CN108070647B - Gene haplotype related to HBV infection and application thereof - Google Patents

Abstract

The genotype related to HBV infection and the application thereof belong to the technical field of biology, and the inventor conducts intensive research on the genotype of a promoter region of an IL-22 gene in a large sample. A haplotype C-T-G (OR 0.12) was obtained that was significantly associated with the risk of HBV infection; a haplotype T-C-a (OR 0.54) was also obtained that was significantly associated with the risk of disease progression after HBV infection. The molecular marker of the IL-22 gene related haplotype provided by the invention is used for detecting hepatitis B virus infection and liver related disease progression risk after infection, and has high clinical application value. The invention provides a reliable and sensitive mode for clinically evaluating the hepatitis B virus infection risk and the liver-related disease progression risk after infection, and has simple and convenient detection process and low cost, thereby being beneficial to clinical popularization.

Description

Gene haplotype related to HBV infection and application thereof

Technical Field

The invention belongs to the field of biotechnology, and particularly relates to an IL-22 gene haplotype related to Hepatitis B Virus (HBV) infection, a primer pair and a kit for constructing an SNP marker of the haplotype, and application of the IL-22 gene haplotype in detection of HBV infection risk and liver related disease progression risk after infection.

Background

Hepatitis b virus infection is currently one of the most serious public health problems for humans. The immune tolerance of the immune system after host HBV infection is mainly generated and maintained by HBeAg (hepatitis B e antigen), HBeAg exists in HBV core in a concealed form, and HBcAg loses a part of amino acid and changes the spatial structure after being metabolized in vivo to form soluble protein with another antigen activity, which is an important serum marker for obvious replication and strong infectivity of hepatitis B virus. HBeAg positivity indicates that the immune tolerance of the host is broken, and the immune system can start to recognize and attack liver cells infected by HBV, so that the liver damage mediated by immune response is caused. Thus, HBeAg positive patients tend to have higher HBV DNA titers and more severe liver damage. The probability of the HBeAg positive patient suffering from serious liver damage and then progressing to cirrhosis within 5 years is 12-20%; the probability of the child of the HBeAg positive pregnant woman breaking through HBV infection is 9.26 percent, which is obviously higher than that of the child of the HBeAg negative pregnant woman (0.23 percent), and the child infected by HBV after the newborn is inoculated with the vaccine is more likely to suffer from hepatocellular carcinoma; a few patients with HBeAg-positive chronic hepatitis even progress directly to hepatocellular carcinoma (HCC) without cirrhosis. Thus, patients who are HBeAg positive are at a higher risk of disease transmission and progression than patients who are HBeAg negative.

A large number of molecular biological researches prove that HBV infection and pathogenesis are related to a plurality of genes such as a cytokine IL-22 (interleukin 22) in a human body, and the cytokine can generate a plurality of complex interactions with viruses invading in host cells to influence the occurrence, development and prognosis of virus infectious diseases. IL-22 is produced by activated Th22, Thl7, gamma delta T, and NK cells, and the limiting component of the IL-22 receptor complex, IL-22R1, is strongly expressed in the closed epithelial cells of the skin, kidney, digestive and respiratory organs, which are the external barriers of the body that are in permanent contact with the external environment. IL-22 can activate JAK/STAT signal pathway after being combined with a receptor, and induce phosphorylation of molecules such as STAT1, 3, 5 and the like; IL-22 induces production of a variety of antimicrobial peptides by epithelial cells of the skin and mucosa, both immature Dendritic Cells (DCs) and CD4⁺T cells produce chemotaxis and thus play an important role in the natural immune response against pathogen invasion; IL-22 can reduce liver cell injury, prevent liver failure, improve liver steatosis, and promote liver resectionProliferation of liver cells, inhibition of apoptosis of liver cells and protection of liver; IL-22 promotes HepG2 cell proliferation and resists apoptosis induced by serum starvation, due to the regulation of IL-22 induced anti-apoptosis (e.g., Bcl-xL, Mcl-1) and mitogenesis (e.g., cyclin D1, c-myc, and Rb2), and transient overexpression of IL-22 in mice also protects against liver damage induced by carbon tetrachloride and Fas activation.

It has been found that the frequency of two SNP alleles occurring simultaneously in a population is often significantly different from the expected random frequency, and this linkage disequilibrium state (1inkage disequilibrium, LD) makes a group of related SNP alleles on a chromosome or in a region tend to be inherited as a whole to the offspring, and a plurality of SNPs in these positions, which are relatively close, constitute a haplotype block. In fact, most chromosomal regions have only a few common haplotypes, which represent most of the human-to-human polymorphisms in a population. Haplotypes differ from SNPs in polymorphism, are not usually biallelic in nature, and include genetic information from multiple SNPs, so studying the association of haplotypes with disease can yield more comprehensive and useful information about molecular mechanisms of organism susceptibility. Research finds that IFN-gamma +874A/A is related to susceptibility of chronic HBV infection, and the frequency of ATA haplotype in IL-10 gene promoter region in asymptomatic HBV carrier group is obviously higher than that in chronic hepatitis B group and liver cirrhosis group, and is closely related to disease progression of virus infection. In addition, IL-10 gene promoter region-592A allele is a high risk factor for HBV persistent infection, and IL-10 gene promoter region-592A allele and-819C allele are associated with acute liver failure after hepatitis B infection. The IL-22 gene is a latest member of the IL-10 gene family and a brand new type of cytokine, and the significant positive results of the haplotype of the gene and the large-scale group case control correlation study related to HBV infection are rarely reported.

Disclosure of Invention

The invention provides an in-depth research on collected 494 cases of HBV infected persons and 619 cases of healthy individuals, and 3 SNP sites of a promoter region of an IL-22 gene related to HBV infection and an rs2227484, rs2227485, rs2227513 and the like of a 5' untranslated region in a total of 1113 cases. Data analysis results show that the frequency distribution of haplotype C-T-G of IL-22 gene in the infected group and the control group samples has significant difference, and the haplotype C-T-G distribution frequency in the HBV infected group is significantly lower [ P ═ 0.014, OR ═ 0.12(CI ═ 0.02-0.91) ]. The haplotype T-C-A of the IL-22 gene has significant difference in frequency distribution in an HBeAg positive group and a control group, and the haplotype T-C-A frequency in the HBeAg positive group is significantly lower [ P is 0.02, OR is 0.12(CI is 0.54(0.32-0.91) ].

The invention aims to solve the technical problem that the infection risk of hepatitis B virus of a detected person and the progression risk of relevant diseases of the liver after infection are analyzed by detecting relevant haplotypes of IL-22 gene, the hepatitis B virus is screened from the population, and corresponding preventive measures are informed in advance to achieve the purposes of prevention-oriented and prevention-control combination.

The inventor detects the genotypes of 3 SNP sites of a putative promoter region of IL-22 gene of more than one thousand hundred related samples by a TaqMan fluorescent probe method, and constructs the individual gene haplotype by PHASE software. 3 SNP sites in the population are found to constitute only 4 haplotypes, namely C-T-A, C-C-A, T-C-A, C-T-G, wherein the haplotype C-T-G is closely related to the risk of hepatitis B virus infection, and the haplotype T-C-A is closely related to the risk of liver-related disease progression after HBV infection.

The invention provides a detection reagent for judging HBV infection risk and liver related disease progression risk after HBV infection, which detects 3 SNP loci such as rs2227484, rs2227485, rs2227513 and the like according to a TaqMan fluorescence probe method, constructs an individual gene haplotype according to the genotype of the SNP loci of the detected individual, and judges the individual HBV infection risk and the liver related disease progression risk after infection according to the individual gene haplotype. When the haplotype is C-T-G, the tested individual belongs to the population with low risk of HBV infection; when the haplotype is T-C-A, the individuals tested belong to a population with a low risk of progression of liver-related diseases after HBV infection.

The invention provides a primer for detecting HBV infection risk and liver-related disease progression risk after infection, and the primer can amplify nucleotide sequences including rs2227484, rs2227485 and rs2227513 loci. The primer sequences are as follows: the forward primer is shown as SEQ ID N01, and the reverse primer is shown as SEQ ID N02. The TaqMan fluorescent probe primer sequence is shown as SEQ ID N03, SEQ ID N04, SEQ ID N05, SEQ ID N06, SEQ ID N07 and SEQ ID N08.

The invention provides application of haplotype A-T-G in evaluating the infection risk of hepatitis B virus.

The invention provides application of haplotype T-C-A in evaluating the risk of liver-related disease progression after hepatitis B virus infection.

The invention also provides application of the rs2227484, rs2227485 and rs2227513 loci in preparing a detection reagent for judging individual HBV infection risk and liver-related disease progression risk after HBV infection, and application in preparing a kit for detecting SNP locus genotype.

The invention also provides a method for detecting HBV infection protective factors and liver-related disease progression protective factors after infection, which is not used for diagnosis, and the detection method comprises the following steps:

1) extracting the genomic DNA of the extracorporeal peripheral blood;

2) preferably, a genomic DNA whole blood extraction kit (Qiagen, Germany);

3) detecting the genotypes of the locus rs2227484, rs2227485 and rs2227513 of the IL-22 gene;

4) inferring the genohaplotype of the individual;

5) preferably, the individual genohaplotypes are constructed using the PHASE software.

When the IL-22 gene haplotype in the extracorporeal peripheral blood is C-T-G, the tested individual sample contains HBV infection protective factor. When the IL-22 gene haplotype in the extracorporeal peripheral blood is T-C-A, the tested individual contains protective factors for liver related disease progression after HBV infection.

The IL-22 gene haplotype related to HBV infection provided by the invention can be used for large-scale detection of hepatitis B virus infection and liver related disease morbidity risk of people, provides a reliable and sensitive mode for clinical evaluation of HBV infection risk and liver related disease progression risk after infection, has simple and convenient detection process and low cost, and is beneficial to clinical popularization.

Drawings

FIG. 1 is a schematic diagram of the structure of IL-22 gene sequence and SNP sites

FIG. 2 is a sample peripheral venous blood genome electrophoresis diagram

Wherein: lanes 1-8 are genomic DNA samples, lane 9 is DNA Marker DL 2000;

FIG. 3 is a real-time fluorescent PCR amplification curve of rs2227484 site C/C homozygous genotype

FIG. 4 is a real-time fluorescent PCR amplification curve of rs2227484 locus C/T heterozygous genotype

FIG. 5 is a real-time fluorescent PCR amplification curve of rs2227484 locus T/T homozygous genotype

FIG. 6 is a real-time fluorescent PCR amplification curve of rs2227485 site C/C homozygous genotype

FIG. 7 is a real-time fluorescent PCR amplification curve of rs2227485 site C/T heterozygous genotype

FIG. 8 is a real-time fluorescent PCR amplification curve of rs2227485 site T/T homozygous genotype

In fig. 3 to 8: the abscissa is the number of cycles; the ordinate is the normalized result of the fluorescence value of the nth cycle fluorescent reporter group minus the baseline, i.e., Delta Rn.

Detailed Description

The invention will be further illustrated with reference to the following specific examples.

Example 1

1.1 study object

In this study, 1113 blood samples were collected, of which 494 cases of HBV-infected patients, 619 cases of normal control group, and HIV, HCV, and treponema pallidum infections were excluded simultaneously from both HBV-infected group and healthy control group. All subjects had no direct relationship with each other and all participating investigators had been informed of the purpose of the experiment and given oral or written consent.

1.2 results of the study

The general demographics of the case and control groups are summarized in table 1, including gender composition and age structure. Case group 494 cases of HBV-infected persons, 280 cases in men (56.7%), 214 cases in women (43.3%); the mean age was 26.61 + -7.11 years (minimum 16 years, maximum 61 years, median 25 years). The mean age of the control group (351 men/268 men) was 27.07 ± 6.87 (18 th-year minimum, 66 th-year maximum, and 26 th-year median), and there was no statistical difference in sex and age between the control group and the case group (P ═ 0.528 and 0.507).

Serological test indices for the case groups are summarized in Table 2 and include sex, serum alanine Aminotransferase (ALT) level, serum hepatitis B e-antigen level, and the like. Wherein, 304 cases with ALT less than or equal to 40IU/L account for 61.5 percent; and the proportion of 190 cases with ALT more than 40IU/L is 38.5 percent. 332 hepatitis B e antigen negative patients account for 67.2 percent; 162 cases of hepatitis B positive to e antigen account for 32.8 percent.

TABLE 1 general demographics of case and control groups

Table 1the general demographic characteristics of case and control

Basic features	Case group (%)	Control group (%)	P
				Sex (M/F)	280/214(56.7％/43.3％)	345/274(55.7％/44.3％)	0.528a
Age (1)years)	26.61±7.11	27.07±6.87	0.507a

M: male, F: female, a Kolmogorov-Smirnov Z test, progressive significance (bilateral)

Table 2 serological test indices for case groups

Table 2Serological detectional index of case

ALT:alanine aminotransferase，HBeAg:hepatitis B e antigen

Example 2

2.1 selection of SNPs sites

Based on the experimental work of the previous stage, the IL-22 gene is selected as a candidate gene. According to the data of an international human genome haplotype map planning database (http:// www.hapmap.org) and the determination result of the whole gene sequence of the IL-22 gene of 73 collected Han population samples, the gene has no SNP site found in the exon region of the IL-22 gene of Han population in China. Three sites rs2227484, rs2227485 and rs2227513 of the IL-22 gene are further selected as target sites for case-to-control correlation analysis, wherein the sites rs2227484 and rs2227485 are positioned in a putative promoter region at the upstream of the IL-22 gene, and the site rs2227513 is positioned in a short small intron region between a first exon and a second exon in a 5' untranslated region of the gene (figure 1).

2.2 primer design

Based on the complete sequence of human IL-22 gene provided by GenBank (access No. NT-029419.11: 30792244bp-30783674bp, minus strand) and rs2227484, rs2227485, rs2227513 site information, 1 pair of PCR amplification primers (the PCR amplification result is shown in figure 2) and 3 pairs of TaqMan fluorescence probe primers are designed and artificially synthesized by using Primer Premier Version 5.0(PREMIER Biosoft International, USA) software, the DNA sequence of the amplification region and the SNP site are shown in SEQ ID N09, and the designed Primer sequences are shown in Table 3.

TABLE 3PCR amplification primers and TaqMan fluorescent Probe primers

Table 3primers for PCR amplification and TaqMan fluorescent probe primers

Example 3

3.1 extraction of human Whole blood genomic DNA

The collected 2 ml of peripheral venous whole blood added with EDTA anticoagulant is stored in a low-temperature refrigerator at-80 ℃ until the extraction of genome DNA. Genomic DNA of mononuclear cells (PBMC) in 200. mu.l of whole Blood was extracted using QIAamp DNA Blood mini kit from QIAGEN, Germany. The specific procedures are described in the QIAamp DNA Blood mini kit.

Randomly selected genomic DNA samples after partial extraction were electrophoresed on 1% agarose gel to check the quality of the sample extraction (FIG. 2). All genome DNA samples are tested for purity under ultraviolet spectrophotometers of 260nm and 280nm, the concentration of the DNA is controlled to be more than 15ng/uL, the purity of the DNA is controlled to be between 1.6 and 1.9, and the DNA is stored in a refrigerator at the temperature of 20 ℃ below zero to facilitate the next experiment.

Genotyping of 3.23 SNP sites

Firstly, amplifying a DNA fragment containing a corresponding SNP locus by PCR, and then realizing the genotyping of the SNP by a Taqman fluorescent probe with specific sequence. The specific process is as follows: the prepared TaqMan PCR reaction solution is subpackaged in an 8-tube special for fluorescent quantitative PCR (PCR0208-C, Axygen company), and SNP genotyping is carried out on an ABI7500 fluorescent quantitative PCR instrument.

3.2.1rs2227484 locus PCR reaction system components and reaction conditions are described as follows:

10ul TaqMan PCR reaction system components

TaqMan PCR amplification reaction conditions:

after the reaction is finished, the genotype corresponding to each sample to be tested is judged according to the PCR amplification curve of the VIC and FAM fluorescence signals carried by the allele (figure 4, figure 5 and figure 6).

3.2.2rs2227485 site PCR reaction system components and reaction conditions are described as follows:

10ul TaqMan PCR reaction system components:

TaqMan PCR amplification reaction conditions:

after the reaction is finished, the genotype corresponding to each sample to be tested is judged according to the PCR amplification curve of the VIC and FAM fluorescence signals carried by the allele (figure 7 and figure 8).

3.2.3rs2227513 site PCR reaction system components and reaction conditions are described as follows:

10ul TaqMan PCR reaction system components:

TaqMan PCR amplification reaction conditions:

all the samples after completing genotyping at the 3 sites need to randomly draw part of samples according to a proportion of 5% for rechecking so as to verify the accuracy and repeatability of genotyping; in addition, at least 3 blanks (redistilled water instead of DNA template) are needed for each test, and the negative control is regarded as the pollution existing in the experimental process if the amplification curve exists.

EXAMPLE 4 construction of IL-22 Gene haplotype in individuals

The Excel 2003 is used for establishing a genotyping result database of all samples at 3 sites, and then the PHASE software is used for constructing gene haplotypes aiming at the genotype data of a population. The software uses Bayesian statistics to process sites for SNPs, microsatellites and other multiallelic forms (e.g., tristate SNPs and HLA alleles).

The software must run with the command prompt window of the virtual DOS. The PHASE software is not required to be installed, and the program is called under DOS to complete calculation analysis. Inputting ' cmd ' or ' command ' into a DOS system in ' start ' running ' at the lower left corner of a display screen of the personal computer, entering a folder where phase.exe is located by using a ' cd ' command, and typing ' phase.exe '. The method has the advantages that the PHASE application program (phase.exe) and the data file are put together, operation can be conveniently conducted under the DOS dynamic environment, the program and the data to be analyzed are both placed under a root directory of a certain partition (such as a D disk), and after operation is finished, results are generated under the same path.

The data file identified by the PHASE software needs to be a text file in txt format, the format of the input file needs to strictly refer to the corresponding format, and the format needs to be distinguished from case to case. And editing data by using the notebook, uniformly spacing the data by using a space key, not allowing commas to appear, and storing the data as text in a txt format after finishing. Open my computer > tools > folder options > view > remove the pair number in front of the extension hiding the known file type in the advanced settings and click to determine. And then, the file name suffix of the input data is changed from the. The file name is preferably in english.

Data for healthy control 619 sample genotypes construction were compiled in the following format:

and other sample data editing formats to be processed refer to the formats, and after the sample data formats are edited, calling corresponding data files in the virtual DOS window. Entering a folder where the PHASE software and the data file to be processed are located, inputting PHASE health-619.inp health-619.out, representing a data file with a running file name of health-619, and outputting the data file to a result file with a file name of health-619. After the operation is finished, a plurality of files with the names of health-619 are output, and the files are opened by using the notebook. Where health-619.out presents a brief case in the operation, health-619.out _ freqs lists the frequency of each haplotype, and health-619.out _ calls lists the most likely haplotype composition for each person.

The partial operation results of the health-619.out file are as follows:

example 5 haplotype frequency Association analysis

Statistical tests assume that cases and controls are random independent samples from the target population. Haploview (version 4.2) is utilized to evaluate whether the gene frequency distribution of 3 SNPs isoloci of the IL-22 gene of an individual conforms to Hardy-Weinberg equilibrium rule. Chi for frequency comparison among groups²Testing and calculating the ratio of ratios (OR), in case-control studies, the ratio of the number of exposed to unexposed persons in the case group (a/b) to the number of exposed to unexposed persons in the control group (c/d), to give OR ad/bc, hence the cross-product ratio, which can beUsed as an estimate of the relative risk. If x²P of<An association can be considered statistically significant if the 95% confidence interval of the 0.05 OR OR value does not contain the invalid hypothesis value of 1. The comparison of the above-mentioned data between groups was performed using PASW Statistics 18.0for Windows Statistics software.

5.1SNP site allele frequency and HWE test

The rs2227484, rs2227485 and rs2227513 site gene frequencies of IL-22 genes of the case and the control group are analyzed by using Haploview (version 4.2) software, and HWE (HWE test) is carried out. The observed and expected values of heterozygous genotypes at each site of the two groups of samples, the frequency of the next allele and the P value of the Hardy-Weinberg equilibrium test of the genotype frequency are shown in Table 4. Results with a P value of HWE greater than 0.05 are generally required to be trusted, otherwise the presence of population structures in the samples makes the results erroneous. As can be seen from the table, the frequency distribution of the genotypes at 3 sites in both groups of samples was in accordance with Hardy-Weinberg equilibrium (HWE).

TABLE 4 allele frequencies and HWE test of 3 sites in two groups of samples

Table 4allele frequency and HWE test for rs2227513loci in two groups of samples

dbSNP:NCBI dbSNP database(http://www.ncbi.nlm.nih.gov/SNP)

ObsHET observation of heterozygous genotypes

PredHET heterozygous genotype expected value

MAF: frequency of minor allele

Probability of HWE p Val Hardy-Weinberg equilibrium detection

5.2 comparison between groups of haplotype frequencies

In the two groups of population samples in the research, 3 SNPs sites of the IL-22 gene promoter region form 4 haplotypes, namely C-T-A, C-C-A, T-C-A, C-T-G and the like. When the distribution of the haplotypes among the groups was statistically different, the haplotype C-T-A was used as a comparison criterion. C-T-G frequency was 0.1% in HBV-infected group, correspondingThe frequency of this haplotype in the control group was 0.81% (Table 5), Pearson χ²The value was 6.08, corresponding to a P value of 0.014 (two-sided test), indicating that there was a significant difference in the frequency distribution of the C-T-G haplotype between the two groups. The frequency of the T-C-A haplotype in the HBeAg positive group was 5.7%, and the frequency of the haplotype in the corresponding control group was 9.1% (Table 6), Pearson χ²The probability is 0.02 (double-sided test), which indicates that the frequency of T-C-A gene haplotype in hepatitis B virus e antigen positive group is obviously lower than that of control group, and the frequency difference between groups is obvious.

The OR value, also known as the odd ratio (odd ratio), is an accurate estimate of the relative risk for a disease with a low incidence. An OR value greater than 1 indicates that the factor is a risk factor; an OR value less than 1 indicates that the factor is a protective factor. The results of comparison between the frequency of the C-T-G haplotype in the HBV-infected group and the control group showed that the haplotype had an OR value of 0.12, 95% CI of 0.02-0.91 and an upper limit of less than 1, indicating that the risk of HBV infection is lower in the patients with the C-T-G haplotype, and that the C-T-G haplotype is a protective factor against HBV infection. The results of the comparison between the T-C-A haplotype frequency of the hepatitis B virus e antigen positive group and the control group show that the OR value of the haplotype is 0.54, the 95% confidence interval of the OR value is 0.32-0.91, the upper limit of the confidence interval is less than 1, which indicates that the risk of the disease transmission and the liver-related disease progression after HBV infection of a person carrying the T-C-A haplotype is lower, and the T-C-A haplotype is a protective factor of the HBV transmission and the liver-related disease progression.

TABLE 5 frequency comparison of IL-22 Gene promoter region haplotypes in control and HBV case groups

TABLE 6 comparison of haplotype frequencies of the promoter region of the IL-22 gene in the control group with HBeAg negative and with HBeAg positive groups

a:Pearson Chi-Square Continuity Correction

b:the value of the weight variable was zero,such cases are invisible to statistical OR

Sequence listing

Sequence listing

<110> Jilin university

<120> genotype related to HBV infection and use thereof

<141> 2021-04-21

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 1

ggagatcagattttcagcattag 23

<210> 2

<211> 19

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 2

aacctggtcgaagacaacg 19

<210> 3

<211> 26

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

ccagacttatgtttcaaaaataact[a/g] 26

<210> 4

<211> 25

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

tcttggctaatctaattattgtttt 25

<210> 5

<211> 26

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

taaaatgttttgatctcctatagtg[a/g] 26

<210> 6

<211> 25

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

ctgagtaagcattttggtcacggac 25

<210> 7

<211> 26

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

agtatttcatcaaactaaccaattg[c/t] 26

<210> 8

<211> 25

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

accaagtttgccgaaacgcttacct 25

<210> 9

<211> 1140

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 9

-771 aaaattttaa gatgaactat atccatggta ttcttttatt ttaaaaaaag tttacatgtt

-711 aagaaaaaag gagatcagat tttcagcatt agtatttaca aacttaagtt gatattgatt

-651 ataattcaat taatacaatt ttaagatata tttacttctg ccttaattgt tatgatcact

-581 taaaaatagt tccaaaaagg gaagaaaaca ataattagat tagccaagac/t agttattttt

-521 gaaacataag tctggtttag aattcagcat gtttaaaaat gagataaaat tattttaata

-461 atggaatgat ctgttagctg tcattaccat ttactttaaa gcagaggata taggacatgg

-401 gtcctttttt tctgatcacc tccaatgaga taagaatcta taaagctggt aggaaaatga

-341 gtccgtgacc aaaatgctta ctcagc/tcact ataggagatc aaaacatttt atactaaatc

-281 tgaactctac taagacaaaa caattgtgtt ctttgaaaaa tatgtagggt ttagaaaatt

-221 tctgggattt gtctgtaaaa taccctccgg gctctaatag tgacgtttta gggaaacact

-161 tgcatctcaa ggtggaaagg atagaggtgg tgttttgtgg gctcctgtgg tggttaggtc

-101 gttctcagaa gacagtactg gaaattagat aattgctgat gtcatatttt tcacaattaa

-41 aaaaaagtca gtatcctggg ggctataaaa gcagcagctt ctaccttccc cgtcacaagc

20 agaatcttca gaacaggtaa gcgtttcggc aaacttggta/g caattggtta gtttgatgaa

80 atacttcttg actaattttg ttccttcacg ttgtcttcga ccaggttctc cttccccagt

140 caccagttgc tcgagttaga attgtctgca atggccgccc tgcagaaatc tgtgagctct

200 ttccttatgg ggaccctggc caccagctgc ctccttctct tggccctctt ggtacaggga

260 ggagcagctg cgcccatcag ctcccactgc aggcttgaca agtccaactt ccagcagccc

340 tatatcacca accgcacctt catgctggct aaggaggtat acatctcaat cctgctcttt

Claims (1)

1. The application of a primer and probe combination in preparing a reagent for detecting HBV infection risk and liver-related disease progression risk after infection is characterized in that the primer and probe combination comprises a forward primer, a reverse primer and a TaqMan fluorescent probe primer, wherein the forward primer is shown as SEQ ID NO.1, the reverse primer is shown as SEQ ID NO.2, and the TaqMan fluorescent probe primer sequence is shown as SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO. 8;

the reagent is used for detecting whether the genotypes of the three sites rs2227484, rs2227485 and rs2227513 form a haplotype T-C-A.

Images