CN103031334A - Dual-target siRNA eukaryotic expression plasmid capable of inhibiting STAT3 and AFP gene expression, and application of expression plasmid - Google Patents

Abstract

The invention relates to a dual-target siRNA eukaryotic expression plasmid capable of inhibiting STAT3 and AFP gene expression, and the application of the expression plasmid. Mainly based on the RNA interference technology, directing at the target sequence of AFP and STAT3 genes with abnormal high expression in tumor, a plasmid pGenesil1.5-STAT3-AFP capable of simultaneously expressing STAT3 and AFP SiRNA in eukaryotic cells is built. The dual-target siRNA eukaryotic expression plasmid can efficiently and specifically inhibit the STAT3 and AFP gene expression of tumor cells, and can be used for preparing the gene medicines for the treatment on AFP positive tumors expressing the STAT3.

Description

Suppress dual-target siRNA eukaryon expression plasmid of STAT3 and AFP genetic expression and uses thereof

Technical field

The present invention relates to dual-target siRNA eukaryon expression plasmid that suppresses STAT3 and AFP genetic expression and uses thereof, belong to the biological medicine technology field.

Background technology

Alpha-fetoprotein (alpha-fetoprotein, AFP) is a kind of glycoprotein that is produced by liver, yolk sac embryonic stage, sharply reduction after the birth.When liver neoplasm, some gastroenteric tumor and some genital system tumor occured, serum afp raise again again.AFP has vital role as a kind of generally acknowledged tumor markers in the diagnosis of tumour at present.Nearly 80% liver cancer patient blood serum AFP raises, and is one of inspection item commonly used of diagnosing primary liver cancer.The AFP positive appears in 50% the germinoma of having an appointment, and in various degree rising also can occur other enterogastric tube tumour such as the patients such as carcinoma of the pancreas or lung cancer and liver cirrhosis.Wherein AFP positive gastric carcinoma sickness rate accounts for the 5.1%-15% of cancer of the stomach, and this malignancy is high, has morphocytology as liver cancer, easily liver metastasis and early stage lymphatic metastasis, and aggressive is strong, the characteristics of poor prognosis.

Recent study finds that AFP has vital role in the genesis of tumour: (1) immunoregulatory activity: AFP can suppress the antigen-reactive of NK cytoactive and the dependence of T lymphocyte, the generation of suppressor inducer T lymphocyte, the MHC-II quasi-molecule of downward modulation onthe surface of monocytes, and suppress tumour necrosis factor to the cytotoxic effect of tumour cell; AFP can also reduce the expression of liver cancer cell death receptor, makes it to escape lymphocytic attack.(2) promote tumor cell proliferation: experimental results show that, AFP has direct proliferation to human hepatoma HepG2 cell, H22 cell and Ehrlich ascites cells and Cervical Cancer HeLa Cells, use AFP(20mg/L) stimulate human liver cancer cell Bel 7402 to find c-fos, the mRNA amount of c-jun and N-ras raises, illustrate that AFP can stimulate some and the cell proliferation oncogene expression relevant with differentiation, thereby promote tumor cell proliferation.Prompting AFP may be the autocrine protein that important endogenous is urged tumor cell proliferation.(3) participate in the apoptosis of tumor cells process: thus research report AFP is arranged by stoping apoptosis of tumor cells with the AFP receptors bind.Other has research to think that AFP can be apoptosis-induced by activation caspase3 in tumour cell.

AFP is as a kind of embryo period or the synthetic protein of pathological state, and it is accompanied by fetal development and the vigorous process of cell fission, is not only a kind of satellite phenomenon in the tumor development process, and is the endogenous material that promotes growth of tumour cell.This effect can be blocked by the AFP monoclonal antibody.The medicine and the method that suppress AFP genetic expression will affect the propagation of tumour cell, thereby reach the purpose of antineoplaston.Therefore, the expression of blocking-up AFP gene and biologic activity thereof might be new strategies of a treatment and AFP related neoplasms in conjunction with other treatment means simultaneously.

The inventor's studies confirm that in the AFP positive gastric carcinoma, utilize the RNAi technology to suppress the AFP expression AFP positive gastric carcinoma cell FU97 is had propagation inhibition and apoptosis-induced effect, may suppress tumor-blood-vessel growth in liver cancer by the downward modulation vegf expression simultaneously, siRNA (the small interference RNA of research report AFP, siRNA) can induce the retarded growth of Bel7402 Huh7 (referring to Yang X, Zhang Y, Zhang L, Zhang L, Mao J.Silencingalpha-fetoprotein expression induces growth arrest and apoptosis in humanhepatocellular cancer cell.Cancer Lett.2008 Nov 28; 271 (2): 281-93.Epub 2008 Jul26.).The research of seminar of the present invention finds that also AFP-siRNA can suppress the propagation of liver cancer cell SMMC-7721 (referring to WangYS, Ma XL, Qi TG, Liu XD, Meng YS, Guan GJ.Downregulation of alpha-fetoprotein siRNAinhibits proliferation of SMMC-7721 cells.World J Gastroenterol.2005 Oct14; 11 (38): 6053-5.).

Signal transduction and activating transcription factor 3(signal transducer and activator of transcription 3 STAT3) are a kind of bifunctional protein that is present in cytoplasm and the coupling of tyrosine phosphorylation signalling channel.STAT3 is activated in kinds of tumor cells, and continues to be in the high reactivity state.It has inhibited apoptosis, promotes the effect of cell proliferation, has participated in generation, development and the evolution of human malignancies, has been acknowledged as a kind of tumor-related gene.Large quantity research is found, utilizes the dominant negative isomer of antisense nucleic acid, STAT3 and the active and expression of RNAi technology blocking-up STAT3 that growth of tumour cell is suppressed.

RNA disturbs ((RNA interference, RNAi) be discovered in recent years and the Gene silence on transcriptional level that grows up, that a kind of double-stranded RNA (double-stranded RNA, dsRNA) molecule is closed the expression of corresponding sequence gene or made its reticent process in the mRNA level.The RNAi technology has high efficiency, specificity, operation relative simple, effect stability, once can study many-sided advantages such as a plurality of genes.At present, in the treatment research of some virus disease, make some progress, also demonstrating huge application prospect aspect gene functional research and the gene therapy.

Dual-target RNAi is with 2 shRNA different RNA polymerase III promotor (H1+U6) of same plasmid-termination signal structural unit of packing into.Each shRNA is independent effectively to transcribe.Different promotors avoids using single promotor because of the identical restructuring that may cause of sequence, and 2 shRNA act on respectively the different target gene, strengthens the action effect to target cell.

There is no at present about utilizing the RNAi technology will disturb the high efficiency siRNA of STAT3 and AFP gene to be connected on the shRNA expression plasmid, reach simultaneously the dual-target siRNA eukaryon expression plasmid of the efficient gene that suppresses two kinds of overexpressions in tumour and the report of application thereof.

Summary of the invention

For the deficiencies in the prior art, the invention provides dual-target siRNA eukaryon expression plasmid of a kind of STAT3 of inhibition and AFP genetic expression and uses thereof.

Summary of the invention: the present invention is to utilize the RNA interference technique as main, effective target sequences for STAT3 and AFP gene, made up the expression plasmid pGenesil1.5-STAT3-AFP that can in mammalian cell, express simultaneously STAT3 and AFPsiRNA, hereinafter to be referred as pG1.5-SA.Its signal collection of illustrative plates is seen Fig. 1, can suppress efficiently, specifically AFP and STAT3 genetic expression, can be used for preparing the genomic medicine of the AFP positive tumor for the treatment of high expression level STAT3 gene.

The term explanation:

STAT3: English signal transducer and activator of transcription 3 writes a Chinese character in simplified form signal transduction and activating transcription factor 3.

AFP, English alpha-fetoprotein writes a Chinese character in simplified form, alpha-fetoprotein.

SiRNA: English small interference RNA writes a Chinese character in simplified form siRNA

ShRNA: the abbreviation of English short hairpin RNA, short hairpin RNA.

ShRNA comprises that (one is the forward sequence to two short inverted repeats, another is reverse complementary sequence, and both can be combined into two strands, and forward sequence wherein is for interfering target sequence), middle by stem ring (loop) sequence separation, form hairpin structure.So-called inverted repeats refers to that the downstream exists the sequence reverse with the complementary sequence of a certain section sequence in upstream in single polynucleotide chain.

RT-PCR: the abbreviation of English reverse transcription Polymerase Chain Reaction, inverse transcription polymerase chain reaction.

Western blotting:western Western blotting.

MRNA: the abbreviation of English messenger RNA, messenger RNA(mRNA).

CDNA: the abbreviation of English complementary DNA, complementary DNA (cDNA).

DEPC: the abbreviation of English diethypyrocarbonate, diethylpyrocarbonate is a kind of RNA enzyme inhibitors.

MTT: English 3-(4,5)-dimethylthiahiazo (z-y1)-3, the abbreviation of 5-di-phenytetrazoliumromide, tetramethyl-azo azoles salt, the reagent of doing the colorimetric method for determining cell viability commonly used.

Technical scheme of the present invention is as follows:

The dual-target siRNAs eukaryon expression plasmid that suppresses STAT3 and AFP genetic expression, it is characterized in that, take pGenesil1.5 as carrier, utilize dual-target siRNA technology, introduce for STAT3 and the effective shRNA sequence of AFP gene at a shRNA expression plasmid, each sequence has promotor and termination signal and separately independent expression separately, brings into play interference effect in the AFP positive tumor of the STAT3 of high expression level gene, is the therapeutic substance for the AFP positive tumor of expressing the STAT3 gene;

Two inverted repeats of described shRNA sequence are respectively interference target sequence and the reverse complementary sequence thereof of STAT3 or AFP gene;

The interference target sequence of described STAT3, AFP gene is respectively: 1. 5'-GCAACAGATTGCCTGCATTGG-3' originates in 956; 2. 5'-CAGGGAGACATTCATGAAC-3' originates in 508;

The reverse complementary sequence of the interference target sequence of described STAT3, AFP gene is respectively:

5'-CCAATGCAGGCAATCTGTTGC-3'，5'-GTTCATGAATGTCTCCCTG-3'；

The loop sequence of STAT3, AFP gene shRNA expression cassette is respectively: 5'-GGCCGGCGCGC-3', 5'-CGCGCGCGGGCC-3';

Made by following methods:

(1) structure of STAT3 and AFP Gene Double promotor shRNA expression cassette

A. first round PCR: take the plasmid XM-2P that comprises H1 and U6 promotor as template, design PCR primer, partial sequence at 3 ' introducing pcr template plasmid XM-2P, be used for amplification H1 and U6 promoter sequence, and in the upstream and downstream primer, introduce respectively reverse complementary sequence and the loop sequence of the interference target sequence of described STAT3 and AFP gene;

Upstream primer: P1-FW:5 '-GGCCGGCGCGC CCAATGCAGGCAATCTGTTGC GGGAAAGAGTGATC-3 ',

Downstream primer: P1-RV:5 '-CGCGCGCGGGCC GTTCATGAATGTCTCCCTG GGTGTTTCGTCCTTTC-3 ';

B. second take turns PCR: take first round PCR as template; design PCR primer; in the upstream and downstream primer, introduce respectively interference target sequence, rna plymerase iii terminator sequence " AAAAA " and the restriction enzyme HindIII(AAGCTT of described STAT3 and AFP gene), BamHI(GGATCC); cut for the ease of enzyme, added the protectiveness base at two restriction endonucleases, 5 ' end and be respectively " AGT " and " AT ":

Upstream primer: P2-FW:5 '-AGTAAGCTTAAAAA GCAACAGATTGCCTGCATTGG GGCCGGCGCGC CC-3 ',

Downstream primer: P2-RV:5 '-ATGGATCCAAAAA CAGGGAGACATTCATGAAC CGCGCGCGGGCC GT-3 ';

C. pass through above two-wheeled PCR, obtain STAT3 and AFP Gene Double promotor shRNA expression cassette, product structure is: HindIII--shRNA1-H1 promotor-U6 promotor-shRNA2-BamHI.

(2) STAT3 that step (1) is constructed and AFP gene shRNA expression cassette and siRNA expression vector pGenesil1.5 use HindIII, BamHI double digestion simultaneously, produce respectively Insert Fragment and carrier segments, then connect, be transformed at last DH5 α intestinal bacteria, screen through kantlex, select single bacterium colony and cultivate in a large number, extract plasmid DNA purification with plasmid extraction kit; The dual-target siRNAs eukaryon expression plasmid pGenesil1.5-STAT3-AFP of STAT3 and AFP genetic expression is inhibited;

(3) evaluation of plasmid: with the plasmid DNA agarose gel electrophoresis of step (2) extraction, application limitations restriction endonuclease HindIII, BamHI do enzyme and cut evaluation, concentration and the purity of plasmid DNA is measured in the ultraviolet spectrophotometer analysis, and insert the segment order-checking, whether correctly insert in the pGenesil1.5 plasmid to determine STAT3 and AFP gene shRNA expression cassette.

The application of the dual-target siRNA eukaryon expression plasmid of inhibition STAT3 of the present invention and AFP genetic expression in the genomic medicine of the AFP positive tumor of preparation treatment expression STAT3.

For to STAT3, the two siRNA expression plasmids of AFP are to the inhibition of STAT3 and AFP gene and the effect of AFP positive tumor cell is identified, the liposome transfection cell, extract Total RNA (Ribonucleic Acid, RNA), reverse transcription-polymerase chain reaction (reverse transcription Polymerase Chain Reaction, RT-PCR) method is measured STAT3 and AFP messenger RNA(mRNA) (messenger RNA, mRNA) restraining effect of expression level, Western blotting (western blotting) is measured the impact on STAT3 and AFP protein expression level.Tetramethyl-azo azoles salt colorimetry (MTT), immunocytochemistry method detect Ki67 and analyze behind the two siRNA expression plasmids of transfection STAT3, AFP impact on AFP positive tumor cell growing multiplication.

Of the present invention is the AFP positive tumor therapeutants that can be used for high expression level STAT3 for STAT3 and the gene constructed two siRNA expression plasmids of AFP, but the expression of its establishment STAT3 and AFP gene in the AFP of vitro culture positive tumor cell, propagation to tumour cell has significant restraining effect, can further carry out gene therapy research in experimental animals.

Preparation method and the identification of its biological activity of the dual-target siRNA eukaryon expression plasmid of inhibition STAT3 of the present invention and AFP genetic expression mainly comprise following content:

One, the preparation of plasmid, comprise the introducing of two rna plymerase iii promotors (H1+U6), the design ﹠ formulation of dual-gene shRNA expression cassette, two shRNA expression cassette directed clonings of above-mentioned structure are entered carrier pGenesil1.5, transform the extraction of Host Strains, amplification and plasmid DNA, the evaluation of plasmid.

Two, the evaluation of plasmid biologic activity comprises the transfection of plasmid, the calculating of liposome transfection efficient, the expression that RT-PCR detects STAT3 and AFP gene, the impact that western blotting measures STAT3 and AFP protein expression level.MTT, immunocytochemistry method detect Ki67 and analyze behind the two siRNA expression plasmids of transfection STAT3, AFP impact on AFP positive tumor cell growing multiplication.

The below describes the concrete operation method of each step among the preparation method of the present invention in detail:

1, RNA interferes the selection of target sequence and the introducing of two rna plymerase iii (H1+U6) promotors: select the RNAi target sequence through screening, the effective STAT3 of checking and AFP gene, be respectively:

①5'-GCAACAGATTGCCTGCATTGG-3'

②5'-CAGGGAGACATTCATGAAC-3'

Design PCR primer, take the plasmid XM-2P that comprises H1 and U6 promotor as template, amplification H1 and U6 promoter sequence, and in the upstream and downstream primer, introduce respectively reverse complementary sequence and the loop sequence of the interference target sequence of STAT3 and AFP gene: upstream primer: P1-FW:5 '-GGCCGGCGCGCCCAATGCAGGCAATCTGTTGCGGGAAAGAGTGATC-3 ' downstream primer: P1-RV:5 '-CGCGCGCGGGCCGTTCATGAATGTCTCCCTGGGTGTTTCGTCCTTTC-3 ' PCR reaction system:

2.STAT3 and the structure of AFP Gene Double promotor shRNA expression cassette

Gained PCR product is as template in 1, design PCR primer, in the upstream and downstream primer, introduce respectively the interference target sequence of STAT3 and AFP gene and HindIII, BamHI, rna plymerase iii terminator sequence " AAAAA ": upstream primer: P2-FW:5 '-AGTAAGCTTAAAAA GCAACAGATTGCCTGCATTGG GGCCGGCGCGCCC-3 ' downstream primer: P2-RV:5 '-ATGGATCCAAAAA CAGGGAGACATTCATGAAC CGCGCGCGGGCCGT-3 ' reaction system:

Through two-wheeled PCR, finally obtain STAT3 and AFP Gene Double promotor shRNA expression cassette, product structure is: HindIII-shRNA1-H1 promotor-U6 promotor-shRNA2-BamHI.

3, STAT3 and AFP Gene Double promotor shRNA expression cassette directed cloning enter vector plasmid pGenesil1.5

Constructed STAT3 and AFP gene shRNA expression cassette and siRNA expression vector pGenesil1.5 are used HindIII, BamHI double digestion simultaneously, produce respectively Insert Fragment and carrier segments, then connect, be transformed at last DH5 α intestinal bacteria, screen through kantlex, select single bacterium colony and cultivate in a large number, extract plasmid DNA purification with plasmid extraction kit;

The ligation system:

4, the evaluation of plasmid

With the plasmid DNA agarose gel electrophoresis that extracts, application limitations restriction endonuclease HindIII+BamHI does enzyme and cuts evaluation; Concentration and the purity of plasmid DNA are measured in the ultraviolet spectrophotometer analysis, and insert the segment order-checking.

The constructed plasmid identification of its biological activity method of aforesaid method is as follows:

1. the transfection SMMC-7721 cell cultures of liver cancer cell cultivation and plasmid places 37 ℃, 5%CO in the RPMI-1640 that contains 10% new-born calf serum ₂In the incubator.Front 24 hours of transfection, with tumor cell inoculation on 6 well culture plates, every hole approximately 5 * 10 ⁵Individual cell reaches more than 90% every porocyte saturation ratio before transfection, do not use during bed board to contain antibiotic nutrient solution.Behind kind of the plate 24 hours, get plasmid 5 μ g and add 250 μ lopti-MEM nutrient solutions, mixing is pressed Lipofectamine gently ^TM2000 transfection reagent specification sheets methods are carried out transient transfection.Dosage ratio is selected design in its suggested range, divide five groups according to liposome and plasmid proportioning, be respectively the blank group, 4 μ l:2 μ g group, 6 μ l:2 μ g group, 8 μ l:4 μ g group, 10 μ l:4 μ g group, prepare respectively and add 500 μ l transfection composites in liposome/plasmid transfection mixture 6 orifice plates, the culture plate that moves around makes transfection composite fully contact with cell.Behind 37 ℃ of cultivation 6h, add the fresh DMEM that contains 10% new-born calf serum, continue to hatch.48h detects the expression of green fluorescent protein in fluorescent microscope after transfection.

2. the sxemiquantitative RT-PCR of the synthetic and RNA interference effect of the extraction of total RNA, cDNA detects

(1) extracts liver cancer cell SMMC-7721 after total RNA gets transfection, with PBS rinsing 2 times, by 10 ⁶-10 ⁷Individual cell adds the total RNA extraction agent of 1ml Trizol lysing cell, lysate goes to the 1.5ml size without the Ep pipe of RNA enzyme, add 200 μ l chloroforms, thermal agitation 30 seconds, 12000 rev/mins 4 ℃ centrifugal 5 minutes, carefully get supernatant and move to the 1.5ml size without the Ep pipe of RNA enzyme, add and the isopyknic Virahol of supernatant, room temperature place after 5 minutes 12000 rev/mins 4 ℃ centrifugal 5 minutes, carefully abandon supernatant, 70% ethanol (diethylpyrocarbonate (diethypyrocarbonate, DEPC) water preparation) washing precipitation is 2 times, naturally dry under the room temperature, with distilled water (containing 1%DEPC) dissolving, lower continuous reaction.

(2) the RT-PCR test kit of Takara company is used in the synthetic and PCR reaction of complementary DNA (cDNA) (complementary DNA, cDNA), first by 50 ℃ 30 minutes, 99 ℃ 5 minutes, 5 ℃ of steps of 5 minutes are synthesized respectively cDNA, and reaction totally is 10 μ l, comprises MgCI ₂2 μ l, 10X reverse transcription damping fluid 1 μ l, dNTPs mixture 1 μ l, RNA enzyme inhibitors 0.25 μ l, AMV ThermoScript II 0.5 μ l, Oligo dT-primer 0.5 μ l, RNA 4.8 μ l; Then getting cDNA1 μ l increases in the PCR instrument, reaction conditions is 94 ℃ of circulations in 2 minutes, 94 ℃ 30 seconds, 56 ℃ 30 seconds, 72 ℃ of totally 30 circulations in 1 minute, reaction totally is 20 μ l, comprises 5X PCR damping fluid 5 μ l, sterile purified water 9.875 μ l, TaKaRa Ex Taq HS enzyme 0.125 μ l, each is to each 1 μ l of upstream and downstream primer, and confidential reference items β-actin upstream and downstream primer is 1 μ l respectively, cDNA 1 μ l.Pcr amplification product detects through 2% agarose gel electrophoresis.PCR primer sequence following table.

Goal gene PCR primer sequence and expanding fragment length

3.Western the variation of blot checking STAT3, AFP protein expression

(1) culturing cell protein extraction step: take out culturing cell, discard old nutrient solution, ice precooling PBS washes 1 time.Add 1 * SDS sample-loading buffer lysing cell, with the cell sleaker cell is scraped off, and be transferred in the Ep pipe, remain on ice.Shear DNA 10-15 second, reduce the sample viscosity.95～100 ℃ the heating 10 minutes, cooled on ice, centrifugal 11000 rev/mins 4 ℃ 4 minutes.Draw supernatant to 0.5m lEp pipe ,-80 ℃ of preservations.

(2) protein sample electrophoresis step: pour into first the approximately separation gel of 4ml, solidified approximately 30 minutes; Then pour into the approximately concentrated glue of 1ml, solidified approximately 20 minutes.Offset plate is put into electrophoresis chamber, fill it up with electrophoresis liquid.Protein sample is joined in the hole 4 ℃ of 90v voltage electrophoresis 1.5～2 hours.

(3) transferring film step: pvdf membrane is processed: methyl alcohol soaked 10 seconds, and deionized water soaked 5 minutes, and 1 * transfering buffering liquid soaked 15 minutes.(wear gloves when cutting film, prevent the protein contamination film of being infected with on hand)., put well according to the order of three metafiltration paper, gel, pvdf membrane, three metafiltration paper to anodal by negative pole.(size of the size 〉=filter paper of film〉size of glue; Bubble can not appear between each layer), 50 milliamperes of transfers of 4 ℃ of current stabilizations 12～14 hours.

(4) antibody incubation step: wash film with 25ml TBS after the transferring film, room temperature 5 minutes.Room temperature is hatched on the film 1h(shaking table with the sealing damping fluid and is shaken).25ml TBST washed film 3 times * 5 minutes/time.The primary antibodie diluent is hatched 4 ℃ of the slight vibrations of film and is spent the night.TBST washed film 3 times * 5 minutes/time.Two anti-diluent (diluting with confining liquid) incubated at room film 1h of HRP-mark.TBST washed film 3 times * 5 minutes/time.Filter membrane is placed in bottle ware, adds the DAB substrate solution of an amount of fresh configuration, can develop the color in 5-15 minute, water flushing termination reaction is also taken a picture.

4. the proliferation activity of cell changes

(1) tetramethyl-azo azoles salt (MTT) colorimetric method for determining cell viability:

But MTT permeate through cell membranes, mitochondrial dehydrogenase in the viable cell can change it into water-fast formazan particle, dissolves this particle with DMSO, detects absorbancy, because the amount that crystallization forms and cell quantity and metabolic activity are proportional, the height of absorbancy can reflect quantity and the activity of viable cell.Experimentation is as follows: with the MTT solution of PBS preparation 5mg/ml, filtration sterilization, stand-by.According to 1.5x10 ⁴/ hole, inoculation SMMC-7721 cell is in 96 orifice plates, and every hole 200 μ l nutrient solutions place 37 ℃, 5% CO ₂Incubator is cultivated 24h; Liposome method is carried out plasmid DNA transfection, and transfection method as previously mentioned.Be put in incubator after the transfection and continue to cultivate, every experimental group is established 5 multiple holes, carries out the MTT detection after 24,48,72 hours: add the MTT solution of 20 μ l (5g/L), place cell culture incubator to continue to hatch 4 hours; Gentle aspiration also discards the upper strata nutrient solution, adds the DMSO (DMSO) of 150 μ l in every hole again, and the lucifuge vibration is 15 minutes under the room temperature; Enzyme-linked immunosorbent assay instrument is measured the absorbancy of 492nm.

(2) ki-67 immunocytochemistry method is measured cell proliferation:

Ki-67 is the typical nucleoprotein relevant with the cell cycle, can effectively reflect proliferative activity, is regarded as reflecting the objective indicator of cell colony proliferation activity more comprehensively.With logarithmic phase SMMC-7721 cell according to 5 * 10 ⁵The cell density of individual/ml is seeded in six orifice plates that are covered with the sterility cover slide, places 37 ℃, 5%CO ₂Respectively cultivate in the incubator after 24,48 and 72 hours and carefully take out cover glass with tweezers, at room temperature, adopt ki-67 immunocytochemistry method to test.

Constructed plasmid and bioactive qualification result are as follows:

1. plasmid DNA agarose gel electrophoresis result such as Fig. 2 show, and the more visible plasmid DNA of the band of Marker is between 4000-7000bp, and the known plasmid size that builds is about 5.4kb.

2. the plasmid DNA enzyme is cut qualification result such as Fig. 3 shows, after plasmid is done enzyme and is cut with HindIII+BamHI, and two bar segment of product 685bp and 4.7kb.

3. sequencing result has verified that by order-checking (Fig. 4) insertion sequence and constructed STAT3 and AFP Gene Double shRNA expression cassette meet fully, illustrate successfully to have made up pGenesil1.5-STAT3-AFP.

4. the expression of transfection efficiency calculation result 48h fluorescence microscopy Microscopic observation green fluorescent protein after transfection.The result show take liposome/plasmid body ratio during as 2:1 the transfection effect best, and liposome is less to the toxicity of cell, is the proper ratio of plasmid and transfection reagent.

5.RT-PCR after the transfection 48 hours as a result, RT-PCR reaction product agarose gel electrophoresis result as shown in Figure 5, each group is specific band and the confidential reference items β-actin band of visible STAT3, AFP gene all, can find that with the band comparison of empty carrier contrast pG1.5-SA transfection group STAT3, the brightness of AFP gene band all weaken to some extent, inhibiting rate is respectively 51.29%, 26.71%, illustrate this plasmid can the establishment liver cancer cell in the expression of STAT3, AFP gene.

6.Western bloting detects the pG1.5-SA plasmid to affect after the transfection 48 hours of STAT3, AFP protein expression level, extract each experimental group total protein of cell, Western bloting detects, the result shows, can find that with the band comparison of empty carrier contrast pG1.5-SA transfection group STAT3, AFP gene band gray-scale value all weaken to some extent, inhibiting rate is respectively 59.67%, 40.98%, illustrate this plasmid can the establishment liver cancer cell in STAT3, AFP protein expression (see figure 6).

7. the proliferation activity of cell changes detected result

(1) mtt assay detected result: measured respectively each hole A after the transfection at 24,48,72 hours ₄₉₂, averaging in 5 multiple holes, calculates inhibiting rate, inhibiting rate=(1-experimental group A value mean value/control group A value mean value) * 100%, take the time as transverse axis, inhibiting rate is longitudinal axis curve plotting (Fig. 7).As seen STAT3, AFP dual-target siRNA expression plasmid (pG1.5-SA) transfection group are significantly higher than siRNA expression plasmid (pGPU6-STAT3, the pDonor Vector AFP) transfection group of individual gene to the inhibiting rate of SMMC-7721 cell proliferation.

(2) Ki-67 immunocytochemistry method detected result: transfection pG1.5-SA group 24,48h ki-67 fluorescent dye positive cell is starkly lower than control group (Fig. 8).Prompting STAT3, the transfection of AFP dual-target siRNA expression plasmid can significantly suppress the proliferation activity of liver cancer cell SMMC-7721.This may can disturb simultaneously with dual-target siRNA STAT3, the AFP genetic expression of SMMC-7721, these two genes all have the effect that promotes tumor cell proliferation, thereby produce stack or synergy, cause restraining effect to the SMMC-7721 cell-proliferation activity apparently higher than single-gene RNA interference group.

Excellent results of the present invention is as follows:

The present invention is directed to common in the malignant tumour two overexpression gene STAT3 and AFP, select through screening, the effective RNAi target sequence of checking, utilize the RNA perturbation technique successfully to make up dual-target siRNA expression plasmid by two rna plymerase iii promoters driven in conjunction with gene recombination technology, 2 effective RNAi sequences of checking are disturbed corresponding target gene, and tumour cell has been produced synergy.By in the Liver cancer cell SMMC-7721 of the AFP positive, expressing, suppressed specifically the expression of STAT3 and AFP gene, with the shRNA expression plasmid comparison of a kind of gene of independent inhibition, to reach the purpose of more effectively treating the AFP positive tumor.

1. the simultaneously expression of establishment STAT3 and AFP gene of the STAT3 that makes up of the present invention and AFP Gene Double target siRNA eukaryon expression plasmid.Mainly have the following advantages: 1. this plasmid can increase in bacillus coli DH 5 alpha in a large number, can constantly obtain to express the plasmid of siRNAs; 2. selected through this laboratory screening and confirmed, to STAT3 and the higher target site of AFP gene inhibition efficient; 3. safe, dangerous without insertion mutation, also react without immunotoxicity.

2. the specificity dual-target siRNA expression plasmid of the present invention's structure is for STAT3 and AFP gene, respectively by the independently expression of rna plymerase iii promotor startup shRNA, can avoid interfering with each other, to guarantee the siRNA effective expression of two genes, more significant inhibition is played in the expression of two genes.

3. the present invention has realized STAT3 and AFP gene siRNA are expressed in a plasmid simultaneously, and behind the transfectional cell, can reach compares with the siRNA plasmid of independent transfection term single gene suppresses the effect of cell proliferation more significantly.On the other hand, disturb simultaneously two genetic expressions in order to reach, two siRNA expression plasmids can be less to the toxicity of cell than two single siRNA expression plasmid cotransfections, and interfering with each other of two genetic expressions can be less, and operability is stronger.

The dual-target siRNA expression plasmid that the present invention is directed to STAT3 and AFP gene is the therapeutant that can be used for the AFP positive tumor of high expression level STAT3, significantly inhibition tumor cell propagation.

Description of drawings

Fig. 1 is pGenesil1.5-STAT3-AFP plasmid physical map.

Fig. 2 is plasmid DNA agarose gel electrophoresis figure: 1. Marker (DL10000); 2. pGenesil1.5-Stat3-AFP plasmid

Fig. 3 is that enzyme is cut evaluation figure: 1. Marker (DL2000); 2. 3. pGenesil1.5-Stat3-AFP of pGenesil1.5-Stat3-AFP HindIII/BamHI; 4. Marker (DL10000).

Fig. 4 is the Insert Fragment gene sequencing figure of pGenesil1.5-Stat3-AFP plasmid: A:STAT3-shRNA expression cassette sequencer map; B:AFP-shRNA expression cassette sequencer map.

Fig. 5 is that RT-PCR detects the restraining effect that transfection pGenesil1.5-Stat3-AFP expressed SMMC-7721 cell Stat3, AFPmRNA after 48 hours, 1. empty carrier control group; 2. pGenesil1.5-Stat3-AFP transfection group.

Fig. 6 is that Western bloting detects transfection the pGenesil1.5-Stat3-AFP restraining effect to SMMC-7721 cell Stat3, AFP protein expression, 1. empty carrier control group after 48 hours; 2. pGenesil1.5-Stat3-AFP transfection group.

Fig. 7 is that mtt assay is measured behind the different plasmids of transfection the restraining effect to SMMC-7721 cell proliferation.

Fig. 8 is that ki-67 immunocytochemistry method is measured behind the different plasmids of transfection the restraining effect to SMMC-7721 cell proliferation.By being successively from left to right: pGPU6-STAT3 transfection group, pDonor Vector AFP transfection group, pGenesil1.5-Stat3-AFP transfection group.

Embodiment

The invention will be further described below in conjunction with embodiment, but be not limited only to this.

One, main agents

1. carrier pGenesil1.5 is available from Wuhan wash rice agate company;

2. engineering bacteria DH5 α is available from promega company;

3.T4 ligase enzyme is purchased from NEW ENGLAND company; The extraction of plasmid and purification kit (QIAprep Spin Miniprep Kit) are available from QIAGEN company

4.PCR primer is synthetic and determined dna sequence (Nanjing Genscript Biotechnology Co., Ltd.)

5. transfection reagent Lipofectamine 2000, TRizol Reagent are available from Invitrogen company

6.RT-PCR test kit RNA PCR Kit(AMV) Ver.3.0, restriction enzyme HindIII, BamHI, DNA Marker is available from Takara company

7. dye in advance albumen marker and be purchased from Fermentas company;

8.MTT reagent is available from sigma company;

9. the goat anti-rabbit igg antibody of the anti-Ki-67 antibody of rabbit, FITC mark is available from epitomics company.

Two, key instrument

1. ultraviolet spectrophotometer (GeneQuant Pro): Amersham Biosciences;

2. gel imaging system (ChemilmagerTM 4400): Alpha Innotech;

3. Biohazard Safety Equipment (Hfsafe1200): power Shen, Shanghai scientific instrument company;

4. CO2gas incubator (HF90): power Shen, Shanghai scientific instrument company;

5. fluorescent microscope (ECLIPSE TE 2000-S): Nikon;

6.CCD(penguin150CL): U.S. pixera company;

7. tabletop refrigerated centrifuge (TGL-16G): Anting Scientific Instrument Factory, Shanghai;

8.PCR instrument (PE7300): ABI company;

9. full-automatic microplate reader (Model 680): Bio-Rad company.

Three, the preparation method of plasmid and identification of its biological activity thereof

1, RNA interferes the selection of target sequence and the introducing of two rna plymerase iii (H1+U6) promotors: select the RNAi target sequence through screening, the effective STAT3 of checking and AFP gene, be respectively:

①5'-GCAACAGATTGCCTGCATTGG-3'

②5'-CAGGGAGACATTCATGAAC-3'

The reverse complementary sequence of the RNAi target sequence of described STAT3 and AFP gene is respectively:

5'-CCAATGCAGGCAATCTGTTGC-3' and 5'-GTTCATGAATGTCTCCCTG-3';

The loop sequence of STAT3, AFP gene shRNA expression cassette is respectively 5'-GGCCGGCGCGC-3' and 5'-CGCGCGCGGGCC-3';

Design PCR primer, take the plasmid XM-2P that comprises H1 and U6 promotor as template, amplification H1 and U6 promoter sequence, and in the upstream and downstream primer, introduce respectively reverse complementary sequence and the loop sequence of the interference target sequence of STAT3 and AFP gene:

Upstream primer: P1-FW:5 '-GGCCGGCGCGCCCAATGCAGGCAATCTGTTGCGGGAAAGAGTGATC-3 '

Downstream primer: P1-RV:5 '-CGCGCGCGGGCCGTTCATGAATGTCTCCCTGGGTGTTTCGTCCTTTC-3 '

The PCR reaction system:

2.STAT3 and the structure of AFP Gene Double promotor shRNA expression cassette

Gained PCR product is as template in the above-mentioned steps 1, design PCR primer, in the upstream and downstream primer, introduce respectively the interference target sequence of STAT3 and AFP gene and HindIII, BamHI, rna plymerase iii terminator sequence " AAAAA ": upstream primer: P2-FW:5 '-AGTAAGCTTAAAAA GCAACAGATTGCCTGCATTGG GGCCGGCGCGCCC-3 ', downstream primer: P2-RV:5 '-ATGGATCCAAAAA CAGGGAGACATTCATGAAC CGCGCGCGGGCCGT-3 ', reaction system:

Through two-wheeled PCR, finally obtain STAT3 and AFP Gene Double promotor shRNA expression cassette, product structure is: HindIII--shRNA1-H1 promotor-U6 promotor-shRNA2-BamHI.

3, STAT3 and AFP Gene Double promotor shRNA expression cassette directed cloning enter vector plasmid pGenesil1.5

Constructed STAT3 and AFP gene shRNA expression cassette and siRNA expression vector pGenesil1.5 are used HindIII, BamHI double digestion simultaneously, produce respectively Insert Fragment and carrier segments, then connect, be transformed at last DH5 α intestinal bacteria, screen through kantlex, select single bacterium colony and cultivate in a large number, extract plasmid DNA purification with plasmid extraction kit;

The ligation system:

4, transform

1. get competent cell DH5 α, melted on ice 10 minutes.

2. add and connect product 5 μ l mixings, placed on ice 30 minutes, shook gently the EP pipe every 5 minutes.

3. placed 30 seconds in 42 ℃ of water-baths, do not rock.Take out rapidly and place ice, left standstill 2 minutes.

4. the LB substratum that adds 37 ℃ of preheatings of 250 μ l, 37 ℃ of joltings (approximately 225 turn) are about 1 hour.

5. get different volumes bacterium liquid (50 μ l-200 μ l) and coat on the LB flat board that contains kantlex (final concentration is 30 μ g/ml), cultivated 12-16 hour for 37 ℃.

5, positive recombinant increases and separation and purification in a small amount

1. select 5 of mono-clonal bacterium colonies in the above-mentioned LB flat board that contains kantlex, be seeded in separately in the LB nutrient solution that 4ml contains kantlex 37 ℃ of joltings (approximately 170 rev/mins) 14-16 hour.

2. every pipe is got 1ml bacterium liquid and is sent Nanjing Genscript Biotechnology Co., Ltd. to carry out Insert Fragment order-checking.Preserve remaining bacterium liquid with glycerine in addition, put-80 ℃ and save backup.

3. take out the correct bacterial classification of order-checking, streak inoculation is containing on the LB flat board of kantlex, hatches 14-16 hour for 37 ℃.Choose single colony inoculation and contain in the LB liquid nutrient medium of penbritin at 4ml, 37 ℃ of joltings (approximately 170 rev/mins) 14-16 hour.

4. a small amount of of plasmid is extracted: get 3ml bacterium liquid and extract plasmid by QIAprep Spin Miniprep Kit (QIAGEN) specification sheets.

A collects in bacterium liquid and the centrifuge tube, centrifugal 5 minutes of lower 10000 rev/mins of room temperature; Collect thalline, be resuspended in the cell suspending liquid P1 of 250 μ l;

B adds 250 μ l alkaline lysis liquid P2, covers tightly the mouth of pipe, puts upside down rotating centrifugal pipe 4-6 time with mixing, and room temperature left standstill 5 minutes;

C adds 350 μ l damping fluid N3, and gentleness is put upside down centrifuge tube 5-10 time immediately, centrifugal 10 minutes of lower 13000 rev/mins of room temperature;

D carefully moves into adsorption column with supernatant liquor, and centrifugal 1 minute of lower 10000 rev/mins of room temperature is outwelled the liquid of collection tube, and adsorption column is put in the same collection tube;

E adds 750 μ l washings PE in adsorption column, centrifugal 1 minute of 10000 rev/mins of room temperatures are outwelled liquid in the collection tube, repeated washing one time;

F outwells liquid in the collection tube, and adsorption column is put into same collection tube.Centrifugal 1 minute of 10000 rev/mins of room temperatures are removed residual washing lotion;

G puts into a clean 1.5ml centrifuge tube with adsorption column, and central authorities add 50 μ l elutriant EB at adsorption film, leave standstill centrifugal 1 minute of room temperature 1 minute;

The h plasmid is kept at-70 ℃

6, the evaluation of plasmid DNA

1. agargel electrophoresis analysis: prepare 1% sepharose (containing 0.5 μ g/ml ethidium bromide), get 2 μ l plasmid DNA and carry out electrophoresis, the plasmid DNA of Detection and Extraction.

2. application limitations restriction endonuclease HindIII+BamHI does enzyme and cuts evaluation.It is as follows that enzyme is cut system:

37 ℃ of enzymes were cut 2 hours.

3. ultraviolet spectrophotometer analysis: get 1 μ l plasmid DNA and dilute with 69 μ l ultrapure waters, under automatic ultraviolet spectrophotometer, detect the light absorption value at A260nm and A280nm place, to measure concentration and the purity of plasmid DNA.

7, the transfection SMMC-7721 cell cultures of liver cancer cell cultivation and plasmid places 37 ℃, 5%CO in containing the RPMI-1640 substratum of 10% new-born calf serum ₂In the incubator.Front 24 hours of transfection, with tumor cell inoculation on 6 well culture plates, every hole approximately 5 * 10 ⁵Individual cell reaches more than 90% every porocyte saturation ratio before transfection, do not use during bed board to contain antibiotic nutrient solution.Behind kind of the plate 24 hours, get plasmid 5 μ g and add 250 μ lopti-MEM substratum, mixing is pressed Lipofectamine gently ^TM2000 transfection reagents (Invitrogen) specification sheets method is carried out transient transfection.Dosage ratio is selected design in its suggested range, divide five groups according to liposome and plasmid proportioning, be respectively the blank group, 4 μ l:2 μ g group, 6 μ l:2 μ g group, 8 μ l:4 μ g group, 10 μ l:4 μ g group, prepare respectively and add 500 μ l transfection composites in liposome/plasmid transfection mixture 6 orifice plates, the culture plate that moves around makes transfection composite fully contact with cell.Behind 37 ℃ of cultivation 6h, add the fresh DMEM nutrient solution that contains 10% new-born calf serum, continue to hatch.After transfection, detected the expression of green fluorescent protein in 48 hours in fluorescent microscope.

8, the sxemiquantitative RT-PCR of the synthetic and RNA interference effect of the extraction of total RNA, cDNA detects

(1) extracts liver cancer cell SMMC-7721 after total RNA gets transfection, with PBS rinsing 2 times, by 10 ⁶-10 ⁷Individual cell adds 1ml Trizol (Invitrogen) lysing cell, lysate goes to the Ep pipe of 1.5ml size RNase-free (without the RNA enzyme), add 200 μ l chloroforms, thermal agitation 30 seconds, 12000 rev/mins 4 ℃ centrifugal 5 minutes, carefully get the Ep pipe that supernatant moves to 1.5ml size RNase-free, add and the isopyknic Virahol of supernatant, room temperature place after 5 minutes 12000 rev/mins 4 ℃ centrifugal 5 minutes, carefully abandon supernatant, 70% ethanol (preparation of DEPC water) washing precipitation 2 times is dried under the room temperature naturally, with distilled water (containing 1%DEPC) dissolving, lower continuous reaction.

(2) the RT-PCR test kit of Takara company is used in the synthetic and PCR reaction of cDNA, first by 50 ℃ 30 minutes, 99 ℃ 5 minutes, 5 ℃ of steps of 5 minutes are synthetic cDNA respectively, reaction totally is 10 μ l, comprises MgCl ₂2 μ l, 10X reverse transcription damping fluid 1 μ l, dNTPs mixture 1 μ l, RNA enzyme inhibitors 0.25 μ l, AMV ThermoScript II 0.5 μ l, Oligo dT primer 0.5 μ l, RNA 4.8 μ l; Then getting cDNA 1 μ l increases in PCR instrument (PE7300), reaction conditions is 94 ℃ of circulations in 2 minutes, 94 ℃ 30 seconds, 56 ℃ 30 seconds, 72 ℃ of totally 30 circulations in 1 minute, reaction totally is 20 μ l, comprises 5X PCR damping fluid 5 μ l, sterile purified water 9.875 μ l, TaKaRa Ex Taq HS enzyme 0.125 μ l, each 1 μ l of upstream and downstream primer, each 1 μ l of confidential reference items β-actin upstream and downstream primer, cDNA 1 μ l.Pcr amplification product detects through 2% agarose gel electrophoresis.PCR primer sequence following table.

Goal gene PCR primer sequence and expanding fragment length

9, the variation of Western bloting checking STAT3, AFP protein expression

(1) culturing cell protein extraction step: take out culturing cell, discard old nutrient solution, ice precooling PBS washes 1 time.Add 1 * SDS sample-loading buffer lysing cell, with the cell sleaker cell is scraped off, and be transferred in the Ep pipe, remain on ice.Shear DNA 10-15 second, reduce the sample viscosity.95～100 ℃ were heated cooled on ice, 4 ℃ centrifugal 11000 rev/mins, 4 minutes 10 minutes.Draw in supernatant to the 0.5 milliliter Ep pipe-80 ℃ of preservations.

(2) protein sample electrophoresis step: pour into first the approximately separation gel of 4ml, solidified approximately 30 minutes; Then pour into the approximately concentrated glue of 1ml, solidified approximately 20 minutes.Offset plate is put into electrophoresis chamber, fill it up with electrophoresis liquid.Protein sample is joined in the hole 4 ℃ of 90v voltage electrophoresis 1.5～2 hours.

(3) transferring film step: pvdf membrane is processed: methyl alcohol soaked 10 seconds, and deionized water soaked 5 minutes, and 1 * transfering buffering liquid soaked 15 minutes.Wear gloves when cutting film, prevent the protein contamination film of being infected with on hand., put well according to the order of three metafiltration paper, gel, pvdf membrane, three metafiltration paper to anodal by negative pole.The size of the size 〉=filter paper of film〉size of glue; Between each layer bubble can not appear, 50 milliamperes of transfers of 4 ℃ of current stabilizations 12～14 hours.

(4) antibody incubation step: wash film with 25ml TBS after the transferring film, room temperature 5 minutes.Room temperature is hatched film 1 hour (shaking on the shaking table) with the sealing damping fluid.25ml TBST washing lotion was washed film 3 times * 5 minutes/time.The primary antibodie diluent is hatched 4 ℃ of the slight vibrations of film and is spent the night.TBST washes film 3 times * 5min/ time.Two anti-diluent (diluting with confining liquid) incubated at room film 1h of HRP-mark.TBST washes film 3 times * 5min/ time.Filter membrane is placed in bottle ware, adds the DAB substrate solution of an amount of fresh configuration, can develop the color in 5-15 minute, water flushing termination reaction is also taken a picture.

10, the proliferation activity of cell changes detection

(1) MTT colorimetric method for determining cell viability:

1) PBS is made into the MTT solution of 5mg/ml, 0.22 μ l filter filtration sterilization.Be inoculated in the SMMC-7721 cell DMEM substratum that contains 10% new-born calf serum in the culturing bottle, 37 ℃, 5%CO ₂Cultivate, the next day change liquid, treat that cell is long during to 80-90%, PBS washes cell twice, uses trypsin digestion and cell, according to 1.5x10 again ⁴/ hole is inoculated in 96 orifice plates, and every hole 200 μ l contain 10% new-born calf serum in the nutrient solution, place 37 ℃, 5% CO ₂Incubator was cultivated 24 hours;

2) next day, add corresponding transfection reagent mixture according to the unloaded group of pGPU6-STAT3 transfection group, pDonor Vector AFP transfection group, pGenesil1.5-Stat3-AFP transfection group and pGenesil1.5 and carry out transfection in 96 orifice plates, transfection method as previously mentioned.Be put in incubator after the transfection and continue to cultivate, every experimental group is established 5 multiple holes, carries out the MTT detection after after the transfection 24,48,72 hours;

3) each experimental group adds the MTT solution of 20 μ l by design time, places cell culture incubator to continue to hatch 4 hours;

4) gentle aspiration and discard the upper strata nutrient solution adds the DMSO of 150 μ l again in every hole, the lucifuge vibration is 15 minutes under the room temperature;

5) absorbancy (A) of mensuration wavelength 492nm light on the enzyme-linked immunosorbent assay instrument is calculated and is respectively organized appreciation rate;

6) above experiment triplicate is averaged.

(2) ki-67 immunocytochemistry method

With SMMC-7721 in logarithmic phase according to 5 * 10 ⁵The cell density of individual/ml is seeded in six orifice plates that are covered with the sterility cover slide, places 37 ℃, 5%CO ₂Respectively cultivate in the incubator after 24,48 and 72 hours and carefully take out cover glass with tweezers, at room temperature, adopt ki-67 immunocytochemistry method to test.Step is as follows:

1) cover glass is taken out with tweezers are careful after, with TBST flush cover slide twice gently, avoid firmly flushing with the cell flake;

2) 20% Paraformaldehyde 96 is dripped on cover glass, cover cell fully with fixed cell 20 minutes;

3) carefully wash cell surface 3 times with 1xPBST;

4) the penetrating cell of 0.1%Triton-X100 is 5 minutes;

5) wash cell twice with the 1xPBST washing lotion.

6) will link antibody and be diluted to suitable concn with antibody diluent;

7) antibody is added drop-wise on the cell of cover glass, the room temperature lucifuge was hatched 1 hour;

8) with PBST washing lotion flushing 3 times;

9) with DAPI fluorescence dye room temperature lucifuge dyeing 5 minutes;

10) PBST flushing cell is 3 times;

11) use the neutral gum mounting, keep in Dark Place.

Four, result

1. plasmid DNA agarose gel electrophoresis result such as Fig. 2 show, and the more visible plasmid DNA of the band of Marker is between 4000-7000bp, and the known plasmid size that builds is about 5.4kb.

2. the plasmid DNA enzyme is cut qualification result such as Fig. 3 shows, after plasmid is cut with the HindIII+BamHI enzyme, obtains two bar segment of product 685bp and 4.7kb.

3. sequencing result has verified that by order-checking (Fig. 4) insertion sequence and STAT3 and AFP Gene Double shRNA expression cassette that we make up meet fully, illustrate successfully to have made up pGenesil1.5-STAT3-AFP.

4. transfection efficiency calculation result expression at fluorescence microscopy Microscopic observation green fluorescent protein in 48 hours after transfection.The result show take liposome/plasmid ratio during as 2:1 the transfection effect best, and liposome is less to the toxicity of cell, is the proper ratio (figure is slightly) of plasmid and transfection reagent.

5.RT-PCR after the transfection 48 hours as a result, RT-PCR reaction product agarose gel electrophoresis result as shown in Figure 5, each group is specific band and the confidential reference items β-actin band of visible STAT3, AFP gene all, can find that with the band comparison of empty carrier contrast pG1.5-SA transfection group STAT3, the brightness of AFP gene band all weaken to some extent, inhibiting rate is respectively 51.29%, 26.71%, illustrate this plasmid can the establishment liver cancer cell in the expression of STAT3, AFP gene.

6.Western bloting detects the pG1.5-SA plasmid to affect after the transfection 48 hours of STAT3, AFP protein expression level, extract each experimental group total protein of cell, Western bloting detects, the result shows, can find that with the band comparison of empty carrier contrast pG1.5-SA transfection group STAT3, AFP gene band gray-scale value all weaken to some extent, inhibiting rate is respectively 59.67%, 40.98%, illustrate this plasmid can the establishment liver cancer cell in STAT3, AFP protein expression (see figure 6).

7. the proliferation activity of cell changes detected result

(1) mtt assay detected result: measured respectively each hole A after the transfection at 24,48,72 hours ₄₉₂, averaging in 5 multiple holes, calculates inhibiting rate, inhibiting rate=(1-experimental group A value mean value/control group A value mean value) * 100%, take the time as transverse axis, inhibiting rate is longitudinal axis curve plotting (Fig. 7).As seen STAT3, AFP dual-target siRNA expression plasmid (pG1.5-SA) transfection group are significantly higher than siRNA expression plasmid (pGPU6-STAT3, the pDonor Vector AFP) transfection group of individual gene to the inhibiting rate of SMMC-7721 cell proliferation.

(2) Ki-67 immunocytochemistry method detected result: transfection pG1.5-SA group 24,48h ki-67 fluorescent dye positive cell is starkly lower than control group (Fig. 8).Prompting STAT3, the transfection of AFP dual-target siRNA expression plasmid can significantly suppress the proliferation activity of liver cancer cell SMMC-7721.This may can disturb simultaneously with dual-target siRNA STAT3, the AFP genetic expression of SMMC-7721, these two genes all have the effect that promotes tumor cell proliferation, thereby produce stack or synergy, cause restraining effect to the SMMC-7721 cell-proliferation activity apparently higher than single-gene RNA interference group.

Claims (2)

1. the dual-target siRNAs eukaryon expression plasmid that suppresses STAT3 and AFP genetic expression, it is characterized in that, take pGenesil1.5 as carrier, utilize dual-target siRNA technology, introduce for STAT3 and the effective shRNA sequence of AFP gene at a shRNA expression plasmid, each sequence has promotor and termination signal and separately independent expression separately, brings into play interference effect in the AFP positive tumor of the STAT3 of high expression level gene, is the therapeutic substance for the AFP positive tumor of expressing the STAT3 gene;

Two inverted repeats of described shRNA sequence are respectively interference target sequence and the reverse complementary sequence thereof of STAT3 or AFP gene;

The interference target sequence of described STAT3, AFP gene is respectively: 1. 5'-GCAACAGATTGCCTGCATTGG-3' originates in 956; 2. 5'-CAGGGAGACATTCATGAAC-3' originates in 508;

The reverse complementary sequence of the interference target sequence of described STAT3, AFP gene is respectively:

5'-CCAATGCAGGCAATCTGTTGC-3'，5'-GTTCATGAATGTCTCCCTG-3'；

The loop sequence of STAT3, AFP gene shRNA expression cassette is respectively: 5'-GGCCGGCGCGC-3',

5'-CGCGCGCGGGCC-3'；

Made by following methods:

(1) structure of STAT3 and AFP Gene Double promotor shRNA expression cassette

A. first round PCR: take the plasmid XM-2P that comprises H1 and U6 promotor as template, design PCR primer, partial sequence at 3 ' introducing pcr template plasmid XM-2P, be used for amplification H1 and U6 promoter sequence, and in the upstream and downstream primer, introduce respectively reverse complementary sequence and the loop sequence of the interference target sequence of described STAT3 and AFP gene;

Upstream primer: P1-FW:5 '-GGCCGGCGCGC CCAATGCAGGCAATCTGTTGC GGGAAAGAGTGATC-3 ',

Downstream primer: P1-RV:5 '-CGCGCGCGGGCC GTTCATGAATGTCTCCCTG GGTGTTTCGTCCTTTC-3 ';

B. second take turns PCR: take first round PCR as template; design PCR primer; in the upstream and downstream primer, introduce respectively interference target sequence, rna plymerase iii terminator sequence " AAAAA " and the restriction enzyme HindIII(AAGCTT of described STAT3 and AFP gene), BamHI(GGATCC); cut for the ease of enzyme, added the protectiveness base at two restriction endonucleases, 5 ' end and be respectively " AGT " and " AT ":

Upstream primer: P2-FW:5 '-AGTAAGCTTAAAAA GCAACAGATTGCCTGCATTGG GGCCGGCGCGC CC-3 ',

Downstream primer: P2-RV:5 '-ATGGATCCAAAAA CAGGGAGACATTCATGAAC CGCGCGCGGGCC GT-3 ';

C. pass through above two-wheeled PCR, obtain STAT3 and AFP Gene Double promotor shRNA expression cassette, product structure is: HindIII--shRNA1-H1 promotor-U6 promotor-shRNA2-BamHI.

(2) STAT3 that step (1) is constructed and AFP gene shRNA expression cassette and siRNA expression vector pGenesil1.5 use HindIII, BamHI double digestion simultaneously, produce respectively Insert Fragment and carrier segments, then connect, be transformed at last DH5 α intestinal bacteria, screen through kantlex, select single bacterium colony and cultivate in a large number, extract plasmid DNA purification with plasmid extraction kit; The dual-target siRNAs eukaryon expression plasmid pGenesil1.5-STAT3-AFP of STAT3 and AFP genetic expression is inhibited;

(3) evaluation of plasmid: with the plasmid DNA agarose gel electrophoresis of step (2) extraction, application limitations restriction endonuclease HindIII, BamHI do enzyme and cut evaluation, concentration and the purity of plasmid DNA is measured in the ultraviolet spectrophotometer analysis, and insert the segment order-checking, whether correctly insert in the pGenesil1.5 plasmid to determine STAT3 and AFP gene shRNA expression cassette.

2. the application of the dual-target siRNA eukaryon expression plasmid of the inhibition STAT3 of claim 1 and AFP genetic expression in the genomic medicine of the AFP positive tumor of preparation treatment expression STAT3.

Images