CN103031334B - Dual-target siRNA eukaryotic expression plasmid capable of inhibiting STAT3 and AFP gene expression, and application of expression plasmid - Google Patents
Dual-target siRNA eukaryotic expression plasmid capable of inhibiting STAT3 and AFP gene expression, and application of expression plasmid Download PDFInfo
- Publication number
- CN103031334B CN103031334B CN201210488901.0A CN201210488901A CN103031334B CN 103031334 B CN103031334 B CN 103031334B CN 201210488901 A CN201210488901 A CN 201210488901A CN 103031334 B CN103031334 B CN 103031334B
- Authority
- CN
- China
- Prior art keywords
- stat3
- afp
- plasmid
- expression
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a dual-target siRNA eukaryotic expression plasmid capable of inhibiting STAT3 and AFP gene expression, and the application of the expression plasmid. Mainly based on the RNA interference technology, directing at the target sequence of AFP and STAT3 genes with abnormal high expression in tumor, a plasmid pGenesil1.5-STAT3-AFP capable of simultaneously expressing STAT3 and AFP SiRNA in eukaryotic cells is built. The dual-target siRNA eukaryotic expression plasmid can efficiently and specifically inhibit the STAT3 and AFP gene expression of tumor cells, and can be used for preparing the gene medicines for the treatment on AFP positive tumors expressing the STAT3.
Description
Technical field
The present invention relates to dual-target siRNA eukaryon expression plasmid suppressing STAT3 and AFP genetic expression and uses thereof, belong to biological medicine technology field.
Background technology
Alpha-fetoprotein (alpha-fetoprotein, AFP) is a kind of glycoprotein being produced by liver, yolk sac embryonic stage, after birth, sharply reduces.When there is liver neoplasm, some gastroenteric tumor and some genital system tumor, serum afp raises again again.AFP has vital role as a kind of generally acknowledged tumor markers in the diagnosis of tumour at present.Nearly 80% liver cancer patient blood serum AFP raises, and is one of conventional inspection item of diagnosing primary liver cancer.50% the germinoma of having an appointment occurs that AFP is positive, in other enterogastric tube tumour, also can occur rising in various degree as patients such as carcinoma of the pancreas or lung cancer and liver cirrhosis.Wherein AFP positive gastric carcinoma sickness rate accounts for the 5.1%-15% of cancer of the stomach, and this malignancy is high, has morphocytology as liver cancer, easily liver metastasis and early stage lymphatic metastasis, and aggressive is strong, the feature of poor prognosis.
Recent study finds that AFP has vital role in the developing of tumour: (1) immunoregulatory activity: AFP can suppress the antigen-reactive that NK cytoactive and T lymphocyte rely on, the generation of suppressor inducer T lymphocyte, lower the MHC-II quasi-molecule of onthe surface of monocytes, and suppress the cytotoxic effect of tumour necrosis factor to tumour cell; AFP can also reduce the expression of liver cancer cell death receptor, makes it to escape lymphocytic attack.(2) promote tumor cell proliferation: experimental results show that, AFP has direct proliferation to human hepatoma HepG2 cell, H22 cell and Ehrlich ascites cells and Cervical Cancer HeLa Cells, with AFP(20mg/L) stimulate human liver cancer cell Bel 7402 to find c-fos, the mRNA amount of c-jun and N-ras raises, illustrate that AFP can stimulate some oncogene expressions relevant with differentiation with cell proliferation, thereby promote tumor cell proliferation.Prompting AFP may be the autocrine protein that important endogenous is urged tumor cell proliferation.(3) participate in apoptosis of tumor cells process: thus studies have reported that AFP is by stoping apoptosis of tumor cells with AFP receptors bind.Separately there is research to think that AFP can be apoptosis-induced by activation caspase3 in tumour cell.
AFP is as a kind of embryo period or the synthetic protein of pathological state, and it is accompanied by fetal development and the vigorous process of cell fission, is not only a kind of satellite phenomenon in tumor development process, and is the endogenous material that promotes growth of tumour cell.This effect can be blocked by AFP monoclonal antibody.The medicine and the method that suppress AFP genetic expression will affect the propagation of tumour cell, thereby reach the object of antineoplaston.Therefore, the expression of blocking-up AFP gene and biologic activity thereof are likely new strategies of a treatment and AFP related neoplasms in conjunction with other treatment means simultaneously.
The inventor's studies confirm that in AFP positive gastric carcinoma, utilize RNAi technology to suppress AFP expression AFP positive gastric carcinoma cell FU97 is had to propagation inhibition and apoptosis-induced effect, may suppress tumor-blood-vessel growth in liver cancer by lowering vegf expression simultaneously, siRNA (the small interference RNA of research report AFP, siRNA) can induce the retarded growth of Bel7402 Huh7 (referring to Yang X, Zhang Y, Zhang L, Zhang L, Mao J.Silencingalpha-fetoprotein expression induces growth arrest and apoptosis in humanhepatocellular cancer cell.Cancer Lett.2008 Nov 28, 271 (2): 281-93.Epub 2008 Jul26.).The research of seminar of the present invention also finds that propagation that AFP-siRNA can suppress liver cancer cell SMMC-7721 is (referring to WangYS; Ma XL; Qi TG; Liu XD; Meng YS, Guan GJ.Downregulation of alpha-fetoprotein siRNAinhibits proliferation of SMMC-7721 cells.World J Gastroenterol.2005 Oct14; 11 (38): 6053-5.).
Signal transduction and activating transcription factor 3(signal transducer and activator of transcription 3, STAT3) be a kind of bifunctional protein that is present in cytoplasm and the coupling of tyrosine phosphorylation signalling channel.STAT3 is activated in kinds of tumor cells, and continues in high reactivity state.It has inhibited apoptosis, promotes the effect of cell proliferation, has participated in generation, development and the evolution of human malignancies, has been acknowledged as a kind of tumor-related gene.Large quantity research is found, utilizes the dominant negative isomer of antisense nucleic acid, STAT3 and the active and expression of RNAi technology blocking-up STAT3 can make growth of tumour cell be suppressed.
RNA disturbs ((RNA interference, RNAi) be discovered in recent years and the Gene silence on transcriptional level growing up, that a kind of double-stranded RNA (double-stranded RNA, dsRNA) molecule is closed the expression of corresponding sequence gene or made its reticent process in mRNA level.RNAi technology has that high efficiency, specificity, operation are relatively easy, effect stability, once can study many-sided advantages such as a plurality of genes.At present, in the treatment research of some virus disease, make some progress, aspect gene functional research and gene therapy, also demonstrating huge application prospect.
Dual-target RNAi packs 2 shRNA into different RNA polymerase III promotor (the H1+U6)-termination signal structural unit of same plasmid.Each shRNA is independent effectively to transcribe.Different promotors avoids using single promotor because of the identical restructuring that may cause of sequence, and 2 shRNA act on respectively different target gene, strengthens the action effect to target cell.
There is no at present about utilizing RNAi technology that the high efficiency siRNA that disturbs STAT3 and AFP gene is connected on a shRNA expression plasmid, reaches simultaneously the dual-target siRNA eukaryon expression plasmid of the efficient gene that suppresses two kinds of overexpressions in tumour and the report of application thereof.
Summary of the invention
For the deficiencies in the prior art, the invention provides dual-target siRNA eukaryon expression plasmid of a kind of STAT3 of inhibition and AFP genetic expression and uses thereof.
Summary of the invention: the present invention be take and utilized RNA interference technique as main, effective target sequences for STAT3 and AFP gene, built the expression plasmid pGenesil1.5-STAT3-AFP that can simultaneously express STAT3 and AFPsiRNA in mammalian cell, hereinafter to be referred as pG1.5-SA.Fig. 1 is shown in by its signal collection of illustrative plates, can suppress efficiently, specifically AFP and STAT3 genetic expression, can be used for the genomic medicine of the AFP positive tumor of preparation treatment high expression level STAT3 gene.
Term explanation:
STAT3: English signal transducer and activator of transcription 3 writes a Chinese character in simplified form, signal transduction and activating transcription factor 3.
AFP, English alpha-fetoprotein writes a Chinese character in simplified form, alpha-fetoprotein.
SiRNA: English small interference RNA writes a Chinese character in simplified form, siRNA
ShRNA: the abbreviation of English short hairpin RNA, short hairpin RNA.
ShRNA comprises that (one is forward sequence to two short inverted repeats, another is reverse complementary sequence, and both can be combined into two strands, and forward sequence is wherein for interfering target sequence), middle by stem ring (loop) sequence separation, form hairpin structure.So-called inverted repeats refers to that downstream exists the sequence reverse with the complementary sequence of a certain section of sequence in upstream in single polynucleotide chain.
RT-PCR: the abbreviation of English reverse transcription Polymerase Chain Reaction, inverse transcription polymerase chain reaction.
Western blotting:western Western blotting.
MRNA: the abbreviation of English messenger RNA, messenger RNA(mRNA).
CDNA: the abbreviation of English complementary DNA, complementary DNA (cDNA).
DEPC: the abbreviation of English diethypyrocarbonate, diethylpyrocarbonate, is a kind of RNA enzyme inhibitors.
MTT: English 3-(4,5)-dimethylthiahiazo (z-y1)-3, the abbreviation of 5-di-phenytetrazoliumromide, tetramethyl-azo azoles salt, the conventional reagent of doing colorimetric method for determining cell viability.
Technical scheme of the present invention is as follows:
The dual-target siRNAs eukaryon expression plasmid that suppresses STAT3 and AFP genetic expression, it is characterized in that, take pGenesil1.5 as carrier, utilize dual-target siRNA technology, on a shRNA expression plasmid, introduce for STAT3 and the effective shRNA sequence of AFP gene, each sequence has promotor and termination signal and independent expression separately separately, in the AFP positive tumor of the STAT3 of high expression level gene, brings into play interference effect, is for expressing the therapeutic substance of the AFP positive tumor of STAT3 gene;
Two inverted repeats of described shRNA sequence are respectively interference target sequence and the reverse complementary sequence thereof of STAT3 or AFP gene;
The interference target sequence of described STAT3, AFP gene is respectively: 1. 5'-GCAACAGATTGCCTGCATTGG-3', originates in 956; 2. 5'-CAGGGAGACATTCATGAAC-3', originates in 508;
The reverse complementary sequence of the interference target sequence of described STAT3, AFP gene is respectively:
5'-CCAATGCAGGCAATCTGTTGC-3',5'-GTTCATGAATGTCTCCCTG-3';
The loop sequence of STAT3, AFP gene shRNA expression cassette is respectively: 5'-GGCCGGCGCGC-3', 5'-CGCGCGCGGGCC-3';
By following methods, made:
(1) structure of STAT3 and AFP Gene Double promotor shRNA expression cassette
A. first round PCR: the plasmid XM-2P that comprises H1 and U6 promotor of take is template, design PCR primer, partial sequence at 3 ' introducing pcr template plasmid XM-2P, H1 and U6 promoter sequence reverse complementary sequence and the loop sequence of the interference target sequence of the STAT3 described in introducing respectively in upstream and downstream primer and AFP gene are used for increasing;
Upstream primer: P1-FW:5 '-GGCCGGCGCGC CCAATGCAGGCAATCTGTTGC GGGAAAGAGTGATC-3 ',
Downstream primer: P1-RV:5 '-CGCGCGCGGGCC GTTCATGAATGTCTCCCTG GGTGTTTCGTCCTTTC-3 ';
B. second take turns PCR: take first round PCR as template; design PCR primer; in upstream and downstream primer, introduce respectively described STAT3 and interference target sequence, rna plymerase iii terminator sequence " AAAAA " and the restriction enzyme HindIII(AAGCTT of AFP gene), BamHI(GGATCC); for the ease of enzyme, cut, at two restriction endonucleases, 5 ' end, added protectiveness base and be respectively " AGT " and " AT ":
Upstream primer: P2-FW:5 '-AGTAAGCTTAAAAA GCAACAGATTGCCTGCATTGG GGCCGGCGCGC CC-3 ',
Downstream primer: P2-RV:5 '-ATGGATCCAAAAA CAGGGAGACATTCATGAAC CGCGCGCGGGCC GT-3 ';
C. pass through above two-wheeled PCR, obtain STAT3 and AFP Gene Double promotor shRNA expression cassette, product structure is: HindIII--shRNA1-H1 promotor-U6 promotor-shRNA2-BamHI.
(2) the constructed STAT3 of step (1) and AFP gene shRNA expression cassette and siRNA expression vector pGenesil1.5 are used to HindIII, BamHI double digestion simultaneously, produce respectively Insert Fragment and carrier segments, then connect, finally be transformed into DH5 α intestinal bacteria, through kantlex, screen, select single bacterium colony and cultivate in a large number, with plasmid extraction kit, extract plasmid DNA purification; The dual-target siRNAs eukaryon expression plasmid pGenesil1.5-STAT3-AFP of STAT3 and AFP genetic expression is inhibited;
(3) evaluation of plasmid: the plasmid DNA agarose gel electrophoresis that step (2) is extracted, application limitations restriction endonuclease HindIII, BamHI do enzyme and cut evaluation, concentration and the purity of plasmid DNA is measured in ultraviolet spectrophotometer analysis, and insert segment order-checking, to determine whether STAT3 and AFP gene shRNA expression cassette correctly insert in pGenesil1.5 plasmid.
The application of the dual-target siRNA eukaryon expression plasmid of inhibition STAT3 of the present invention and AFP genetic expression in the genomic medicine of the AFP positive tumor of preparation treatment expression STAT3.
For to STAT3, the two siRNA expression plasmids of AFP are to the inhibition of STAT3 and AFP gene and the effect of AFP positive tumor cell is identified, liposome transfection cell, extract total RNA (Ribonucleic Acid, RNA), reverse transcription-polymerase chain reaction (reverse transcription Polymerase Chain Reaction, RT-PCR) method is measured STAT3 and AFP messenger RNA(mRNA) (messenger RNA, mRNA) restraining effect of expression level, Western blotting (western blotting) is measured the impact on STAT3 and AFP protein expression level.Impact on AFP positive tumor cell growing multiplication after tetramethyl-azo azoles salt colorimetry (MTT), immunocytochemistry method detection Ki67 analysis transfection STAT3, the two siRNA expression plasmids of AFP.
Of the present invention is the AFP positive tumor therapeutants that can be used for high expression level STAT3 for STAT3 and the gene constructed two siRNA expression plasmids of AFP, in its AFP positive tumor cell of cultivating in vitro, can effectively suppress the expression of STAT3 and AFP gene, the propagation of tumour cell is had to significant restraining effect, can further in experimental animals, carry out gene therapy research.
Preparation method and the identification of its biological activity of the dual-target siRNA eukaryon expression plasmid of inhibition STAT3 of the present invention and AFP genetic expression mainly comprise following content:
One, the preparation of plasmid, comprise the introducing of two rna plymerase iii promotors (H1+U6), the design & formulation of dual-gene shRNA expression cassette, two shRNA expression cassette directed clonings of above-mentioned structure are entered to carrier pGenesil1.5, transform the extraction of Host Strains, amplification and plasmid DNA, the evaluation of plasmid.
Two, the evaluation of plasmid biologic activity, comprises the transfection of plasmid, the impact of the expression of the calculating of liposome transfection efficiency, RT-PCR detection STAT3 and AFP gene, western blotting mensuration STAT3 and AFP protein expression level.Impact on AFP positive tumor cell growing multiplication after MTT, immunocytochemistry method detection Ki67 analysis transfection STAT3, the two siRNA expression plasmids of AFP.
Describe the concrete operation method of each step in preparation method of the present invention below in detail:
1, RNA interferes the selection of target sequence and the introducing of two rna plymerase iii (H1+U6) promotor: select through screening, verify the RNAi target sequence of effective STAT3 and AFP gene, be respectively:
①5'-GCAACAGATTGCCTGCATTGG-3'
②5'-CAGGGAGACATTCATGAAC-3'
Design PCR primer, the plasmid XM-2P that comprises H1 and U6 promotor of take is template, amplification H1 and U6 promoter sequence, and in upstream and downstream primer, introduce respectively reverse complementary sequence and the loop sequence of the interference target sequence of STAT3 and AFP gene: upstream primer: P1-FW:5 '-GGCCGGCGCGCCCAATGCAGGCAATCTGTTGCGGGAAAGAGTGATC-3 ' downstream primer: P1-RV:5 '-CGCGCGCGGGCCGTTCATGAATGTCTCCCTGGGTGTTTCGTCCTTTC-3 ' PCR reaction system:
The structure of 2.STAT3 and AFP Gene Double promotor shRNA expression cassette
The gained PCR product in 1 of take is template, design PCR primer, in upstream and downstream primer, introduce respectively the interference target sequence of STAT3 and AFP gene and HindIII, BamHI, rna plymerase iii terminator sequence " AAAAA ": upstream primer: P2-FW:5 '-AGTAAGCTTAAAAA GCAACAGATTGCCTGCATTGG GGCCGGCGCGCCC-3 ' downstream primer: P2-RV:5 '-ATGGATCCAAAAA CAGGGAGACATTCATGAAC CGCGCGCGGGCCGT-3 ' reaction system:
Through two-wheeled PCR, finally obtain STAT3 and AFP Gene Double promotor shRNA expression cassette, product structure is: HindIII-shRNA1-H1 promotor-U6 promotor-shRNA2-BamHI.
3, STAT3 and AFP Gene Double promotor shRNA expression cassette directed cloning enter vector plasmid pGenesil1.5
Constructed STAT3 and AFP gene shRNA expression cassette and siRNA expression vector pGenesil1.5 are used to HindIII, BamHI double digestion simultaneously, produce respectively Insert Fragment and carrier segments, then connect, finally be transformed into DH5 α intestinal bacteria, through kantlex, screen, select single bacterium colony and cultivate in a large number, with plasmid extraction kit, extract plasmid DNA purification;
Ligation system:
4, the evaluation of plasmid
By the plasmid DNA agarose gel electrophoresis extracting, application limitations restriction endonuclease HindIII+BamHI does enzyme and cuts evaluation; Concentration and the purity of plasmid DNA are measured in ultraviolet spectrophotometer analysis, and insert segment order-checking.
The constructed plasmid identification of its biological activity method of aforesaid method is as follows:
1. the transfection SMMC-7721 cell cultures of liver cancer cell cultivation and plasmid, containing in the RPMI-1640 of 10% new-born calf serum, is placed in 37 ℃, 5%CO
2in incubator.First 24 hours of transfection, by tumor cell inoculation in 6 well culture plate Shang,Mei holes approximately 5 * 10
5individual cell reaches more than 90% every porocyte saturation ratio before transfection, does not use containing antibiotic nutrient solution during bed board.After kind of plate 24 hours, get plasmid 5 μ g and add 250 μ lopti-MEM nutrient solutions, mix gently, press Lipofectamine
tM2000 transfection reagent specification sheets methods are carried out transient transfection.Dosage ratio is selected design in its suggested range, according to liposome and plasmid proportioning, divide five groups, be respectively blank group, 4 μ l:2 μ g groups, 6 μ l:2 μ g groups, 8 μ l:4 μ g groups, 10 μ l:4 μ g groups, prepare respectively in liposome/plasmid transfection mixture 6 orifice plates and add 500 μ l transfection composites, the culture plate that moves around, makes transfection composite fully contact with cell.After 37 ℃ of cultivation 6h, add the fresh DMEM containing 10% new-born calf serum, continue to hatch.After transfection, 48h detects the expression of green fluorescent protein in fluorescent microscope.
2. the sxemiquantitative RT-PCR of the synthetic and RNA interference effect of the extraction of total RNA, cDNA detects
(1) extract total RNA and get the liver cancer cell SMMC-7721 after transfection, with PBS rinsing 2 times, by 10
6-10
7individual cell adds the total RNA extraction agent of 1ml Trizol lysing cell, lysate goes to 1.5ml size without the Ep pipe of RNA enzyme, add 200 μ l chloroforms, thermal agitation 30 seconds, 12000 revs/min 4 ℃ centrifugal 5 minutes, carefully get supernatant and move to 1.5ml size without the Ep pipe of RNA enzyme, add and the isopyknic Virahol of supernatant, room temperature place after 5 minutes 12000 revs/min 4 ℃ centrifugal 5 minutes, carefully abandon supernatant, 70% ethanol (diethylpyrocarbonate (diethypyrocarbonate, DEPC) water preparation) washing precipitation is 2 times, under room temperature, naturally dry, with distilled water (containing 1%DEPC), dissolve, lower continuous reaction.
(2) the RT-PCR test kit of Takara company is used in the synthetic and PCR reaction of complementary DNA (cDNA) (complementary DNA, cDNA), first by 50 ℃ 30 minutes, 99 ℃ 5 minutes, 5 ℃ of steps of 5 minutes are synthesized respectively cDNA, and reaction is totally 10 μ l, comprises MgCI
22 μ l, 10X reverse transcription damping fluid 1 μ l, dNTPs mixture 1 μ l, RNA enzyme inhibitors 0.25 μ l, AMV ThermoScript II 0.5 μ l, Oligo dT-primer 0.5 μ l, RNA 4.8 μ l; Then get cDNA1 μ l increases in PCR instrument, reaction conditions is 94 ℃ of circulations in 2 minutes, 94 ℃ 30 seconds, 56 ℃ 30 seconds, 72 ℃ of totally 30 circulations in 1 minute, reaction is totally 20 μ l, comprises 5X PCR damping fluid 5 μ l, sterile purified water 9.875 μ l, TaKaRa Ex Taq HS enzyme 0.125 μ l, each 1 μ l of Ge Dui upstream and downstream primer, each 1 μ l of internal reference β-actin upstream and downstream primer, cDNA 1 μ l.Pcr amplification product detects through 2% agarose gel electrophoresis.PCR primer sequence following table.
Goal gene PCR primer sequence and expanding fragment length
The variation of 3.Western blot checking STAT3, AFP protein expression
(1) culturing cell protein extraction step: take out culturing cell, discard old nutrient solution, ice precooling PBS washes 1 time.Add 1 * SDS sample-loading buffer lysing cell, with cell sleaker, cell is scraped off, and be transferred in Ep pipe, remain on ice.Shear DNA 10-15 second, reduce sample viscosity.95~100 ℃ heating 10 minutes, cooled on ice, centrifugal 11000 revs/min 4 ℃ 4 minutes.Draw supernatant to 0.5m lEp pipe ,-80 ℃ of preservations.
(2) protein sample electrophoresis step: first pour into the separation gel of about 4ml, solidify approximately 30 minutes; Then pour into the concentrated glue of about 1ml, solidify approximately 20 minutes.Offset plate is put into electrophoresis chamber, fill it up with electrophoresis liquid.Protein sample is joined in hole to 4 ℃ of 90v voltage electrophoresis 1.5~2 hours.
(3) transferring film step: pvdf membrane is processed: methyl alcohol soaks 10 seconds, deionized water soaks 5 minutes, and 1 * transfering buffering liquid soaks 15 minutes.(while cutting film, wear gloves, prevent the protein contamination film of being infected with on hand).By negative pole, to anodal, according to the order of three metafiltration paper, gel, pvdf membrane, three metafiltration paper, put well.(size of the size >=filter paper of film > size of glue; Between each layer, can not there is bubble), 50 milliamperes of transfers of 4 ℃ of current stabilizations 12~14 hours.
(4) antibody incubation step: wash film with 25ml TBS after transferring film, room temperature 5 minutes.Room temperature is hatched on film 1h(shaking table and is shaken with sealing damping fluid).25ml TBST washes film 3 times * 5 minutes/time.Primary antibodie diluent is hatched 4 ℃ of the slight vibrations of film and is spent the night.TBST washes film 3 times * 5 minutes/time.Two anti-diluent (diluting with confining liquid) incubated at room film 1h of HRP-mark.TBST washes film 3 times * 5 minutes/time.Filter membrane is placed in bottle ware, adds the DAB substrate solution of appropriate fresh configuration, within 5-15 minute, can develop the color, water rinses termination reaction and takes a picture.
4. the proliferation activity of cell changes
(1) tetramethyl-azo azoles salt (MTT) colorimetric method for determining cell viability:
MTT can permeate through cell membranes, mitochondrial dehydrogenase in viable cell can be changed into water-fast formazan particle, with DMSO, dissolves this particle, detects absorbancy, the amount forming due to crystallization and cell quantity and metabolic activity are proportional, and the height of absorbancy can reflect quantity and the activity of viable cell.Experimentation is as follows: with the MTT solution of PBS preparation 5mg/ml, filtration sterilization, stand-by.According to 1.5x10
4/ hole, inoculation SMMC-7721 cell, in 96 orifice plate Zhong,Mei hole 200 μ l nutrient solutions, is placed in 37 ℃, 5% CO
2incubator is cultivated 24h; Liposome method is carried out plasmid DNA transfection, and transfection method as previously mentioned.After transfection, be put in incubator and continue to cultivate, every experimental group is established 5 Ge Fu holes, after 24,48,72 hours, carries out MTT detection: add the MTT solution of 20 μ l (5g/L), be placed in cell culture incubator and continue to hatch 4 hours; Gentle aspiration also discards the DMSO (DMSO) that adds 150 μ l in nutrient solution ,Zai Mei hole, upper strata, and under room temperature, lucifuge vibration is 15 minutes; Enzyme-linked immunosorbent assay instrument is measured the absorbancy of 492nm.
(2) ki-67 immunocytochemistry method is measured cell proliferation:
Ki-67 is the typical nucleoprotein relevant to the cell cycle, can effectively reflect proliferative activity, is regarded as reflecting the objective indicator of cell colony proliferation activity more comprehensively.By logarithmic phase SMMC-7721 cell according to 5 * 10
5the cell density of individual/ml is seeded in six orifice plates that are covered with sterility cover slide, is placed in 37 ℃, 5%CO
2in incubator, respectively cultivate after 24,48 and 72 hours and carefully take out cover glass with tweezers, at room temperature, adopt ki-67 immunocytochemistry method to test.
Constructed plasmid and bioactive qualification result are as follows:
1. plasmid DNA agarose gel electrophoresis result is shown as Fig. 2, and the more visible plasmid DNA of the band of Marker is between 4000-7000bp, and the known plasmid size building is about 5.4kb.
2. plasmid DNA enzyme is cut qualification result and is shown as Fig. 3, after plasmid is done enzyme and is cut with HindIII+BamHI, and two bar segment of product 685bp and 4.7kb.
3. sequencing result has verified that by order-checking (Fig. 4) insertion sequence and constructed STAT3 and AFP Gene Double shRNA expression cassette meet completely, illustrate and have successfully built pGenesil1.5-STAT3-AFP.
4. the expression of transfection efficiency calculation result 48h fluorescence microscopy Microscopic observation green fluorescent protein after transfection.Result show take liposome/plasmid body ratio during as 2:1 transfection effect best, and liposome is less to the toxicity of cell, is the proper ratio of plasmid and transfection reagent.
After the transfection of 5.RT-PCR result 48 hours, RT-PCR reaction product agarose gel electrophoresis result as shown in Figure 5, each group is specific band and internal reference β-actin band of visible STAT3, AFP gene all, the band comparison contrasting with empty carrier can find that pG1.5-SA transfection group STAT3, the brightness of AFP gene band all weaken to some extent, inhibiting rate is respectively 51.29%, 26.71%, illustrates that this plasmid can effectively suppress the expression of STAT3 in liver cancer cell, AFP gene.
6.Western bloting detects affect transfection after 48 hour of pG1.5-SA plasmid on STAT3, AFP protein expression level, extract each experimental group total protein of cell, Western bloting detects, result shows, the band comparison contrasting with empty carrier can find that pG1.5-SA transfection group STAT3, AFP gene band gray-scale value all weaken to some extent, inhibiting rate is respectively 59.67%, 40.98%, illustrates that this plasmid can effectively suppress the expression (see figure 6) of STAT3 in liver cancer cell, AFP albumen.
7. the proliferation activity of cell changes detected result
(1) mtt assay detected result: measured respectively each hole A after transfection at 24,48,72 hours
492, averaging in 5 Ge Fu holes, calculates inhibiting rate, and inhibiting rate=(1-experimental group A value mean value/control group A value mean value) * 100%, take the time as transverse axis, and inhibiting rate is longitudinal axis curve plotting (Fig. 7).Visible STAT3, AFP dual-target siRNA expression plasmid (pG1.5-SA) transfection group are significantly higher than siRNA expression plasmid (pGPU6-STAT3, the pDonor Vector AFP) transfection group of individual gene to the inhibiting rate of SMMC-7721 cell proliferation.
(2) Ki-67 immunocytochemistry method detected result: transfection pG1.5-SA group 24,48h ki-67 fluorescent dye positive cell is starkly lower than control group (Fig. 8).Prompting STAT3, the transfection of AFP dual-target siRNA expression plasmid can significantly suppress the proliferation activity of liver cancer cell SMMC-7721.This may can disturb STAT3, the AFP genetic expression of SMMC-7721 with dual-target siRNA simultaneously, these two genes all have the effect that promotes tumor cell proliferation, thereby produce stack or synergy, cause the restraining effect of SMMC-7721 cell-proliferation activity apparently higher than single-gene RNA interference group.
Excellent results of the present invention is as follows:
The present invention is directed to common in malignant tumour two overexpression gene STAT3 and AFP, select through screening, verify effective RNAi target sequence, utilize RNA perturbation technique successfully to build the dual-target siRNA expression plasmid by two rna plymerase iii promoters driven in conjunction with gene recombination technology, 2 effective RNAi sequences of checking are disturbed corresponding target gene, and tumour cell has been produced to synergy.By expressing in the Liver cancer cell SMMC-7721 in the AFP positive, suppressed specifically the expression of STAT3 and AFP gene, with the shRNA expression plasmid comparison of a kind of gene of independent inhibition, to reach the object of more effectively treating AFP positive tumor.
1. the STAT3 that the present invention builds and AFP Gene Double target siRNA eukaryon expression plasmid can effectively suppress the expression of STAT3 and AFP gene simultaneously.Mainly have the following advantages: 1. this plasmid can increase in a large number in bacillus coli DH 5 alpha, can constantly obtain the plasmid of expressing siRNAs; 2. selected through this laboratory screening and confirmed, to STAT3 and the higher target site of AFP gene inhibition efficiency; 3. safe, dangerous without insertion mutation, also without immunotoxicity, react.
2. the specificity dual-target siRNA expression plasmid that the present invention builds is for STAT3 and AFP gene, respectively by the independently expression of rna plymerase iii promotor startup shRNA, can avoid interfering with each other, to guarantee the siRNA effective expression of two genes, the expression of two genes is played to more significant inhibition.
3. the present invention has realized STAT3 and AFP gene siRNA has been expressed simultaneously in a plasmid, after transfectional cell, can reach with the siRNA plasmid of independent transfection term single gene and compare and suppress more significantly the effect of cell proliferation.On the other hand, in order to reach, disturb two genetic expressions, two siRNA expression plasmids can be less to the toxicity of cell than two single siRNA expression plasmid cotransfections simultaneously, and interfering with each other of two genetic expressions can be less, and operability is stronger.
The dual-target siRNA expression plasmid that the present invention is directed to STAT3 and AFP gene is the therapeutant that can be used for the AFP positive tumor of high expression level STAT3, significantly inhibition tumor cell propagation.
Accompanying drawing explanation
Fig. 1 is pGenesil1.5-STAT3-AFP plasmid physical map.
Fig. 2 is plasmid DNA agarose gel electrophoresis figure: 1. Marker (DL10000); 2. pGenesil1.5-Stat3-AFP plasmid
Fig. 3 is that enzyme is cut evaluation figure: 1. Marker (DL2000); 2. 3. pGenesil1.5-Stat3-AFP of pGenesil1.5-Stat3-AFP HindIII/BamHI; 4. Marker (DL10000).
Fig. 4 is the Insert Fragment gene sequencing figure of pGenesil1.5-Stat3-AFP plasmid: A:STAT3-shRNA expression cassette sequencer map; B:AFP-shRNA expression cassette sequencer map.
Fig. 5 is that RT-PCR detects the restraining effect that transfection pGenesil1.5-Stat3-AFP expressed SMMC-7721 cell Stat3, AFPmRNA after 48 hours, 1. empty carrier control group; 2. pGenesil1.5-Stat3-AFP transfection group.
Fig. 6 is that Western bloting detects transfection the pGenesil1.5-Stat3-AFP restraining effect to SMMC-7721 cell Stat3, AFP protein expression, 1. empty carrier control group after 48 hours; 2. pGenesil1.5-Stat3-AFP transfection group.
Fig. 7 is the restraining effect to SMMC-7721 cell proliferation after the different plasmids of mtt assay mensuration transfection.
Fig. 8 is the restraining effect to SMMC-7721 cell proliferation after the different plasmids of ki-67 immunocytochemistry method mensuration transfection.By from left to right successively: pGPU6-STAT3 transfection group, pDonor Vector AFP transfection group, pGenesil1.5-Stat3-AFP transfection group.
Embodiment
Below in conjunction with embodiment, the invention will be further described, but be not limited only to this.
One, main agents
1. carrier pGenesil1.5 is purchased from Wuhan Xi Ma company;
2. engineering bacteria DH5 α is purchased from promega company;
3.T4 ligase enzyme is purchased from NEW ENGLAND company; The extraction of plasmid and purification kit (QIAprep Spin Miniprep Kit) are purchased from QIAGEN company
4.PCR primer synthesizes and determined dna sequence (Nanjing Genscript Biotechnology Co., Ltd.)
5. transfection reagent Lipofectamine 2000, TRizol Reagent are purchased from Invitrogen company
6.RT-PCR test kit RNA PCR Kit(AMV) Ver.3.0, restriction enzyme HindIII, BamHI, DNA Marker is purchased from Takara company
7. dye in advance albumen marker and be purchased from Fermentas company;
8.MTT reagent is purchased from sigma company;
9. the goat anti-rabbit igg antibody of the anti-Ki-67 antibody of rabbit, FITC mark is purchased from epitomics company.
Two, key instrument
1. ultraviolet spectrophotometer (GeneQuant Pro): Amersham Biosciences;
2. gel imaging system (ChemilmagerTM 4400): Alpha Innotech;
3. Biohazard Safety Equipment (Hfsafe1200): Shanghai Li Shen scientific instrument company;
4. CO2gas incubator (HF90): Shanghai Li Shen scientific instrument company;
5. fluorescent microscope (ECLIPSE TE 2000-S): Nikon;
6.CCD(penguin150CL): U.S. pixera company;
7. tabletop refrigerated centrifuge (TGL-16G): Anting Scientific Instrument Factory, Shanghai;
8.PCR instrument (PE7300): ABI company;
9. full-automatic microplate reader (Model 680): Bio-Rad company.
Three, the preparation method of plasmid and identification of its biological activity thereof
1, RNA interferes the selection of target sequence and the introducing of two rna plymerase iii (H1+U6) promotor: select through screening, verify the RNAi target sequence of effective STAT3 and AFP gene, be respectively:
①5'-GCAACAGATTGCCTGCATTGG-3'
②5'-CAGGGAGACATTCATGAAC-3'
The reverse complementary sequence of the RNAi target sequence of described STAT3 and AFP gene is respectively:
5'-CCAATGCAGGCAATCTGTTGC-3' and 5'-GTTCATGAATGTCTCCCTG-3';
The loop sequence of STAT3, AFP gene shRNA expression cassette is respectively 5'-GGCCGGCGCGC-3' and 5'-CGCGCGCGGGCC-3';
Design PCR primer, the plasmid XM-2P that comprises H1 and U6 promotor of take is template, amplification H1 and U6 promoter sequence, and in upstream and downstream primer, introduce respectively reverse complementary sequence and the loop sequence of the interference target sequence of STAT3 and AFP gene:
Upstream primer: P1-FW:5 '-GGCCGGCGCGCCCAATGCAGGCAATCTGTTGCGGGAAAGAGTGATC-3 '
Downstream primer: P1-RV:5 '-CGCGCGCGGGCCGTTCATGAATGTCTCCCTGGGTGTTTCGTCCTTTC-3 '
PCR reaction system:
The structure of 2.STAT3 and AFP Gene Double promotor shRNA expression cassette
The gained PCR product in above-mentioned steps 1 of take is template, design PCR primer, in upstream and downstream primer, introduce respectively the interference target sequence of STAT3 and AFP gene and HindIII, BamHI, rna plymerase iii terminator sequence " AAAAA ": upstream primer: P2-FW:5 '-AGTAAGCTTAAAAA GCAACAGATTGCCTGCATTGG GGCCGGCGCGCCC-3 ', downstream primer: P2-RV:5 '-ATGGATCCAAAAA CAGGGAGACATTCATGAAC CGCGCGCGGGCCGT-3 ', reaction system:
Through two-wheeled PCR, finally obtain STAT3 and AFP Gene Double promotor shRNA expression cassette, product structure is: HindIII--shRNA1-H1 promotor-U6 promotor-shRNA2-BamHI.
3, STAT3 and AFP Gene Double promotor shRNA expression cassette directed cloning enter vector plasmid pGenesil1.5
Constructed STAT3 and AFP gene shRNA expression cassette and siRNA expression vector pGenesil1.5 are used to HindIII, BamHI double digestion simultaneously, produce respectively Insert Fragment and carrier segments, then connect, finally be transformed into DH5 α intestinal bacteria, through kantlex, screen, select single bacterium colony and cultivate in a large number, with plasmid extraction kit, extract plasmid DNA purification;
Ligation system:
4, transform
1. get competent cell DH5 α, melt on ice 10 minutes.
2. add connection product 5 μ l to mix, place on ice 30 minutes, every 5 minutes, shake gently EP pipe.
3. in 42 ℃ of water-baths, place 30 seconds, do not rock.Take out and be placed in ice, standing 2 minutes rapidly.
4. the LB substratum that adds 37 ℃ of preheatings of 250 μ l, 37 ℃ of joltings (approximately 225 turn) are about 1 hour.
5. get different volumes bacterium liquid (50 μ l-200 μ l) and coat on the LB flat board that contains kantlex (final concentration is 30 μ g/ml), cultivate 12-16 hour for 37 ℃.
5, positive recombinant increases and separation and purification in a small amount
1. select above-mentionedly containing 5 of the mono-clonal bacterium colonies in the LB flat board of kantlex, be seeded in separately 4ml containing in the LB nutrient solution of kantlex, 37 ℃ of joltings (approximately 170 revs/min) 14-16 hour.
2. every Guan Qu 1mlJun Yesong Nanjing Genscript Biotechnology Co., Ltd. carries out Insert Fragment order-checking.Separately with glycerine, preserve remaining bacterium liquid, put-80 ℃ and save backup.
3. take out the bacterial classification that order-checking is correct, streak inoculation, containing on the LB flat board of kantlex, is hatched 14-16 hour for 37 ℃.Choose single colony inoculation and contain in the LB liquid nutrient medium of penbritin at 4ml, 37 ℃ of joltings (approximately 170 revs/min) 14-16 hour.
4. a small amount of of plasmid is extracted: get 3ml bacterium liquid and extract plasmid by QIAprep Spin Miniprep Kit (QIAGEN) specification sheets.
A collects in bacterium liquid and centrifuge tube, centrifugal 5 minutes of lower 10000 revs/min of room temperature; Collect thalline, be resuspended in the cell suspending liquid P1 of 250 μ l;
B adds 250 μ l alkaline lysis liquid P2, covers tightly the mouth of pipe, puts upside down rotating centrifugal pipe 4-6 time to mix, standing 5 minutes of room temperature;
C adds 350 μ l damping fluid N3, and gentleness is put upside down centrifuge tube 5-10 time immediately, centrifugal 10 minutes of lower 13000 revs/min of room temperature;
D carefully moves into adsorption column by supernatant liquor, and centrifugal 1 minute of lower 10000 revs/min of room temperature is outwelled the liquid of collection tube, and adsorption column is put in same collection tube;
E adds 750 μ l washings PE in adsorption column, and centrifugal 1 minute of 10000 revs/min of room temperatures, outwell liquid in collection tube, repeated washing one time;
F outwells liquid in collection tube, and adsorption column is put into same collection tube.Centrifugal 1 minute of 10000 revs/min of room temperatures, remove residual washing lotion;
G puts into a clean 1.5ml centrifuge tube by adsorption column, in adsorption film central authorities, adds 50 μ l elutriant EB, standing 1 minute, centrifugal 1 minute of room temperature;
H plasmid is kept at-70 ℃
6, the evaluation of plasmid DNA
1. agargel electrophoresis analysis: prepare 1% sepharose (containing 0.5 μ g/ml ethidium bromide), get 2 μ l plasmid DNA and carry out electrophoresis, the plasmid DNA of Detection and Extraction.
2. application limitations restriction endonuclease HindIII+BamHI does enzyme and cuts evaluation.It is as follows that enzyme is cut system:
37 ℃ of enzymes are cut 2 hours.
3. ultraviolet spectrophotometer analysis: get 1 μ l plasmid DNA and dilute with 69 μ l ultrapure waters, detect the light absorption value at A260nm and A280nm place under automatic ultraviolet spectrophotometer, to measure concentration and the purity of plasmid DNA.
7, the transfection SMMC-7721 cell cultures of liver cancer cell cultivation and plasmid, containing in the RPMI-1640 substratum of 10% new-born calf serum, is placed in 37 ℃, 5%CO
2in incubator.First 24 hours of transfection, by tumor cell inoculation in 6 well culture plate Shang,Mei holes approximately 5 * 10
5individual cell reaches more than 90% every porocyte saturation ratio before transfection, does not use containing antibiotic nutrient solution during bed board.After kind of plate 24 hours, get plasmid 5 μ g and add 250 μ lopti-MEM substratum, mix gently, press Lipofectamine
tM2000 transfection reagents (Invitrogen) specification sheets method is carried out transient transfection.Dosage ratio is selected design in its suggested range, according to liposome and plasmid proportioning, divide five groups, be respectively blank group, 4 μ l:2 μ g groups, 6 μ l:2 μ g groups, 8 μ l:4 μ g groups, 10 μ l:4 μ g groups, prepare respectively in liposome/plasmid transfection mixture 6 orifice plates and add 500 μ l transfection composites, the culture plate that moves around, makes transfection composite fully contact with cell.After 37 ℃ of cultivation 6h, add the fresh DMEM nutrient solution containing 10% new-born calf serum, continue to hatch.Within 48 hours after transfection, in fluorescent microscope, detect the expression of green fluorescent protein.
8, the sxemiquantitative RT-PCR of the synthetic and RNA interference effect of the extraction of total RNA, cDNA detects
(1) extract total RNA and get the liver cancer cell SMMC-7721 after transfection, with PBS rinsing 2 times, by 10
6-10
7individual cell adds 1ml Trizol (Invitrogen) lysing cell, lysate goes to the Ep pipe of 1.5ml size RNase-free (without RNA enzyme), add 200 μ l chloroforms, thermal agitation 30 seconds, 12000 revs/min 4 ℃ centrifugal 5 minutes, carefully get the Ep pipe that supernatant moves to 1.5ml size RNase-free, add and the isopyknic Virahol of supernatant, room temperature place after 5 minutes 12000 revs/min 4 ℃ centrifugal 5 minutes, carefully abandon supernatant, 70% ethanol (preparation of DEPC water) washing precipitation 2 times, dries under room temperature naturally, with distilled water (containing 1%DEPC), dissolve lower continuous reaction.
(2) the RT-PCR test kit of Takara company is used in the synthetic and PCR reaction of cDNA, first by 50 ℃ 30 minutes, 99 ℃ 5 minutes, 5 ℃ of steps of 5 minutes are synthetic cDNA respectively, reaction is totally 10 μ l, comprises MgCl
22 μ l, 10X reverse transcription damping fluid 1 μ l, dNTPs mixture 1 μ l, RNA enzyme inhibitors 0.25 μ l, AMV ThermoScript II 0.5 μ l, Oligo dT primer 0.5 μ l, RNA 4.8 μ l; Then get cDNA 1 μ l increases in PCR instrument (PE7300), reaction conditions is 94 ℃ of circulations in 2 minutes, 94 ℃ 30 seconds, 56 ℃ 30 seconds, 72 ℃ of totally 30 circulations in 1 minute, reaction is totally 20 μ l, comprises 5X PCR damping fluid 5 μ l, sterile purified water 9.875 μ l, TaKaRa Ex Taq HS enzyme 0.125 μ l, each 1 μ l of upstream and downstream primer, each 1 μ l of internal reference β-actin upstream and downstream primer, cDNA 1 μ l.Pcr amplification product detects through 2% agarose gel electrophoresis.PCR primer sequence following table.
Goal gene PCR primer sequence and expanding fragment length
9, the variation of Western bloting checking STAT3, AFP protein expression
(1) culturing cell protein extraction step: take out culturing cell, discard old nutrient solution, ice precooling PBS washes 1 time.Add 1 * SDS sample-loading buffer lysing cell, with cell sleaker, cell is scraped off, and be transferred in Ep pipe, remain on ice.Shear DNA 10-15 second, reduce sample viscosity.95~100 ℃ are heated 10 minutes, cooled on ice, 4 ℃ centrifugal 11000 revs/min, 4 minutes.Draw in supernatant to 0.5 milliliter Ep pipe-80 ℃ of preservations.
(2) protein sample electrophoresis step: first pour into the separation gel of about 4ml, solidify approximately 30 minutes; Then pour into the concentrated glue of about 1ml, solidify approximately 20 minutes.Offset plate is put into electrophoresis chamber, fill it up with electrophoresis liquid.Protein sample is joined in hole to 4 ℃ of 90v voltage electrophoresis 1.5~2 hours.
(3) transferring film step: pvdf membrane is processed: methyl alcohol soaks 10 seconds, deionized water soaks 5 minutes, and 1 * transfering buffering liquid soaks 15 minutes.While cutting film, wear gloves, prevent the protein contamination film of being infected with on hand.By negative pole, to anodal, according to the order of three metafiltration paper, gel, pvdf membrane, three metafiltration paper, put well.The size of the size >=filter paper of film > size of glue; Between each layer, can not there is bubble, 50 milliamperes of transfers of 4 ℃ of current stabilizations 12~14 hours.
(4) antibody incubation step: wash film with 25ml TBS after transferring film, room temperature 5 minutes.Room temperature is hatched film 1 hour (shaking on shaking table) with sealing damping fluid.25ml TBST washing lotion is washed film 3 times * 5 minutes/time.Primary antibodie diluent is hatched 4 ℃ of the slight vibrations of film and is spent the night.TBST washes film 3 times * 5min/ time.Two anti-diluent (diluting with confining liquid) incubated at room film 1h of HRP-mark.TBST washes film 3 times * 5min/ time.Filter membrane is placed in bottle ware, adds the DAB substrate solution of appropriate fresh configuration, within 5-15 minute, can develop the color, water rinses termination reaction and takes a picture.
10, the proliferation activity of cell changes detection
(1) MTT colorimetric method for determining cell viability:
1) PBS is made into the MTT solution of 5mg/ml, 0.22 μ l filter filtration sterilization.Be inoculated in the DMEM substratum that contains 10% new-born calf serum for SMMC-7721 cell in culturing bottle, 37 ℃, 5%CO
2cultivate, the next day change liquid, when cell grows to 80-90%, PBS rinses cell twice, then uses trypsin digestion and cell, according to 1.5x10
4/ hole, is inoculated in 96 orifice plate Zhong,Mei hole 200 μ l, contains 10% new-born calf serum in nutrient solution, is placed in 37 ℃, 5% CO
2incubator is cultivated 24 hours;
2) next day, in 96 orifice plates, according to the unloaded group of pGPU6-STAT3 transfection group, pDonor Vector AFP transfection group, pGenesil1.5-Stat3-AFP transfection group and pGenesil1.5, add corresponding transfection reagent mixture and carry out transfection, transfection method as previously mentioned.After transfection, be put in incubator and continue to cultivate, every experimental group is established 5 Ge Fu holes, after after transfection 24,48,72 hours, carries out MTT detection;
3) each experimental group adds the MTT solution of 20 μ l by design time, is placed in cell culture incubator and continues to hatch 4 hours;
4) gentle aspiration discard the DMSO that adds 150 μ l in nutrient solution ,Zai Mei hole, upper strata, under room temperature, lucifuge vibration is 15 minutes;
5) on enzyme-linked immunosorbent assay instrument, measure the absorbancy (A) of wavelength 492nm light, calculate and respectively organize appreciation rate;
6) above experiment in triplicate, is averaged.
(2) ki-67 immunocytochemistry method
By SMMC-7721 in logarithmic phase according to 5 * 10
5the cell density of individual/ml is seeded in six orifice plates that are covered with sterility cover slide, is placed in 37 ℃, 5%CO
2in incubator, respectively cultivate after 24,48 and 72 hours and carefully take out cover glass with tweezers, at room temperature, adopt ki-67 immunocytochemistry method to test.Step is as follows:
1), after cover glass is taken out with tweezers are careful, with TBST flush cover slide twice gently, avoid firmly rinsing cell flake;
2) 20% paraformaldehyde is dripped and on cover glass, cover cell completely with fixed cell 20 minutes;
3) with 1xPBST, carefully rinse cell surface 3 times;
4) the penetrating cell of 0.1%Triton-X100 is 5 minutes;
5) by 1xPBST washing lotion, rinse cell twice.
6) link antibody is diluted to suitable concn with antibody diluent;
7) antibody is added drop-wise on the cell of cover glass, room temperature lucifuge is hatched 1 hour;
8) by PBST washing lotion, rinse 3 times;
9) with DAPI fluorescence dye room temperature lucifuge dyeing 5 minutes;
10) PBST rinses cell 3 times;
11) use neutral gum mounting, keep in Dark Place.
Four, result
1. plasmid DNA agarose gel electrophoresis result is shown as Fig. 2, and the more visible plasmid DNA of the band of Marker is between 4000-7000bp, and the known plasmid size building is about 5.4kb.
2. plasmid DNA enzyme is cut qualification result as Fig. 3 shows, after plasmid is cut with HindIII+BamHI enzyme, obtains two bar segment of product 685bp and 4.7kb.
3. sequencing result has verified that by order-checking (Fig. 4) insertion sequence and STAT3 and AFP Gene Double shRNA expression cassette that we build meet completely, illustrate and have successfully built pGenesil1.5-STAT3-AFP.
4. transfection efficiency calculation result expression at fluorescence microscopy Microscopic observation green fluorescent protein in 48 hours after transfection.Result show take liposome/plasmid ratio during as 2:1 transfection effect best, and liposome is less to the toxicity of cell, is the proper ratio (figure is slightly) of plasmid and transfection reagent.
After the transfection of 5.RT-PCR result 48 hours, RT-PCR reaction product agarose gel electrophoresis result as shown in Figure 5, each group is specific band and internal reference β-actin band of visible STAT3, AFP gene all, the band comparison contrasting with empty carrier can find that pG1.5-SA transfection group STAT3, the brightness of AFP gene band all weaken to some extent, inhibiting rate is respectively 51.29%, 26.71%, illustrates that this plasmid can effectively suppress the expression of STAT3 in liver cancer cell, AFP gene.
6.Western bloting detects affect transfection after 48 hour of pG1.5-SA plasmid on STAT3, AFP protein expression level, extract each experimental group total protein of cell, Western bloting detects, result shows, the band comparison contrasting with empty carrier can find that pG1.5-SA transfection group STAT3, AFP gene band gray-scale value all weaken to some extent, inhibiting rate is respectively 59.67%, 40.98%, illustrates that this plasmid can effectively suppress the expression (see figure 6) of STAT3 in liver cancer cell, AFP albumen.
7. the proliferation activity of cell changes detected result
(1) mtt assay detected result: measured respectively each hole A after transfection at 24,48,72 hours
492, averaging in 5 Ge Fu holes, calculates inhibiting rate, and inhibiting rate=(1-experimental group A value mean value/control group A value mean value) * 100%, take the time as transverse axis, and inhibiting rate is longitudinal axis curve plotting (Fig. 7).Visible STAT3, AFP dual-target siRNA expression plasmid (pG1.5-SA) transfection group are significantly higher than siRNA expression plasmid (pGPU6-STAT3, the pDonor Vector AFP) transfection group of individual gene to the inhibiting rate of SMMC-7721 cell proliferation.
(2) Ki-67 immunocytochemistry method detected result: transfection pG1.5-SA group 24,48h ki-67 fluorescent dye positive cell is starkly lower than control group (Fig. 8).Prompting STAT3, the transfection of AFP dual-target siRNA expression plasmid can significantly suppress the proliferation activity of liver cancer cell SMMC-7721.This may can disturb STAT3, the AFP genetic expression of SMMC-7721 with dual-target siRNA simultaneously, these two genes all have the effect that promotes tumor cell proliferation, thereby produce stack or synergy, cause the restraining effect of SMMC-7721 cell-proliferation activity apparently higher than single-gene RNA interference group.
Claims (2)
1. suppress the dual-target siRNAs eukaryon expression plasmid of STAT3 and AFP genetic expression, it is characterized in that, take pGenesil1.5 as carrier, utilize dual-target siRNA technology, on a shRNA expression plasmid, introduce for STAT3 and the effective shRNA sequence of AFP gene, each sequence has promotor and termination signal and independent expression separately separately, in the AFP positive tumor of the STAT3 of high expression level gene, brings into play interference effect, is for expressing the therapeutic substance of the AFP positive tumor of STAT3 gene;
Two inverted repeats of described shRNA sequence are respectively interference target sequence and the reverse complementary sequence thereof of STAT3 or AFP gene;
The interference target sequence of described STAT3, AFP gene is respectively: 1. 5'-GCAACAGATTGCCTGCATTGG-3', originates in 956; 2. 5'-CAGGGAGACATTCATGAAC-3', originates in 508;
The reverse complementary sequence of the interference target sequence of described STAT3, AFP gene is respectively: 5'-CCAATGCAGGCAATCTGTTGC-3', 5'-GTTCATGAATGTCTCCCTG-3';
The loop sequence of STAT3, AFP gene shRNA expression cassette is respectively: 5'-GGCCGGCGCGC-3', 5'-CGCGCGCGGGCC-3';
By following methods, made:
(1) structure of STAT3 and AFP Gene Double promotor shRNA expression cassette
A. first round PCR: the plasmid XM-2P that comprises H1 and U6 promotor of take is template, design PCR primer, partial sequence at 3 ' introducing pcr template plasmid XM-2P, H1 and U6 promoter sequence reverse complementary sequence and the loop sequence of the interference target sequence of the STAT3 described in introducing respectively in upstream and downstream primer and AFP gene are used for increasing;
Upstream primer: P1-FW:5 '-GGCCGGCGCGC CCAATGCAGGCAATCTGTTGC GGGAAAGAGTGATC-3 ',
Downstream primer: P1-RV:5 '-CGCGCGCGGGCC GTTCATGAATGTCTCCCTG GGTGTTTCGTCCTTTC-3 ';
B. second take turns PCR: take first round PCR as template; design PCR primer; the restriction enzyme site GGATCC of restriction enzyme site AAGCTT, the BamHI of STAT3 described in introducing respectively in upstream and downstream primer and interference target sequence, rna plymerase iii terminator sequence " AAAAA " and the restriction enzyme HindIII of AFP gene; for the ease of enzyme, cut, at two restriction endonucleases, 5 ' end, added protectiveness base and be respectively " AGT " and " AT ":
Upstream primer: P2-FW:5 '-AGTAAGCTTAAAAA GCAACAGATTGCCTGCATTGG GGCCGGCGCGC CC-3 ',
Downstream primer: P2-RV:5 '-ATGGATCCAAAAA CAGGGAGACATTCATGAAC CGCGCGCGGGCC GT-3 ';
C. pass through above two-wheeled PCR, obtain STAT3 and AFP Gene Double promotor shRNA expression cassette, product structure is: HindIII--shRNA1-H1 promotor-U6 promotor-shRNA2-BamHI;
(2) the constructed STAT3 of step (1) and AFP gene shRNA expression cassette and siRNA expression vector pGenesil1.5 are used to HindIII, BamHI double digestion simultaneously, produce respectively Insert Fragment and carrier segments, then connect, finally be transformed into DH5 α intestinal bacteria, through kantlex, screen, select single bacterium colony and cultivate in a large number, with plasmid extraction kit, extract plasmid DNA purification; The dual-target siRNAs eukaryon expression plasmid pGenesil1.5-STAT3-AFP of STAT3 and AFP genetic expression is inhibited;
(3) evaluation of plasmid: the plasmid DNA agarose gel electrophoresis that step (2) is extracted, application limitations restriction endonuclease HindIII, BamHI do enzyme and cut evaluation, concentration and the purity of plasmid DNA is measured in ultraviolet spectrophotometer analysis, and carry out Insert Fragment order-checking, to determine whether STAT3 and AFP gene shRNA expression cassette correctly insert in pGenesil1.5 plasmid.
2. the application of the dual-target siRNAs eukaryon expression plasmid of the inhibition STAT3 of claim 1 and AFP genetic expression in the genomic medicine of the AFP positive tumor of preparation treatment expression STAT3.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210488901.0A CN103031334B (en) | 2012-11-27 | 2012-11-27 | Dual-target siRNA eukaryotic expression plasmid capable of inhibiting STAT3 and AFP gene expression, and application of expression plasmid |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210488901.0A CN103031334B (en) | 2012-11-27 | 2012-11-27 | Dual-target siRNA eukaryotic expression plasmid capable of inhibiting STAT3 and AFP gene expression, and application of expression plasmid |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103031334A CN103031334A (en) | 2013-04-10 |
CN103031334B true CN103031334B (en) | 2014-01-15 |
Family
ID=48018733
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201210488901.0A Active CN103031334B (en) | 2012-11-27 | 2012-11-27 | Dual-target siRNA eukaryotic expression plasmid capable of inhibiting STAT3 and AFP gene expression, and application of expression plasmid |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103031334B (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103255173A (en) * | 2013-04-28 | 2013-08-21 | 中国疾病预防控制中心病毒病预防控制所 | Double-promoter and double-expression specific shRNA (Short Hairpin Ribonucleic Acid) lentiviral vector and application thereof |
CN109706151B (en) * | 2019-01-25 | 2019-12-31 | 中国海洋大学 | shRNA for targeted silencing of STAT3 of human non-small cell lung cancer cell |
CN113416729B (en) * | 2021-05-18 | 2022-11-22 | 遵义医科大学附属医院 | shRNA and cDNA of liver target regulation alpha fetoprotein gene and application thereof |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1249243C (en) * | 2003-12-18 | 2006-04-05 | 济南市中心医院 | Targetted liver cancer AFP gene siRNAs expression carrier and its constructing method and use |
CN100549179C (en) * | 2006-08-07 | 2009-10-14 | 汪运山 | SiRNAs expression vector of stomach cancer target AFP gene and uses thereof |
CN102433352B (en) * | 2011-11-16 | 2013-11-13 | 中国科学技术大学 | MicroRNA structure-based construction method and function verification of hepatic cell selective multi-target interfering plasmid vector |
-
2012
- 2012-11-27 CN CN201210488901.0A patent/CN103031334B/en active Active
Also Published As
Publication number | Publication date |
---|---|
CN103031334A (en) | 2013-04-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Zhang et al. | Nectin-4 promotes gastric cancer progression via the PI3K/AKT signaling pathway | |
CN102304538B (en) | Construction and screening as well as applications for siRNAs expression carrier of stomach cancer target STAT3 gene | |
Liu et al. | MicroRNA155 in the growth and invasion of salivary adenoid cystic carcinoma | |
CN103031334B (en) | Dual-target siRNA eukaryotic expression plasmid capable of inhibiting STAT3 and AFP gene expression, and application of expression plasmid | |
CN104031884B (en) | The protein arginine transmethylase 7 application in cancer cell metastasis | |
CN109055374B (en) | shRNA for specifically inhibiting OCT1 gene expression and application thereof | |
CN105039342A (en) | siRNA capable of inhibiting MAT2A genetic expression and application of siRNA | |
CN102558336B (en) | The albumen and application of PRR11 genes and its coding | |
CN108823315A (en) | Detect the application that the reagent of fen1 gene expression dose is invaded in the reagent of transfer in preparation for diagnosing and predicting liver cancer | |
CN103849620A (en) | PC9 cell strain knocked down or over-expressed by TAZ as well as construction method and application of PC9 cell strain | |
CN101705227B (en) | SiRNA for inhibiting human AP-2alpha gene expression and anti-cervical cancer application thereof | |
CN101481688B (en) | SiRNA for inhibiting human KCTD1 gene expression and use thereof in pharmacy | |
CN114672460B (en) | Preparation method and application of CD 44-targeted heterogeneous CIC cell model | |
CN114032236B (en) | shRNA of TMEM2 and application thereof | |
CN101948859B (en) | shRNA expression vector expressed by specificity inhibitor SET protein, construction method and application thereof | |
CN103131710B (en) | ShRNA (short hairpin ribonucleic acid) for inhibiting tumor cell invasion | |
CN104450781B (en) | A kind of cell line of overexpression CIAPIN1 albumen and its preparation method and application | |
CN111575384A (en) | Application of human GLT8D1 gene in clinical diagnosis and treatment of tumor | |
CN110241085A (en) | A kind of human bladder cancer's T24/DDP cell strain that NPM1 is knocked out | |
CN102041270B (en) | Construction and screening of siRNAs (small interfering RANs) expression vectors of gastric cancer targeted DEC1 (differentiated embryo-chondrocyte expressed gene 1) and application thereof | |
CN103773768B (en) | A kind ofly disturb the siRNA of HIP-55 and the application in antitumor thereof | |
CN107753956A (en) | A kind of targeted inhibition agent of RAX2 genes and application thereof | |
CN103667295B (en) | siRNA for FOXC1 gene expression inhibition, and application thereof | |
CN110885798A (en) | Recombinant oncolytic adenovirus targeting prostate cancer and construction method and application thereof | |
CN117517657B (en) | Application of LNX1 gene or protein in regulation of avian innate immune response |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |