CN107630086B - SNP molecular marker related to HBV infection and application thereof - Google Patents
SNP molecular marker related to HBV infection and application thereof Download PDFInfo
- Publication number
- CN107630086B CN107630086B CN201711110782.4A CN201711110782A CN107630086B CN 107630086 B CN107630086 B CN 107630086B CN 201711110782 A CN201711110782 A CN 201711110782A CN 107630086 B CN107630086 B CN 107630086B
- Authority
- CN
- China
- Prior art keywords
- seq
- genotype
- locus
- hbv infection
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
An HBV infection related SNP molecular marker and application thereof belong to the technical field of biology, the invention relates to a detection reagent for judging HBV infection risk degree, which detects that the SNP locus is rs2227513 locus; the detection reagent detects whether the rs2227513 locus is an AG genotype; a primer for detecting HBV infection risk is disclosed, wherein a forward primer and a reverse primer are respectively shown as SEQ ID N01-2, and a TaqMan fluorescent probe primer sequence is shown as SEQ ID N03 and SEQ ID N04; a detection kit for detecting HBV infection risk comprises a detection reagent for detecting whether the rs2227513 locus is an AG genotype or not and the primers; the invention provides a reliable and sensitive mode for clinical evaluation of the hepatitis B virus infection risk, and the detection process is simple and convenient, has low cost and is beneficial to clinical popularization.
Description
Technical Field
The invention belongs to the field of biotechnology, and particularly relates to an SNP (single nucleotide polymorphism) marker related to Hepatitis B Virus (HBV) infection, a primer pair and a kit for detecting the SNP marker, and application of the SNP marker in detection of HBV susceptibility and prevention of hepatitis B virus infection.
Background
Hepatitis b virus infection is currently one of the most serious health problems in humans. Worldwide, a 20 million population has been infected with HBV, about 3.5 million population has chronic infection, and about 100 million people die each year from liver disease caused by hepatitis B virus infection. China is a high-risk area infected by hepatitis B virus, 1.2 hundred million people in China are estimated to carry the hepatitis B virus for a long time, and the hepatitis B virus infection not only seriously harms the health of human beings, but also causes a series of social and economic problems, and is one of the most prominent public health problems in China at the present stage.
The virus and the body are contradictory, and the virus can infect people in the infection and pathogenesis of HBV (hepatitis B virus) because genes related to infectivity exist in the body. A large number of molecular biology researches prove that the infection of hepatitis B virus is associated with a plurality of genes such as a cytokine IL-22 (interleukin 22) in a human body, and the cytokine can generate a plurality of complex interactions with viruses invading in host cells to influence the occurrence, development and prognosis of virus infectious diseases. IL-22 is produced by activated Th22, Thl7, gamma T, and NK cells, and the limiting component of the IL-22 receptor complex, IL-22R1, is strongly expressed in the closed epithelial cells of the skin, kidney, digestive and respiratory organs, which are the external barriers of the body that are in permanent contact with the external environment. The research shows that IL-22 can activate JAK/STAT signal path after being combined with the receptor, and induce phosphorylation of molecules such as STAT1, 3, 5 and the like; IL-22 induces production of a variety of antimicrobial peptides by epithelial cells of the skin and mucosa, both immature Dendritic Cells (DCs) and CD4+T cells produce chemotaxis and thus play an important role in the natural immune response against pathogen invasion; IL-22 can reduce liver cell injury, prevent liver failure, improve liver steatosis, promote hepatocyte proliferation after hepatectomy, inhibit hepatocyte apoptosis, and protect liver; IL-22 promotes HepG2 cell proliferation and protects against apoptosis induced by serum starvation, due to the regulation of IL-22 induced anti-apoptosis (e.g., Bcl-xL, Mcl-1) and mitogenesis (e.g., cyclin D1, c-myc, and Rb2), and transient over-expression of IL-22 in mice also protects against liver damage induced by carbon tetrachloride and Fas activation.
SNPs (single nucleotide polymorphisms) are DNA sequence polymorphisms caused by single nucleotide variations, including base transitions, transversions, insertions, and deletions. Usually, the SNP is 2 allelic polymorphism, and the SNP has stable mutation and is easy for large-scale high-flux rapid detection, so that the SNP has obvious advantages in the research of the relation between host gene heterogeneity and virus susceptibility. In recent years, many studies show that the gene polymorphism of the cytokine can influence the differential expression and secretion of the cytokine among individuals, further cause the difference of immune response to hepatitis B virus infection among individuals and finally influence the outcome after virus infection. It is found that IFN-gamma +874A/A is related to the susceptibility of chronic HBV infection, the frequency of ATA haplotype in IL-10 gene promoter region in asymptomatic HBV carrier group is obviously higher than that in chronic hepatitis B group and liver cirrhosis group, and it is closely related to the disease progression of virus infection. In addition, IL-10 gene promoter region-592A allele is a high risk factor for HBV persistent infection, and IL-10 gene promoter region-592A allele and-819C allele are associated with acute liver failure after hepatitis B infection. As the IL-22 gene is the latest member of the IL-10 gene family and a brand new type of cytokine, the significant positive results of the SNP of the gene and the large-scale group case-control correlation study of HBV susceptibility are rarely reported.
Disclosure of Invention
The invention further analyzes one SNP site of the 5' untranslated region of the IL-22 gene related to HBV infection in total 1113 samples of 494 cases of HBV infected persons and 619 cases of healthy people. Statistical results show that the rs2227513 locus of the IL-22 gene has significant difference in genotype frequency distribution in two groups of samples, and the AG genotype frequency in a healthy control group is significantly higher. The invention provides a marker for detecting the infection risk of hepatitis B virus, and the marker has high clinical application value.
The invention aims to solve the technical problem that whether a person to be detected has infection risk or not is detected and analyzed by detecting SNP sites related to hepatitis B virus infection, the person to be detected is screened out from the population and informed of taking corresponding preventive measures in advance, and the aims of prevention-oriented and prevention-control combination are achieved.
Through intensive research on 1113 samples (494 cases of HBV infected persons and 619 cases of healthy control group), the inventor finds that the SNP locus rs2227513 of the IL-22 gene is closely related to the hepatitis B virus infection risk, and develops a kit capable of judging the HBV infection risk according to the result.
The invention provides a detection reagent for judging HBV infection risk, which is used for detecting that an SNP locus is an rs2227513 locus, and the detection reagent can be used for detecting whether the rs2227513 locus is an AG genotype.
The invention also provides a primer for detecting the HBV infection risk, wherein the primer comprises a nucleic acid sequence capable of amplifying the rs2227513 locus, and the primer sequence is as follows: the forward primer is shown as SEQ ID N01, and the reverse primer is shown as SEQ ID N02. The TaqMan fluorescent probe primers are shown as SEQ ID N03 and SEQ ID N04.
The present invention also provides a kit for detecting the genotype of a SNP site, which comprises reagents required for detecting SNP using any technique known in the art, as long as it can detect the genotype of the rs2227513 site in a sample. Preferably, the kit comprises a detection reagent for detecting whether the rs2227513 site is AG genotype.
The invention provides a detection kit for judging HBV infection risk, the judgment principle of the kit is to detect the genotype of rs2227513 locus by using a reagent in the kit, and the HBV infection risk is judged according to the genotype of the SNP locus of a detected individual. When the rs2227513 site genotype is heterozygous AG, the tested individual belongs to the crowd with low HBV infection risk, and the SNP site can evaluate the hepatitis B virus infection risk.
The invention also provides application of the rs2227513 locus in preparing a detection reagent for judging the individual HBV infection risk and application in preparing a kit for detecting the SNP locus genotype.
The invention also provides a method for detecting HBV infection protective factors for non-diagnostic purposes, which comprises the following steps:
1) extracting the genomic DNA of the extracorporeal peripheral blood;
2) detecting whether the rs2227513 site is AG genotype;
3) preferably, a genomic DNA whole blood extraction kit (Qiagen, Germany);
4) further, the rs2227513 site can be detected as AG genotype by methods well known to those skilled in the art for detecting single nucleotide polymorphism, including hybridization, melting, electrophoresis, sequencing, chemical, enzymatic, physical methods and their combination.
When the rs2227513 locus genotype in the extracorporeal peripheral blood is heterozygous AG, the tested individual sample contains HBV infection protective factors.
The SNP marker related to HBV infection provided by the invention can be used for large-scale detection of the morbidity risk of hepatitis B virus infection of people, provides a reliable and sensitive mode for clinical evaluation of the risk degree of hepatitis B virus infection, has simple and convenient detection process and low cost, and is beneficial to clinical popularization.
Drawings
FIG. 1 is a schematic diagram of the structure of IL-22 gene sequence and SNP sites
FIG. 2 is the electrophoresis chart of the PCR result of the amplification primers
Wherein: lanes 1-8 are PCR amplified fragments, lane 9 is a molecular weight marker 100bp DNA;
FIG. 3 is a sample peripheral venous blood genome electrophoresis diagram
Wherein: lanes 1-8 are genomic DNA samples, lane 9 is DNA Marker DL 2000;
FIG. 4 is a real-time fluorescent PCR amplification curve of rs2227513 site A/A homozygous genotype
FIG. 5 is a real-time fluorescent PCR amplification curve of the rs2227513 locus A/G heterozygous genotype
In fig. 4 and 5: the abscissa is the number of cycles; the ordinate is the fluorescence value of the nth cycle fluorescence reporter group minus the baseline
The normalized result obtained is Delta Rn.
Detailed Description
The invention will be further illustrated with reference to the following specific examples.
Example 1
1.1 study object
In this study, 1113 blood samples were collected, of which 494 cases of HBV-infected patients, 619 cases of normal control group, and HIV, HCV, and treponema pallidum infections were excluded simultaneously from both HBV-infected group and healthy control group. All subjects had no direct relationship with each other and all participating investigators had been informed of the purpose of the experiment and given oral or written consent.
1.2 methods of investigation
1.2.1 exclusion of HIV, HBV, HCV, TP infection of healthy group:
1.2.1.1 screening and determination of HIV antibodies
HIV antibody screening was carried out by using an HIV antibody diagnostic kit (double antigen sandwich enzyme-linked immunosorbent assay) produced by Zhuhaizhu reagent Ltd.
HIV (HIV1+2 type) antibodies were confirmed using an HIV (HIV1+2 type) antibody immunoblotting kit produced by MP biomedical Atlantic Co., Ltd. The qualitative enzyme immunity technology is adopted to detect HIV-1 and HIV-2 antibodies in human serum or plasma in vitro.
1.2.1.2 hepatitis B Virus surface antigen screening
The HBsAg is screened by a hepatitis B virus surface antigen (HBsAg) diagnostic kit (enzyme linked immunosorbent assay) produced by Beijing Wantai biological pharmaceutical industry GmbH.
1.2.1.3 hepatitis C Virus antibody screening
HCV antibodies were screened using a hepatitis C virus antibody diagnostic kit (enzyme linked immunosorbent assay) produced by Zhuhaizhu reagent Ltd.
1.2.1.4 Treponema pallidum antibody screening
The treponema pallidum antibody screening is carried out by adopting a treponema pallidum antibody diagnostic kit produced by Beijing Wantai biological pharmaceutical industry GmbH.
1.2.2 case group clinical serological test
Serum HBsAg, HBsAb, HBeAg, HBeAb and HBcAb were detected by a commercial enzyme-linked immunosorbent kit (Beijing Wantai biological pharmaceutical Co., Ltd.). Serum alanine transaminase levels were tested by clinical chemistry laboratories. The normal range is 0-40 IU/L.
1.3 results of the study
The general demographics of the case and control groups are summarized in table 1, including gender composition and age structure. Case group 494 cases of HBV-infected persons, 280 cases in men (56.7%), 214 cases in women (43.3%); the mean age was 26.61 + -7.11 years (minimum 16 years, maximum 61 years, median 25 years). The mean age of the control group (351 men/268 men) was 27.07 ± 6.87 (18 th-year minimum, 66 th-year maximum, and 26 th-year median), and there was no statistical difference in sex and age between the control group and the case group (P ═ 0.528 and 0.507).
Serological test indices for the case groups are summarized in Table 2 and include sex, serum alanine Aminotransferase (ALT) level, serum hepatitis B e-antigen level, and the like. Wherein, 304 cases with ALT less than or equal to 40IU/L account for 61.5 percent; and the proportion of 190 cases with ALT more than 40IU/L is 38.5 percent. 332 hepatitis B e antigen negative patients account for 67.2 percent; 162 cases of hepatitis B positive to e antigen account for 32.8 percent.
TABLE 1 general demographics of case and control groups
Table 1the general demographic characteristics of case and control
| Basic features | Case group (%) | Control group (%) | P |
| Sex (M/F) | 280/214(56.7％/43.3％) | 345/274(55.7％/44.3％) | 0.528a |
| Age (years) | 26.61±7.11 | 27.07±6.87 | 0.507a |
M: male, F: female, a Kolmogorov-Smirnov Z test, progressive significance (bilateral)
Table 2 serological test indices for case groups
Table 2Serological detectional index of case
ALT:alanine aminotransferase，HBeAg:hepatitis B e antigen
Example 2
2.1 selection of SNPs sites
Based on the early experimental work basis, the IL-22 gene is selected as a candidate gene, and the rs2227513 locus of the IL-22 gene is further selected. According to the data of the international human genome haplotype plan database (http:// www.hapmap.org) and the sequence determination result of the IL-22 gene of 73 collected Han population samples, the gene has no SNP site found in the exon region of the IL-22 gene of the Han population in China, and the rs2227513 site is located in a short small intron region between the first exon and the second exon of the 5' untranslated region of the gene (figure 1).
2.2 primer design
According to the complete sequence (access No. NT _ 029419.11: 30792244bp-30783674bp, minus strand) of the human IL-22 gene and rs2227513 site information provided by GenBank, 1 pair of PCR amplification primers (the PCR amplification result is shown in figure 2) and 1 pair of TaqMan fluorescent probe primers are designed and artificially synthesized by using Primer Premierversion 5.0(PREMIER Biosoft International, USA) software, the DNA sequence of the amplification region and the SNP site are shown in SEQ ID N05, and the designed Primer sequences are shown in Table 3.
TABLE 3PCR amplification primers and TaqMan fluorescent Probe primers
Table 3primers for PCR amplification and TaqMan fluorescent probeprimers
Example 3
3.1 extraction of human Whole blood genomic DNA
The collected 2ml of peripheral venous whole blood added with EDTA anticoagulant is stored in a low-temperature refrigerator at-80 ℃ until the extraction of genome DNA. Genomic DNA of mononuclear cells (PBMC) in 200. mu.l of whole Blood was extracted using QIAamp DNA Blood mini kit from QIAGEN, Germany. The method comprises the following specific steps:
(1) the samples, AE buffer or water were returned to room temperature before use.
(2) AWl, AW2 buffer and QIAGEN protease were determined to have been formulated as required.
(3) If a precipitate forms in the AL buffer, the solution is incubated at 70 ℃.
(4) All centrifugation was performed at room temperature.
(5) 20ul of proteinase K was added to the bottom of a 1.5ml microcentrifuge tube.
(6) 200ul of whole blood sample was added and mixed well with proteinase K.
(7) Add 200ul of AL buffer and mix by shaking for 15 seconds.
(8) Incubate at 56 ℃ for 10 minutes.
(9) Centrifuge rapidly for lO seconds.
(10) Adding 200u1 (96-100%) ethanol into the sample, shaking and uniformly mixing for 15 seconds, and quickly centrifuging for 10 seconds.
(11) Carefully add the mixture from step (v) to a QIAamp column (which is placed on a 2ml collection tube) without wetting the edges, close the lid, centrifuge at 8000rpm (6000 Xg) for 1 minute, and place the QIAamp column on a clean 2ml collection tube.
(12) The QIAamp column was carefully opened and 500ml AWl buffer was added without wetting the edges. The cover was closed and centrifuged at 8000rpm (6000 Xg) for 1 minute to replace the collection tube with a fresh one.
(13) The QIAamp column was carefully opened and 500ul AW2 buffer was added without wetting the edges. The lid was closed and centrifuged at 14000rpm (20000 Xg) for 3 minutes at full speed. Ensure that all AW2 buffer solution was removed from the filter in the middle of the centrifuge tube.
(14) The QIAamp column was placed on a clean 1.5ml microcentrifuge tube, the lid of the QIAamp tube was carefully opened, 200ul of AE buffer or sterile water was added, and the mixture was left at room temperature for 3 minutes. DNA samples were collected by centrifugation at 8000rpm (6000 Xg) for 1 minute.
Randomly selected partially extracted genomic DNA samples were electrophoresed on a 1% agarose gel to check the quality of the sample extraction (FIG. 3). All genome DNA samples are tested for purity under ultraviolet spectrophotometers of 260nm and 280nm, the concentration of the DNA is controlled to be more than 15ng/uL, the purity of the DNA is controlled to be between 1.6 and 1.9, and the DNA is stored in a refrigerator at the temperature of 20 ℃ below zero to facilitate the next experiment.
3.2SNP genotyping
Firstly, a genome segment containing SNP is amplified through PCR, and then the genotyping of SNP is realized through a Taqman fluorescent probe with specific sequence. The specific process is as follows: the prepared TaqMan PCR reaction solution is subpackaged in an 8-tube special for fluorescent quantitative PCR (PCR0208-C, Axygen company), and SNP genotyping is carried out on an ABI7500 fluorescent quantitative PCR instrument. After the reaction is finished, the genotype corresponding to each sample to be tested is judged according to the PCR amplification curve of the VIC and FAM fluorescence signals carried by the allele (figure 4 and figure 5).
Randomly extracting 5% of the proportion from the samples which are already genotyped, and rechecking the proportion to verify the accuracy and the repeatability of the genotyping; in addition, at least 3 blanks (redistilled water instead of DNA template) are needed for each test, and the negative control is regarded as the pollution existing in the experimental process if the amplification curve exists.
The 10ul TaqMan PCR reaction system components are described as follows:
the TaqMan PCR amplification reaction conditions are described as follows:
example 4
4.1 data analysis
The database of genotyping results was built using Excel 2003 and statistical tests assumed that the cases and controls were random independent samples from the target population. Haploview (version 4.2) was used to assess whether the genotype frequency distribution followed Hardy-Weinberg equilibrium. Chi for frequency comparison among groups2The ratio of the ratios of exposed to unexposed persons in the case group (a/b) to the ratio of exposed to unexposed persons in the control group (c/d) in the case-control study, OR (ad) was examined and calculated, giving OR ad/bc, a cross product ratio, which can be used as an estimate of relative risk. If x2P of<An association can be considered statistically significant if the 95% confidence interval of the 0.05 OR OR value does not contain the invalid hypothesis value of 1. The comparison of the above-mentioned data between groups was performed using PASW Statistics 18.0for Windows Statistics software.
4.2SNP site allele frequency and HWE test
The rs2227513 site gene frequency of IL-22 gene of the case and the control group was analyzed by Haploview (version 4.2) software, and HWE test was performed. The observed and expected values for the heterozygous genotype at the locus rs2227513, the frequency of the next allele and the P value of the Hadi-Weinberg equilibrium test for the genotype frequency for the two groups of samples are shown in Table 4. Results with a P value of HWE greater than 0.05 are generally required to be trusted, otherwise the presence of population structures in the samples makes the results erroneous. As can be seen from the table, the frequency distribution of the genotype at the rs2227513 site in both groups of samples was in accordance with Hardy-Weinberg equilibrium (Hardy-Weinberge quilibrium, HWE).
TABLE 4 allele frequencies and HWE test of rs2227513 locus in two groups of samples
Table 4allele frequency and HWE test for rs2227513loci in two groupsof samples
dbSNP:NCBI dbSNP database(http://www.ncbi.nlm.nih.gov/SNP)
ObsHET observation of heterozygous genotypes
PredHET heterozygous genotype expected value
MAF: frequency of minor allele
Probability of HWE p Val Hardy-Weinberg equilibrium detection
4.3 comparison between groups of SNP sites
The rs2227513 locus only shows two genotypes A/A, A/G in a case group and a control group, and the A/A genotype and the A allele are used as calculation bases when the frequency distribution of the genotypes between the statistical groups is different. The genotype was found to be 1A/G heterozygous in 494 HBV-infected patients, with a genotype frequency of 1.62% in the corresponding control group (Table 5). The difference between the A/G heterozygous genotype and the G allele Pearson' χ between the "HBV infected group" and the "control group2Values of 5.61 and 5.042, respectively, and corresponding P values of 0.018 and 0.025, respectively (two-sided test), indicate significant differences in the frequency distribution of AG heterozygous genotypes and G alleles between the two groups. The OR value, also known as the odd ratio (odd ratio), is an accurate estimate of the relative risk for a disease with a low incidence. An OR value greater than 1 indicates that the factor is a risk factor; an OR value less than 1 indicates that the factor is a protective factor. Therefore, the results of comparing the genotype frequencies of the rs2227513 locus of 494 cases of HBV infected persons and 619 cases of healthy persons show that the OR value of the genotype AG is 0.12, the 95% CI is 0.016-0.968, the upper limit is less than 1, which indicates that the HBV infection risk of the person carrying the AG genotype is lower, and the AG genotype is a protective factor against the HBV infection.
TABLE 5 comparison of frequency between polymorphism groups of the rs2227513 Gene
Table 5Comparison of frequencies of rs2227513polymorphism between twogroups
Sequence listing
---------------------------------------------------------------------
Sequence of SEQ ID NO.1
(i) Sequence characteristics: (A) length: -679 to-702 bp; (B) type (2): a nucleotide; (C) chain property: single-stranded.
(ii) Molecular type: nucleotide, its preparation and use
(iii) Description of the sequence: SEQ ID NO.1
GGAGATCAGATTTTCAGCATTAG
Sequence of SEQ ID NO.2
(i) Sequence characteristics: (A) length: +109 to + 128; (B) type (2): a nucleotide; (C) chain property: single-stranded.
(ii) Molecular type: nucleotide, its preparation and use
(iii) Description of the sequence: SEQ ID NO.2
AACCTGGTCGAAGACAACG
Sequence of SEQ ID NO.3
(i) Sequence characteristics: (A) length: +59bp to +85 bp; (B) type (2): a nucleotide; (C) chain property: single-stranded.
(ii) Molecular type: nucleotide, its preparation and use
(iii) Description of the sequence: SEQ ID NO.3
AGTATTTCATCAAACTAACCAATTG[C/T]
Sequence of SEQ ID NO.4
(i) Sequence characteristics: (A) length: +34bp to +59 bp; (B) type (2): a nucleotide; (C) chain property: single-stranded.
(ii) Molecular type: nucleotide, its preparation and use
(iii) Description of the sequence: SEQ ID NO.4
ACCAAGTTTGCCGAAACGCTTACCT
Sequence of SEQ ID NO.5
(i) Sequence characteristics: (A) length: -1bp to-771 bp; +1bp to +400 bp; (B) type (2): a nucleotide; (C) chain property: single-stranded.
(ii) Molecular type: nucleotide, its preparation and use
(iii) Description of the sequence: SEQ ID NO.5
Sequence listing
Sequence of SEQ ID NO.1
(i) Sequence characteristics: (A) length: -679 to-702 bp; (B) type (2): a nucleotide; (C) chain property: single-stranded.
(ii) Molecular type: nucleotide, its preparation and use
(iii) Description of the sequence: SEQ ID NO.1
GGAGATCAGATTTTCAGCATTAG
Sequence of SEQ ID NO.2
(i) Sequence characteristics: (A) length: +109 to + 128; (B) type (2): a nucleotide; (C) chain property: single-stranded.
(ii) Molecular type: nucleotide, its preparation and use
(iii) Description of the sequence: SEQ ID NO.2
AACCTGGTCGAAGACAACG
Sequence of SEQ ID NO.3
(i) Sequence characteristics: (A) length: +59bp to +85 bp; (B) type (2): a nucleotide; (C) chain property: single-stranded.
(ii) Molecular type: nucleotide, its preparation and use
(iii) Description of the sequence: SEQ ID NO.3
AGTATTTCATCAAACTAACCAATTG[C/T]
Sequence of SEQ ID NO.4
(i) Sequence characteristics: (A) length: +34bp to +59 bp; (B) type (2): a nucleotide; (C) chain property: single-stranded.
(ii) Molecular type: nucleotide, its preparation and use
(iii) Description of the sequence: SEQ ID NO.4
ACCAAGTTTGCCGAAACGCTTACCT
Sequence of SEQ ID NO.5
(i) Sequence characteristics: (A) length: -1bp to-771 bp; +1bp to +400 bp; (B) type (2): a nucleotide; (C) chain property: single-stranded.
(ii) Molecular type: nucleotide, its preparation and use
(iii) Description of the sequence: SEQ ID NO.5
-771 AAAATTTTAA GATGAACTAT ATCCATGGTA TTCTTTTATT TTAAAAAAAG TTTACATGTT
-711 AAGAAAAAAG GAGATCAGAT TTTCAGCATT AGTATTTACA AACTTAAGTT GATATTGATT
-651 ATAATTCAAT TAATACAATT TTAAGATATA TTTACTTCTG CCTTAATTGT TATGATCACT
-581 TAAAAATAGT TCCAAAAAGG GAAGAAAACA ATAATTAGAT TAGCCAAGAC AGTTATTTTT
-521 GAAACATAAG TCTGGTTTAG AATTCAGCAT GTTTAAAAAT GAGATAAAAT TATTTTAATA
-461 ATGGAATGAT CTGTTAGCTG TCATTACCAT TTACTTTAAA GCAGAGGATA TAGGACATGG
-401 GTCCTTTTTT TCTGATCACC TCCAATGAGA TAAGAATCTA TAAAGCTGGT AGGAAAATGA
-341 GTCCGTGACC AAAATGCTTA CTCAGCCACT ATAGGAGATC AAAACATTTT ATACTAAATC
-281 TGAACTCTAC TAAGACAAAA CAATTGTGTT CTTTGAAAAA TATGTAGGGT TTAGAAAATT
-221 TCTGGGATTT GTCTGTAAAA TACCCTCCGG GCTCTAATAG TGACGTTTTA GGGAAACACT
-161 TGCATCTCAA GGTGGAAAGG ATAGAGGTGG TGTTTTGTGG GCTCCTGTGG TGGTTAGGTC
-101 GTTCTCAGAA GACAGTACTG GAAATTAGAT AATTGCTGAT GTCATATTTT TCACAATTAA
-41 AAAAAAGTCA GTATCCTGGG GGCTATAAAA GCAGCAGCTT CTACCTTCCC CGTCACAAGC
20 AGAATCTTCA GAACAGGTAA GCGTTTCGGC AAACTTGGTA/G CAATTGGTTA GTTTGATGAA
80 ATACTTCTTG ACTAATTTTG TTCCTTCACG TTGTCTTCGA CCAGGTTCTC CTTCCCCAGT
140 CACCAGTTGC TCGAGTTAGA ATTGTCTGCA ATGGCCGCCC TGCAGAAATC TGTGAGCTCT
200 TTCCTTATGG GGACCCTGGC CACCAGCTGC CTCCTTCTCT TGGCCCTCTT GGTACAGGGA
260 GGAGCAGCTG CGCCCATCAG CTCCCACTGC AGGCTTGACA AGTCCAACTT CCAGCAGCCC
340 TATATCACCA ACCGCACCTT CATGCTGGCT AAGGAGGTAT ACATCTCAAT CCTGCTCTTT
Claims (1)
1. The application of the reagent for detecting whether the SNP locus rs2227513 is an A/G genotype or not in the preparation of the kit for judging the hepatitis B virus infection risk degree is characterized in that the kit comprises a primer for detecting the SNP locus, a forward primer is shown as SEQ ID N01, a reverse primer is shown as SEQ ID N02, and a TaqMan fluorescent probe primer sequence is shown as SEQ ID N03 and SEQ ID N04.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711110782.4A CN107630086B (en) | 2017-11-13 | 2017-11-13 | SNP molecular marker related to HBV infection and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711110782.4A CN107630086B (en) | 2017-11-13 | 2017-11-13 | SNP molecular marker related to HBV infection and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107630086A CN107630086A (en) | 2018-01-26 |
| CN107630086B true CN107630086B (en) | 2020-11-03 |
Family
ID=61108491
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711110782.4A Active CN107630086B (en) | 2017-11-13 | 2017-11-13 | SNP molecular marker related to HBV infection and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107630086B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105039581A (en) * | 2015-09-10 | 2015-11-11 | 吉林大学 | SNP mark related to woman PTC onset risks and application of SNP mark |
| CN105586424A (en) * | 2016-03-01 | 2016-05-18 | 浙江大学 | IL-6 gene SNP marker related to chronic hepatitis b virus (HBV) infection and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2303132T3 (en) * | 2003-08-07 | 2008-08-01 | Zymogenetics, Inc. | HOMOGENEAS PREPARATIONS OF IL-29. |
-
2017
- 2017-11-13 CN CN201711110782.4A patent/CN107630086B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105039581A (en) * | 2015-09-10 | 2015-11-11 | 吉林大学 | SNP mark related to woman PTC onset risks and application of SNP mark |
| CN105586424A (en) * | 2016-03-01 | 2016-05-18 | 浙江大学 | IL-6 gene SNP marker related to chronic hepatitis b virus (HBV) infection and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| IL-22和IL-17 mRNA在慢性HBV感染者PBMCs中的表达及其意义;杨智等;《世界华人消化杂志》;20121208;第20卷(第34期);第3380-3384页 * |
| Impact of IL-22 gene polymorphism on human immunodefificiency virus infection in Han Chinese patients;Jun Hu等;《Journal of Microbiology, Immunology and Infection》;20161231;第49卷(第6期);第872-878页 * |
| Jun Hu等.Impact of IL-22 gene polymorphism on human immunodefificiency virus infection in Han Chinese patients.《Journal of Microbiology, Immunology and Infection》.2016,第49卷(第6期),第872-878页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107630086A (en) | 2018-01-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mangia et al. | IL-10 haplotypes as possible predictors of spontaneous clearance of HCV infection | |
| Cai et al. | Comparison of three different HCV genotyping methods: core, NS5B sequence analysis and line probe assay | |
| Persico et al. | Elevated expression and polymorphisms of SOCS3 influence patient response to antiviral therapy in chronic hepatitis C | |
| Minton et al. | Clearance of hepatitis C virus is not associated with single nucleotide polymorphisms in the IL-1,-6, or-10 genes | |
| US20210079475A1 (en) | Methods and kits for determining a personalized treatment regimen for a subject suffering from a pathologic disorder | |
| Persico et al. | Interleukin-10− 1082 GG polymorphism influences the occurrence and the clinical characteristics of hepatitis C virus infection | |
| Wei et al. | Single nucleotide polymorphisms of toll-like receptor 7 and toll-like receptor 9 in hepatitis C virus infection patients from central China | |
| Sarvari et al. | The role of interferon gamma gene polymorphism (+ 874A/T,+ 2109A/G, and-183G/T) in response to treatment among hepatitis C infected patients in Fars Province, Southern Iran | |
| Pár et al. | IL28B and IL10R− 1087 polymorphisms are protective for chronic genotype 1 HCV infection and predictors of response to interferon-based therapy in an East-Central European cohort | |
| EP2787085B1 (en) | Use of hla-b*1301 allele | |
| Świątek-Kościelna et al. | Interleukin 10 gene single nucleotide polymorphisms in Polish patients with chronic hepatitis C: Analysis of association with severity of disease and treatment outcome | |
| Sheneef et al. | Interleukin-10 and interferon gamma gene polymorphisms and hepatitis C virus–related liver cirrhosis risk | |
| Ghazy et al. | Relation between HLA-DP/DQ polymorphisms, serum IP-10 and response to direct acting antiviral therapy among HCV infected patients | |
| CN110499368B (en) | SNP marker related to oral cancer prognosis prediction and application thereof | |
| Prasetyo et al. | The-1082 A allele of the interleukin-10 single nucleotide polymorphism-1082 G/A is associated with hepatitis virus co-infection in Indonesian Javanese HIV patients | |
| CN107630086B (en) | SNP molecular marker related to HBV infection and application thereof | |
| Ju et al. | Association of polymorphisms in key Th-17 immune response genes with HBeAg-positive chronic hepatitis B susceptibility and response to PEG-IFNa-2α | |
| Fawzy et al. | Association of Interleukin-27 rs 153109 single nucleotide polymorphism with spontaneous resolution of hepatitis C virus-genotype 4a infection in Egyptian patients | |
| CN108070647B (en) | Gene haplotype related to HBV infection and application thereof | |
| CN115679003A (en) | Compositions, systems and uses for predicting drug efficacy | |
| Abdel-Hamid et al. | Detection of BCL2 polymorphism in patient with hepatocellular carcinoma | |
| CN110029162B (en) | SNP marker for detecting susceptibility of systemic lupus erythematosus in non-coding gene region and application thereof | |
| CN109504763B (en) | Molecular marker for predicting efficacy of interferon-alpha for treating hepatitis B patients | |
| Ali et al. | Interleukin-37 gene polymorphism and susceptibility to pulmonary tuberculosis among Iraqi patients | |
| Ibrahim et al. | Polymorphism within the 5’UTR genomic region of hepatitis G virus (HGV) isolated from beta-thalassemia population in Iraq |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |