases, and the increase degree of GPR31 overexpression groups LDH burst size is notable Higher than GFP groups.This result shows that GPR31, which is overexpressed, aggravates hepatocellular injury and hepatotoxicity caused by H/R processing.
Inflammatory factor and chemokine mRNA detection, using actin as reference standards, as a result as shown in figure 4, as progress H/ After R processing, inflammatory factor Il-6, the Tnf- α of GPR31 overexpression groups, Chemokines CC xcl2 mRNA contents dramatically increase. This result shows that GPR31, which is overexpressed, aggravates liver cell inflammatory reaction caused by H/R processing.
Embodiment 3GPR31 is overexpressed the influence of the H9C2 cytoactives to H/R processing inductions
H9C2 cells are divided into 4 groups：GFP control groups, GPR31 control groups, GFP H/R groups, GPR31H/R groups.Corresponding restructuring Slow virus virus liquid infects the H9C2 cells of culture respectively, and H/R processing (anoxic 1h, reoxygenation 6h) is carried out after 24h.Plasmid transfection is complete Cheng Hou, extract total protein of cell, Western blot detections GPR31 overexpression situation (3 independent repetitions are tested).H/R is complete Into rear detection cytoactive (every group of 6 repetitions).Using GFP control groups testing result as 1, remaining each group is calculated compared to the group Ratio.
WB testing results are as shown in figure 5, compared to GFP groups, and GPR31 is overexpressed histone band and significantly increased, i.e. H9C2 GPR31 is overexpressed notable in cell.
Cytoactive detection result as shown in fig. 6, GPR31 cellular control units activity compared to GFP control groups without significance difference It is different.After H/R processing is carried out, cytoactive significantly reduces compared to control group.And after GPR31 is overexpressed, GPR31H/R groups The reduction degree of cytoactive is noticeably greater than GFP H/R groups.This result, which shows that GPR31 is overexpressed, can remarkably promote H/R inductions Myocardial cell injury, reduce the activity of cardiac muscle cell.
Embodiment 4GPR31 is overexpressed the influence to HK2 cellular damages after H/R processing
HK2 cells are divided into 4 groups：GFP control groups, GPR31 control groups, GFP H/R groups, GPR31H/R groups.Corresponding slow disease Viral disease venom infects the HK2 cells of culture respectively, carries out H/R processing (anoxic 3h, reoxygenation 24h) after 24h, after the completion of plasmid transfection Extract total protein of cell, Western blot detection detections GPR31 overexpression situation (3 independent repetitions are tested).H/R is completed The burst size (every group of 6 repetitions) of LDH in culture medium is detected afterwards, the nephrocyte damage induced to evaluate GPR31 to be overexpressed H/R Influence.Testing result is discharged as 1 using GFP control groups LDH, calculates ratio of remaining each group compared to the group.
GPR31 is overexpressed testing result as shown in fig. 7, compared to GFP groups, GPR31 overexpression group cell kinds in HK2 cells GPR31 protein contents dramatically increase.
Kidney cell LDH burst sizes testing result is as shown in figure 8, GPR31 control groups LDH is discharged compared with GFP control groups Without significant difference.After H/R processing is carried out, LDH burst size dramatically increases, and the increasing of GPR31 overexpression groups LDH burst size Degree is added to be significantly higher than GFP groups.This result shows, acts on identical, GPR31 table excessively in liver, cardiac muscle cell with GPR31 Kidney cell damage caused by H/R processing can be aggravated.
Embodiment 5GPR31 strikes the low influence to liver cell fat accumulation
L02 cells are divided into 4 groups：ShRNA control groups, shGPR31 control groups, shRNA experimental groups, shGPR31 experimental groups.Patch Turn corresponding plasmid wall L02 cells difference wink, palmitate (PA) and oleic acid (OA) (PA is added in backward two experimental groups of 24h 0.5mM+OA 1mM) stimulate, the BSA of isodose is added in control group, oil red O stain is carried out after 12h.
RT-PCR the primer sequences are as follows：
Gene Forward primer Reverse primer
GPR31 TCAACCTGCTGTCTCCTCAG GTGCTTCCTGCCAGATGATG
After the completion of plasmid transfection, cell RNA is extracted, detecting GPR31 gene mRNAs content using RT-PCR (carries out 3 times solely It is vertical to repeat to test, 2 repetitions every time), as a result as shown in Figure 9.GPR31 strikes the mRNA contents of low group of (shGPR31) GPR31 gene Significantly reduced compared with shRNA control groups.
Oil red O stain result is as shown in Figure 10, cellular control unit without obvious red, and when add PA+OA stimulate after, it is oily The cell that red O is incarnadined significantly increases compared to control group, and GPR31 strikes the increase of low group of (shGPR31 experimental groups) stained area Degree is small compared with shRNA experimental groups.The result illustrates that the reduction of GPR31 expression can suppress the L02 cytolipins deposition of PA stimulations.
Embodiment 6GPR31 is overexpressed the influence to myocardial hypertrophy
H9C2 cells are divided into 4 groups：GFP control groups, GPR31 control groups, II group of GFP Ang, II group of GPR31Ang.It is corresponding Slow virus virus liquid infects the H9C2 cells of culture respectively, after 24h, with 1 μM of angiotensinⅡ (Ang II) or PBS (controls Group) 48h is stimulated, then carry out immunofluorescent test.After the completion of slow-virus transfection, total protein of cell, Western blot are extracted Detect the expression of H9C2 cell kind GPR31 albumen.(2 times solely for harvesting progress RT-PCR analyses after the completion of Ang II is stimulated Vertical to repeat to test, 3 technologies repeat every time) the plump marker gene Anp and Myh7 of detection mRNA contents.Cell surface product statistics As a result class value is compareed as 1 using GFP, calculates ratio of remaining group relative to the group.
RT-RCR the primer sequences are as follows：
Gene Forward primer Reverse primer
Anp ACCTGCTAGACCACCTGGAG CCTTGGCTGTTATCTTCGGTACCGG
Myh7 CCGAGTCCCAGGTCAACAA CTTCACGGGCACCCTTGGA
GPR31 protein expressions situation testing result is the same as embodiment 3 in H9C2 cells.
H9C2 cellular masts and myocardial hypertrophy marker expression situation testing result are as shown in figure 11, are handled when with Ang II Afterwards, significantly increased compared to PBS control group, cell surface product, and GPR31 overexpression groups cell increase degree is noticeably greater than GFP II group of Ang (Figure 11 A, B)；Consistent with the above results, mRNA analyses are shown, cell GPR31 overexpression groups after the processing of Ang II are thin Born of the same parents' hypertrophy marker gene Anp and Myh7 up-regulation degree are significantly higher than control group (Figure 11 C).

Claims (9)

  1. Purposes of the 1.GPR31 inhibitor in medicine is prepared, the medicine are used to treat ischemical reperfusion injury disease related to its Disease, myocardial hypertrophy and its relevant disease, the diseases associated with inflammation of heart, or fat metabolism exception and relevant disease；
    It is preferred that the ischemical reperfusion injury and its relevant disease are selected from hepatic ischemia-reperfusion injury and its relevant disease, heart Ischemical reperfusion injury and its relevant disease, ischemia-reperfusion injury of kidney and its relevant disease, and/or cerebral ischemia re-pouring damage Injure its relevant disease；
    It is preferred that the priming factorses of the hepatic ischemia-reperfusion injury and its relevant disease are selected from liver tumour, liver transplant, molten Bolt is treated and/or hepatic portal occlusion art；
    It is preferred that the priming factorses of the heart ischemia reperfusion damage and its relevant disease are selected from miocardial infarction, heart infarction and lead to damage again Wound, heart transplant, coronary artery thrombolysis art, percutaneous transluminal coronary angioplasty, by coronary artery intramedullary expansion art and/or coronary artery Lu Shu；
    It is preferred that the priming factorses of the ischemia-reperfusion injury of kidney and its relevant disease be selected from kidney transplant, the renal cystis and/ Or renal blood vessels operation；
    It is preferred that described cerebral ischemia re-pouring injured and its relevant disease priming factorses are selected from cerebral apoplexy and/or cerebrovascular operation；
    It is preferred that the ischemical reperfusion injury and its relevant disease are hepatic ischemia-reperfusion injury, heart ischemia reperfusion damage Wound, ischemia-reperfusion injury of kidney, and/or it is cerebral ischemia re-pouring injured；
    It is preferred that the myocardial hypertrophy and relevant disease be selected from myocardial hypertrophy, heart failure, arrhythmia cordis, arterial embolism, coronary heart disease, Angina pectoris and/or heart block；
    It is preferred that the disease of myocardial hypertrophy is caused to be selected from primary or secondary hypertension, myocardial infarction, valvular heart disease or the congenital heart Popular name for；
    It is preferred that the myocardial hypertrophy and relevant disease are myocardial hypertrophy, heart failure；
    It is preferred that the diseases associated with inflammation of the heart is selected from myocarditis, endocarditis；
    It is preferred that the fat metabolism exception and relevant disease are selected from insulin resistance, metabolic syndrome, non-alcoholic fatty liver Disease, obesity, diabetes, hyperglycaemia, hyperlipemia；
    It is preferred that the fat metabolism exception and relevant disease are non-alcohol fatty liver, obesity, hyperlipemia, insulin support It is anti-；More preferably：Pure hepatic steatosis, nonalcoholic fatty liver disease, obesity, hyperlipidemia.
  2. 2. purposes as claimed in claim 1, the GPR31 inhibitor is to suppress GPR31 protein actives or protein level Inhibitor or suppress GPR31 mRNA level in-site inhibitor；
    It is preferred that the inhibitor of the suppression GPR31 protein actives or protein level is selected from GPR31 antibody, suppresses GPR31 The protein of protein active or protein level, polypeptide, enzyme, native compound, synthesis compound；
    It is preferred that the inhibitor of the mRNA level in-site of the suppression GPR31 be selected from its anti sense nucleotide sequence, siRNA, miRNA, shRNA, DsRNA, or the protein of GPR31 mRNA level in-site, polypeptide, enzyme, compound can be suppressed.
  3. 3. purposes as claimed in claim 1 or 2, the inhibitor is GPR31 mRNA shRNA, its targeting sequence disturbed It is classified as CACTCTCCTGCCTTCAGTTTG；
    It is preferred that the shRNA sequences are：Positive oligonucleotide: 5’- CCGGCACTCTCCTGCCTTCAGTTTGCTCGAGCAAACTGAAGGCAGGAGAGTGTTTTTG -3’;Reverse oligonucleotides Acid: 5’-AATTCAAAAACACTCTCCTGCCTTCAGTTTG CTCGAGCAAACTGAAGGCAGGAGAGTG- 3’.
  4. 4. the purposes as described in claim any one of 1-3, the medicine further includes pharmaceutically acceptable auxiliary material.
  5. 5. expression targets application of the GPR31 mRNA shRNA carrier in medicine is prepared, the medicine is scarce for treating Blood reperfusion injury and its relevant disease, myocardial hypertrophy and its relevant disease, the diseases associated with inflammation of heart, or fat metabolism are abnormal And relevant disease；
    It is preferred that the targeting sequence of the shRNA interference is CACTCTCCTGCCTTCAGTTTG；
    It is preferred that the shRNA sequences are：Positive oligonucleotide: 5’- CCGGCACTCTCCTGCCTTCAGTTTGCTCGAGCAAACTGAAGGCAGGAGAGTGTTTTTG- 3’;Reverse oligonucleotides Acid: 5’-AATTCAAAAACACTCTCCTGCCTTCAGTTTG CTCGAGCAAACTGAAGGCAGGAGAGTG- 3’.
  6. 6. application as claimed in claim 5, the carrier is expression vector, comprising operationally connecting with the shRNA sequences The promoter and transcription terminator connect；
    It is preferred that the expression vector is eukaryotic expression vector；
    It is preferred that the eukaryotic expression vector is plasmid expression vector or virus expression carrier；
    It is preferred that the plasmid expression vector be selected from pcDNA3.1+/-, pcDNA4/HisMax B, pSecTag2 A, pVAX1, PBudCE4.1, pTracer CMV2, pcDNA3.1（-）/ myc-His A, pcDNA6-Myc/His B, pCEP4, pIRES, PIRESneo, pIRES hyg3, pCMV-myc, pCMV-HA, pIRES-puro3, pIRES-neo3, pCAGGS, PSilencer1.0, pSilencer2.1-U6 hygro, pSilencer3.1-H1 hygro, pSilencer3.1-H1 Neo, pSilencer4.1-CMV neo；
    It is preferred that the virus expression carrier is selected from slow virus carrier, adenovirus vector, glandular associated virus expression vector；It is further excellent Elect pLKO.1, pLVX-IRES-ZsGreen1, pCDH-EF1-Luc2-T2A-tdTomato, pCDH-MSCV-MCS-EF1- as Puro, pCDH-MSCV-MCS-EF1-copGFP, pLVX-ZsGreen1-C1, pAdEasy-1, pShuttle-CMV, PShuttle, pAdTrack, pAdTrack-CMV, pShuttle-IRES-hrGFP-1, pShuttle-IRES-hrGFP-2, PShuttle-CMV-lacZ, pShuttle-CMV-EGFP-C, pXC1, pBHGE3, pAAV-MCS, pAAV-RC, pHelper or pAAV-LacZ。
  7. 7. application of the slow virus carrier of the shRNA containing the mRNA for targeting GPR31 in medicine is prepared, the medicine are used for Treat ischemical reperfusion injury and its relevant disease, myocardial hypertrophy and its relevant disease, the diseases associated with inflammation of heart, or fatty generation Thank exception and relevant disease；
    It is preferred that the targeting sequence of the shRNA interference is CACTCTCCTGCCTTCAGTTTG；
    It is preferred that the shRNA sequences are：Positive oligonucleotide: 5’ CCGGCACTCTCCTGCCTTCAGTTTGCTCGAGCAAACTGAAGGCAGGAGAGTGTTTTTG 3’;Reverse oligonucleotides Acid: 5’AATTCAAAAACACTCTCCTGCCTTCAGTTTG CTCGAGCAAACTGAAGGCAGGAGAGTG 3’.
  8. 8. application as claimed in claim 7, the slow virus carrier is pLKO.1 carriers.
  9. 9. the application as described in claim any one of 5-8, the medicine further contain pharmaceutical carrier；It is preferred that the medicinal load Body is parenteral solution carrier；It is preferred that the parenteral solution carrier is selected from：Isotonic NaCl solution, isotonic glucose solution are isotonic Solution containing buffer system.
CN201710719318.9A 2017-08-21 2017-08-21 Application of GPR31 inhibitor in pharmacy Active CN107362365B (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
CN201911134452.8A CN110947003B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicine for treating renal ischemia-reperfusion injury and related diseases
CN201710719318.9A CN107362365B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in pharmacy
CN201911135432.2A CN110935022A (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicines for treating cerebral ischemia-reperfusion injury and related diseases
CN201910864807.2A CN110694071B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicines for treating myocardial hypertrophy and related diseases
CN201911134026.4A CN110772636B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicines for treating cardiac ischemia-reperfusion injury and related diseases
CN201910865919.XA CN110538327B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicines for treating abnormal fat metabolism and related diseases
PCT/CN2017/106949 WO2019037222A1 (en) 2017-08-21 2017-10-19 Use of gpr31 inhibitor in drug preparation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710719318.9A CN107362365B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in pharmacy

Related Child Applications (5)

Application Number Title Priority Date Filing Date
CN201911134452.8A Division CN110947003B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicine for treating renal ischemia-reperfusion injury and related diseases
CN201911134026.4A Division CN110772636B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicines for treating cardiac ischemia-reperfusion injury and related diseases
CN201910865919.XA Division CN110538327B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicines for treating abnormal fat metabolism and related diseases
CN201911135432.2A Division CN110935022A (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicines for treating cerebral ischemia-reperfusion injury and related diseases
CN201910864807.2A Division CN110694071B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicines for treating myocardial hypertrophy and related diseases

Publications (2)

Publication Number Publication Date
CN107362365A true CN107362365A (en) 2017-11-21
CN107362365B CN107362365B (en) 2020-01-07

Family

ID=60310269

Family Applications (6)

Application Number Title Priority Date Filing Date
CN201911134026.4A Active CN110772636B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicines for treating cardiac ischemia-reperfusion injury and related diseases
CN201911134452.8A Active CN110947003B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicine for treating renal ischemia-reperfusion injury and related diseases
CN201911135432.2A Withdrawn CN110935022A (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicines for treating cerebral ischemia-reperfusion injury and related diseases
CN201910864807.2A Active CN110694071B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicines for treating myocardial hypertrophy and related diseases
CN201710719318.9A Active CN107362365B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in pharmacy
CN201910865919.XA Active CN110538327B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicines for treating abnormal fat metabolism and related diseases

Family Applications Before (4)

Application Number Title Priority Date Filing Date
CN201911134026.4A Active CN110772636B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicines for treating cardiac ischemia-reperfusion injury and related diseases
CN201911134452.8A Active CN110947003B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicine for treating renal ischemia-reperfusion injury and related diseases
CN201911135432.2A Withdrawn CN110935022A (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicines for treating cerebral ischemia-reperfusion injury and related diseases
CN201910864807.2A Active CN110694071B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicines for treating myocardial hypertrophy and related diseases

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN201910865919.XA Active CN110538327B (en) 2017-08-21 2017-08-21 Application of GPR31 inhibitor in preparation of medicines for treating abnormal fat metabolism and related diseases

Country Status (2)

Country Link
CN (6) CN110772636B (en)
WO (1) WO2019037222A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108277270A (en) * 2018-01-15 2018-07-13 武汉大学 The application of FBXW5 and its inhibitor in preparing treatment fatty liver and relevant disease drug
CN114848822A (en) * 2022-06-01 2022-08-05 合肥工业大学 Application of GPR31 inhibitor in preparation of drugs for preventing and treating vascular calcification

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113462769B (en) * 2021-08-05 2023-06-30 中国医学科学院医药生物技术研究所 inhibitor/CaMKII system and application thereof as biomarker
CN115287276A (en) * 2022-03-07 2022-11-04 兰州大学 Application of SEM1 protein and engineered probiotic bacteria expressing SEM1 protein in preparation of medicines for treating and/or preventing heart diseases
CN116236477B (en) * 2023-01-17 2024-03-26 复旦大学附属中山医院 Application of lysophosphatidic acid receptor 5 antagonist in preparation of heart protection medicine

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU6517400A (en) * 1999-08-03 2001-02-19 Millennium Pharmaceuticals, Inc. 15571, a novel gpcr-like molecule of the secretin-like family and uses thereof
US20030087249A1 (en) * 2001-03-01 2003-05-08 Millennium Pharmaceuticals, Inc. 93870, a human G-protein coupled receptor and uses therefor
US20020170081A1 (en) * 2001-03-29 2002-11-14 Brennan Thomas J. Transgenic mice containing GPR31 gene disruptions
CN100473662C (en) * 2002-08-01 2009-04-01 阿瑞那制药公司 Human G protein-coupled receptor and modulators thereof for the treatment of ischemic heart disease and congestive heart failure
DE602004031223D1 (en) * 2003-06-20 2011-03-10 Arena Pharm Inc HUMAN G-PROTEIN-COUPLED RECEPTOR AND MODULATORS THEREOF FOR THE TREATMENT OF CARDIAC DISORDER
WO2005059561A2 (en) * 2003-12-12 2005-06-30 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with g protein-coupled receptor 31 (gpr31)
US20100233724A1 (en) * 2006-08-08 2010-09-16 Watkins Steven M Markers of non-alcoholic fatty liver disease (nafld) and non-alcoholic steatohepatitis (nash) and methods of use thereof
EP2391645A1 (en) * 2009-01-30 2011-12-07 Protaffin Biotechnologie AG Glycosaminoglycan-antagonising mcp-i mutants and methods of using same
US8580807B2 (en) * 2009-04-03 2013-11-12 Merck Sharp & Dohme Corp. Bicyclic piperidine and piperazine derivatives as GPCR modulators for the treatment of obesity, diabetes and other metabolic disorders
CN102971311B (en) * 2010-05-06 2015-07-08 百时美施贵宝公司 Bicyclic heteroaryl compounds as GPR119 modulators
CN104434888A (en) * 2013-09-17 2015-03-25 深圳先进技术研究院 Application of CMKLR1 micromolecule antagonist to control nonalcoholic fatty liver and hepatitis
TN2016000444A1 (en) * 2014-05-07 2018-04-04 Bristol Myers Squibb Co Pyrrolidine gpr40 modulators for the treatment of diseases such as diabetes.
CN104316609B (en) * 2014-10-13 2016-09-07 上海市第一人民医院宝山分院 Arachidonic acid metabolite application in preparation preeclampsia detection kit

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
MICHIHIKO TADA等: "Arachidonate Metabolism in Myocardial Ischemia and Reperfusion", 《J.MOL.CELL CARDIOL.》 *
YANDE GUO等: "Identification of the orphan G protein-coupled receptor GPR31 as a receptor for 12-(S)-hydroxyeicosatetraenoic acid", 《THE JOURNAL OF BIOLOGICAL CHEMISTRY》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108277270A (en) * 2018-01-15 2018-07-13 武汉大学 The application of FBXW5 and its inhibitor in preparing treatment fatty liver and relevant disease drug
CN114848822A (en) * 2022-06-01 2022-08-05 合肥工业大学 Application of GPR31 inhibitor in preparation of drugs for preventing and treating vascular calcification

Also Published As

Publication number Publication date
CN110947003B (en) 2021-04-02
CN107362365B (en) 2020-01-07
CN110772636B (en) 2021-03-16
WO2019037222A1 (en) 2019-02-28
CN110538327B (en) 2021-08-03
CN110935022A (en) 2020-03-31
CN110694071A (en) 2020-01-17
CN110694071B (en) 2020-09-22
CN110772636A (en) 2020-02-11
CN110947003A (en) 2020-04-03
CN110538327A (en) 2019-12-06

Similar Documents

Publication Publication Date Title
CN107362365A (en) Application of the GPR31 inhibitor in pharmacy
Mittal et al. The TWEAK–Fn14 system is a critical regulator of denervation-induced skeletal muscle atrophy in mice
JP6932197B2 (en) Application of hexokinase 2-specific inhibitors in acute central nervous system injury disease
Liu et al. Stachydrine ameliorates cardiac fibrosis through inhibition of angiotensin II/transformation growth factor β1 fibrogenic axis
JP2017534628A (en) Composition for cancer stem cell treatment
Ma et al. Role of relaxin-2 in human primary osteosarcoma
US10870852B2 (en) Compositions and methods for treating diabetic retinopathy
CN110464844B (en) Application of ALOX12 inhibitor in preparation of medicine for treating cardiac ischemia-reperfusion injury
CN112543809A (en) Combination therapy comprising C/EBP alpha sarRNA
CN107441100A (en) Treat the compound of ischemical reperfusion injury
WO2014113406A1 (en) Compositions and methods for treating pancreatic cancer
WO2020113877A1 (en) Function and use of e2f6 inhibitor
CN103370414A (en) Method for reducing expression of downregulated in renal cell carcinoma in malignant gliomas
US20230067811A1 (en) Modulating lymphatic vessels in neurological disease
CN108530451B (en) A kind of cachectic compound of anticancer and application
CN108277270A (en) The application of FBXW5 and its inhibitor in preparing treatment fatty liver and relevant disease drug
US20240207211A1 (en) Composition for promoting bone formation or treating bone disease by acting on osteoblast mitochondria
US10801025B2 (en) MicroRNA therapy for pancreatic cancer
CN114807357A (en) Application of miR-564 or miR-564 expression vector in preparation of product for diagnosing/treating aortic dissection
CN106310292B (en) A kind of inhibitor of circRNA-CER gene and its application
Bai et al. MiR‐106a targets ATG7 to inhibit autophagy and angiogenesis after myocardial infarction
RU2584234C1 (en) Using preparation &#34;semax&#34; as means of activation of adaptive immunity
CN112587662A (en) Application of miR-155/PEA15 signal pathway inhibitor in medicine for pathological cardiac remodeling
Zhou Persistent Choroidal Thinning Associated with Retinopathy of Prematurity: A Tale of Two Molecules–IL-1β and p53
Mei et al. Effects of microRNA-338 on morphine tolerance by targeting CXCR4 in a rat model of bone cancer pain

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right
TA01 Transfer of patent application right

Effective date of registration: 20191126

Address after: 430040 No.1, floor 1, No.17, eleven village, Changqing Garden, Dongxihu District, Wuhan City, Hubei Province (18)

Applicant after: Wuhan Dafeng Biotechnology Co., Ltd

Address before: 430072 Hubei Province, Wuhan city Wuchang District of Wuhan University Luojiashan

Applicant before: WuHan University

GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20200624

Address after: 430000 16 / F, building 02, phase III, software new town, No.8 Huacheng Avenue, Donghu New Technology Development Zone, Wuhan City, Hubei Province

Patentee after: Wuhan huikangda Technology Co.,Ltd.

Address before: 430040 No.1, floor 1, No.17, eleven village, Changqing Garden, Dongxihu District, Wuhan City, Hubei Province (18)

Patentee before: Wuhan Dafeng Biotechnology Co.,Ltd.