CN107630086A

CN107630086A - A kind of SNP marker related to HBV infection and its application

Info

Publication number: CN107630086A
Application number: CN201711110782.4A
Authority: CN
Inventors: 胡军; 赵锦; 陈琳; 杨峥嵘; 赵广录; 石向东
Original assignee: Jilin University
Current assignee: Jilin University
Priority date: 2017-11-13
Filing date: 2017-11-13
Publication date: 2018-01-26
Anticipated expiration: 2037-11-13
Also published as: CN107630086B

Abstract

A kind of SNP marker related to HBV infection and its application category biological technical field, a kind of detection reagent for judging HBV infection risk factor of the invention detect SNP site as rs2227513 sites；Whether the detection reagent detection rs2227513 sites are AG genotype；A kind of primer for detecting HBV infection risk factor, its forward primer, reverse primer are respectively as shown in SEQ ID N01 2, and TaqMan fluorescence probes primer sequence is as shown in SEQ ID N03 and SEQ ID N04；A kind of detection kit for detecting HBV infection risk factor includes whether detection rs2227513 sites are the detection reagent of AG genotype and above-described primer；The present invention provides a kind of reliable, sensitive mode for the hepatitis b virus infected risk factor of clinical evaluation, and testing process is easy, cost is cheap, is advantageous to clinical expansion.

Description

A kind of SNP marker related to HBV infection and its application

Technical field

The invention belongs to biological technical field, and in particular to hepatitis type B virus (HBV) infects related SNP marker and is used for The primer pair and kit of above-mentioned SNP marker are detected, and hepatitis b virus infected aspect is detected and prevent in HBV neurological susceptibilities Application.

Background technology

Hepatitis B virus infection is one of presently the most serious health problem of the mankind.The whole world is accumulative have 2,000,000,000 populations once by HBV infection, the existing chronic infection of 3.5 hundred million populations is there are about, there are about 1,000,000 people to die from the liver as caused by hepatitis B virus infection every year Disease.China is the high-risk area of hepatitis B virus infection, it is estimated that there are the long-term Hepatitis B carrier of 1.2 hundred million people, hepatitis B in China Infection has not only seriously endangered the health of the mankind, while has also triggered the problem of a series of social and economic, is present stage of china One of the most prominent public health problem.

Virus and two aspects that body is contradictory, in HBV infection and pathogenic process, virus why can People is infected firstly because existing in body and infectious related gene.Research has shown that in terms of substantial amounts of molecular biology, second Numerous gene-correlation connection such as cell factor IL-22 (interleukin-22 2), cell factor energy and host in the infection of hepatovirus and human body The virus invaded into the cell occurs the interaction of Various Complex and influences the generation, development and prognosis of disease of viral infection. IL-22 is produced by cells such as the Th22, Thl7, gamma delta T and NK that activate, and the limitation composition IL-22R1 of IL-22 receptor complexes is strong Strong is expressed in the closing epithelium confluent monolayer cells of skin, kidney, digestion and respiratory system organ, and the epithelial cell of these organs is With the body external barrier of external environment permanent contact.Research shows IL-22 by that can activate JAK/STAT after being combined with acceptor Signal path, induce the equimolecular phosphorylation in STAT1,3,5；IL-22 can be produced with the epithelial cell of induced skin and mucous membrane Raw a variety of antibacterial peptides, to immature dendritic cell (dendritic cells, DCs) and CD4⁺T cell produces chemotaxis, So as to be played an important role during the innate immunity of resistance pathogen invasion；IL-22 can reduce liver cell damage Hepatocyte growth, the apoptosis of suppression liver cell after wound, prevention liver failure, the steatosis for improving liver, promotion hepatectomy, There is protective effect to liver；IL-22 can promote HepG2 cells to breed and resist by the Apoptosis of serum starvation induction, This comes from IL-22 induction of anti-apoptotic (such as Bcl-xL, Mcl-1) and mitogenesis (such as cyclin D1, c-myc, and Rb2 regulation), IL-22 temporary transient overexpression can also protect the liver by carbon tetrachloride and Fas activation inductions to damage in mouse Wound.

SNP (single nucleotide polymorphisms, SNP) is made a variation by single nucleotide acid Caused DNA sequence polymorphism, including the form such as conversion, transversion, insertion and missing of base.Usual SNP is 2 equipotential bases Because of polymorphism, SNP possesses mutation stabilization, is easy to extensive high-throughout quick detection, so it is different in research host gene Possesses obvious advantage between matter and virus susceptibility during relation.In recent years, many studies have shown that cytokine gene is polymorphic Performance enough influences the differential expression of cell factor and secretion between individual, and then triggers and exempt from for hepatitis b virus infected between individual The difference of epidemic disease response, it is final to influence the metainfective final result of virus.Studies have found that IFN-γ+874A/A and chronic HBV infection Neurological susceptibility is related, and frequency of the IL-10 gene promoter areas ATA haplotypes in Asymptomatic HBV carrier group is apparently higher than chronic Hepatitis B group and liver cirrhosis group, it is in close relations with the progression of disease of virus infection.In addition, IL-10 gene promoter areas -592A Allele is the high-risk factor of HBV persistent infections, and IL-10 gene promoter areas -592A allele and -819C Allele with it is hepatitis B infected after acute hepatic failure it is relevant.IL-22 genes are used as the newest member of IL-10 gene families and complete The cell factor of new type, the significant sun of the large-scale groups case-control association study of SNP and the HBV neurological susceptibility of the gene Property result is rarely reported.

The content of the invention

The present invention by 494 HBV infection persons to collection and 619 healthy populations, altogether 1113 samples and HBV Infect the in-depth analysis of a SNP site of 5 ' non-translational regions of related IL-22 genes.Statistical result showed, IL-22 genes Genotype frequency distribution of the rs2227513 sites in two groups of samples significant difference be present, AG genes in healthy control group Type frequency is significantly higher.The invention provides one kind to mark, and for detecting hepatitis b virus infected risk, has very high face Bed application value.

The technical problems to be solved by the invention are to pass through detection and hepatitis b virus infected related SNP site, inspection Survey and whether analysis subject has infection risk, it is screened from crowd, advance notice takes corresponding prevention to arrange Apply, reach the purpose of putting prevention first and combining prevention with control.

Inventor by the further investigation to 1113 samples (wherein 494 HBV infection persons, healthy control group 619), It is found that SNP site rs2227513 and the hepatitis b virus infected risk factor of IL-22 genes are closely related, and develops accordingly It can interpolate that the kit of HBV infection risk factor.

The invention provides a kind of detection reagent for judging HBV infection risk factor, it is rs2227513 that it, which detects SNP site, Site, the detection reagent can detect whether rs2227513 sites are AG genotype.

Present invention also offers a kind of primer for detecting HBV infection risk factor, the primer includes expanding Nucleotide sequence including rs2227513 sites, primer sequence are as follows：Forward primer is as shown in SEQ ID N01, reverse primer As shown in SEQ ID N02.TaqMan fluorescence probes primer is as shown in SEQ ID N03 and SEQ ID N04.

Present invention also offers the kit for detecting SNP site genotype, the kit is included using this area The reagent needed for any technology for detection SNP known, as long as it can detect the genotype in rs2227513 sites in sample.It is preferred that , described kit include detection rs2227513 sites whether be AG genotype detection reagent.

The invention provides the detection kit for judging HBV infection risk factor, the judgement principle of the kit is profit With the genotype in the reagent detection rs2227513 sites in kit, sentenced according to the genotype for the above-mentioned SNP site for surveying individual Its disconnected HBV infection risk factor.When rs2227513 loci gene types are heterozygosis AG, it is low that tested individual belongs to HBV infection risk factor Crowd, the SNP site can evaluate hepatitis b virus infected risk factor.

Present invention also offers rs2227513 sites to prepare a kind of detection reagent for judging individual HBV infection risk factor In application and prepare detection SNP site genotype kit in application.

Present invention also offers a kind of method of the detection HBV infection protective factors of non-diagnostic purpose, described detection side Method includes:

1) genomic DNA of in vitro peripheral blood is extracted；

2) detect whether rs2227513 sites are AG genotype；

Preferably, 3) genomic DNA whole blood extracts kit (German Qiagen companies)；

4) can further be detected by the method for the single nucleotide polymorphism of detection well known to those skilled in the art Whether rs2227513 sites are AG genotype, including hybrid method, melt method, electrophoresis, PCR sequencing PCR, chemical method, zymetology method, thing Logos and combinations thereof method.

When rs2227513 loci gene types are heterozygosis AG in the in vitro peripheral blood, tested individual specimen contains HBV infection Protect sex factor.

A kind of SNP marker related to HBV infection provided by the invention, it can be used to detect Hepatitis B In People disease on a large scale Malicious infection morbidity risk, a kind of reliable, sensitive mode is provided for the hepatitis b virus infected risk factor of clinical evaluation, and examined Flow gauge is easy, cost is cheap, is advantageous to clinical expansion.

Brief description of the drawings

Fig. 1 is IL-22 gene orders structure and includes SNP site schematic diagram

Fig. 2 is amplimer PCR result electrophoretograms

Wherein：Swimming lane 1-8 is pcr amplified fragment, and swimming lane 9 is molecular weight marker 100bp DNA；

Fig. 3 is sample peripheric venous blood genome electrophoretogram

Wherein：Swimming lane 1-8 is genome DNA sample, and swimming lane 9 is DNA Marker DL2000；

Fig. 4 is rs2227513 sites A/A homozygous genotype real-time fluorescent PCR amplification curves

Fig. 5 is rs2227513 sites A/G heterozygous genotypes real-time fluorescent PCR amplification curves

In Fig. 4 and Fig. 5：Abscissa is period；Ordinate is that the fluorescent value of n-th of circulation fluorescent reporter group deducts base Line

The standardization result obtained afterwards, i.e. Delta Rn.

Embodiment

With reference to specific embodiment, the present invention is expanded on further.

Embodiment 1

1.1 research object

This research have collected 1113 blood preparations, wherein HBV infection person 494, Normal group 619, HBV infection Group and healthy control group all exclude HIV, HCV, infection by Treponema pallidum simultaneously.Closed between all research objects without lineal relative System, all participation researchers have been apprised of experiment purpose, and oral or written consent.

1.2 research method

1.2.1 the exclusion of health group HIV, HBV, HCV, TP infection:

1.2.1.1HIV the examination and determination of antibody

It is (double-antigen sandwich enzyme linked immune using the diagnostic kit of the HIV antibody of Zhuhai Lizhu Reagent Co., Ltd's production Method) carry out HIV antibody examination.

HIV (HIV1+2 types) antibody immunoblotting kit pair produced using MP biomedicines Asia-Pacific private limited partnership HIV (HIV1+2 types) antibody is confirmed.Using qualitative Immunoenzyme techniques, to HIV-1 and HIV-2 antibody in human serum or blood plasma Carry out vitro detection.

1.2.1.2 hepatitis b virus s antigen examination

Diagnosed using the hepatitis b virus s antigen (HBsAg) of Beijing Wantai Biological Pharmacy Enterprise Co., Ltd.'s production Kit (ELISA) carries out examination to HBsAg.

1.2.1.3 antibody of HCV examination

The hepatitis C virus antibody diagnostic kit (ELISA) produced using Zhuhai Lizhu Reagent Co., Ltd Examination HCV antibody.

1.2.1.4 syphilis helicoid antibody examination

Plum is carried out using the treponema pallidum antibody diagnostic kit of Beijing Wantai Biological Pharmacy Enterprise Co., Ltd.'s production Malicious helicoid antibody examination.

1.2.2 case group clinical serum is examined

The enzyme-linked immunosorbent assay kit that the detection of serum HBsAg, HBsAb, HBeAg, HBeAb, HBcAb passes through commercialization (Beijing Tso Biological Pharmaceutical Co).The horizontal detection of serum alanine aminotransferase is completed by clinical chemistry laboratory.It is just Normal scope is 0~40IU/L.

1.3 result of study

The general population characteristic of case group and control group is summarized in table 1, including sex composition and age composition.Case group 494 HBV infection persons, male's 280 (56.7%), women 214 (43.3%)；Average age is 26.61 ± 7.11 years old (pole Small value 16 years old, maximum 61 years old, median 25 years old).Control group (man 351/268) average age is 27.07 ± 6.87 (poles Small value 18 years old, maximum 66 years old, median 26 years old), the sex composition of control group and case group, age difference are poor without statistics Different (P=0.528 and 0.507).

The Serologic detection index of case group is summarized in table 2, including sex, serum alanine aminotransferase (ALT) are horizontal And serum hepatitis B virus e antigen level etc..Wherein ALT≤40IU/L person 304, accounting 61.5%；ALT ＞ 40IU/L persons 190, account for Than 38.5%.Hepatitis B virus e antigen negative patient 332, accounting 67.2%；Hepatitis B virus e antigen positive 162, accounting 32.8%.

The general population characteristic of the case group of table 1 and control group

Table 1the general demographic characteristics of case and control

Essential characteristic	Case group (%)	Control group (%)	P
				Sex (M/F)	280/214 (56.7%/43.3%)	345/274 (55.7%/44.3%)	0.528^a
Age (years)	26.61±7.11	27.07±6.87	0.507^a

M：male,F：female,a:Kolmogorov-Smirnov Z test, progressive conspicuousness (bilateral)

The Serologic detection index of the case group of table 2

Table 2Serological detectional index of case

ALT:Alanine aminotransferase, HBeAg:hepatitis B e antigen

Embodiment 2

The selection in 2.1SNPs sites

Experimental work basis based on early stage, it is candidate gene to choose IL-22 genes, further chooses IL-22 genes Rs2227513 sites.According to international HapMap plan database (http://www.hapmap.org) number According to, and the IL-22 gene complete genome sequence measurement results of collected 73 the Hans' samples show that the gene is in Chinese Han nationality The exon region of crowd's IL-22 genes does not find SNP site, and rs2227513 sites are located at 5 ' untranslateds of the gene One short and small between area's First Exon and Second Exon is included in sub-district (Fig. 1).

2.2 design of primers

According to complete sequence (the access No.NT_029419.11 of the GenBank mankind's IL-22 genes provided： 30792244bp-30783674bp, minus strand) and rs2227513 site informations, utilize Primer Premier Version 5.0 (PREMIER Biosoft International, USA) software, devising 1 pair of pcr amplification primer thing, (PCR expands Increase result and see Fig. 2) and 1 pair of TaqMan fluorescence probes primer and artificial synthesized, amplification region DNA sequence dna and SNP site such as SEQ Shown in ID N05, designed primer sequence is shown in Table 3.

Table 3PCR amplimers and TaqMan fluorescence probe primers

Table 3primers for PCR amplification and TaqMan fluorescent probe primers

Embodiment 3

3.1 people's Whole Blood Genomic DNAs are extracted

The peripheral vein whole blood for the 2 milliliters of addition EDTA anti-coagulants collected is positioned over -80 DEG C of low temperature refrigerators and preserved, until The extraction of genomic DNA.Utilize the QIAamp DNA Blood mini kit genome extracts kits of German QIAGEN companies Extract the genomic DNA of monocyte (PBMC) in 200ul whole bloods.Comprise the following steps that：

(1) by sample, AE buffer solutions or water using being preceding returned to room temperature.

(2) determine that AWl, AW2 buffer solution and QIAGEN protease are prepared on request.

(3) if there is precipitation to be formed in AL buffer solutions, dissolving is incubated in 70 DEG C.

(4) all centrifugations are carried out at room temperature.

(5) 20ul Proteinase K is added to 1.5ml microcentrifugation bottom of the tube.

(6) 200ul whole blood samples are added fully to mix with Proteinase K.

(7) 200ul AL buffer solutions are added, vibration mixes 15 seconds.

(8) 56 DEG C are incubated 10 minutes.

(9) the lO seconds are quickly centrifuged.

(10) 200u1 (96~100%) ethanol is added into sample, and vibration mixes 15 seconds, quick centrifugation 10 seconds.

(11) mixture during carefully 5. the is walked is added in QIAamp posts (collecting pipe of the post positioned at a 2ml On), not get edge wet, shut lid, 8000rpm (6000 × g) is centrifuged 1 minute, by QIAamp posts be placed on one it is clean On 2ml collecting pipes.

(12) QIAamp posts are carefully opened, 500ml AWl buffer solutions is added, not get edge wet.Shut lid, 8000rpm (6000 × g) is centrifuged 1 minute, the collecting pipe more renewed.

(13) QIAamp posts are carefully opened, 500ul AW2 buffer solutions is added, not get edge wet.Close the lid, at full speed Centrifuge 14000rpm (20000 × g) 3 minutes.Ensure that whole AW2 buffer solutions depart from the filter membrane among centrifuge tube.

(14) QIAamp pillars are placed on a clean 1.5ml microcentrifugal tube, carefully open QIAamp pipes Lid, adds 200ul AE buffer solutions or sterilized water, and room temperature is placed 3 minutes.8000rpm (6000 × g) is centrifuged 1 minute, is collected DNA sample.

Randomly select the electrophoresis detection sample extraction on 1% Ago-Gel of the genome DNA sample after extracting section Quality (Fig. 3).All genome DNA samples detect purity under 260nm and 280nm ultraviolet specrophotometers, need to control DNA Concentration is more than 15ng/uL, and DNA purity is stored in the experiment that -20 DEG C of refrigerators are easy to next step between 1.6-1.9.

3.2SNP Genotyping

The genomic fragment containing SNP is expanded by PCR first, it is then real by the Taqman fluorescence probe of sequence specific Existing SNP Genotyping.Detailed process is as follows：The TaqMan PCR reaction solutions prepared are sub-packed in quantitative fluorescent PCR special 8 In union (PCR0208-C, Axygen company), SNP Genotypings are carried out on ABI7500 quantitative real time PCR Instruments.Reaction terminates Afterwards, the genotype according to corresponding to each sample to be tested of VIC and FAM fluorescence signal PCR amplification curve interpretations that allele carries (Fig. 4 and Fig. 5).

The ratio that 5% is randomly selected from the sample for completed Genotyping is rechecked, to verify Genotyping Accuracy and repeatability；In addition detection at least needs to set 3 blank controls (redistilled water replaces DNA profiling) every time, cloudy Property control if amplification curve be considered as in experimentation exist pollution.

10ul TaqMan PCR reaction system compositions are described as follows：

TaqMan pcr amplification reaction conditions are described as follows：

Embodiment 4

4.1 data analysis

Genotypic results database is established using Excel 2003, statistical test assumes that case is from compareing In the random independent sample of target group.Whether met using Haploview (version 4.2) evaluation genotype frequency distributions Hardy-Weinberg Balances.Frequency, which compares, between each group uses χ²Examine, and ratio calculated ratio (Odds ratio, OR), OR In case-control study, refer in case group exposure and exposure in the ratio (a/b) and control group of non-exposed number with it is non- The ratio of the ratio (c/d) of exposure number, draws OR=ad/bc, so being called crossed product ratio, the value can be used as relative risk Estimate.If χ²P<95% credibility interval of 0.05 or OR values does not include null hypothesis value 1, it is possible to thinks that association is It is statistically significant.The PASW Statistics 18.0for Windows statistical softwares that are compared with of data enter between above-mentioned group OK.

4.2SNP alleles and HWE are examined

With Haploview (version 4.2) software analysis cases and control group IL-22 gene rs2227513 sites base Because of frequency, and carry out HWE inspections.It is the observed value and desired value of the heterozygous genotypes in the rs2227513 sites of two groups of samples, inferior The P values that the frequency of position gene, the Hardy-Weinberg equilibrium of genotype frequency are examined are shown in Table 4.Typically require that HWE P values are more than 0.05 result is just credible, not so population structure be present in sample so that result has error.As seen from the table, two groups of samples The frequency distribution of rs2227513 loci gene types all meets Hardy-Weinberg balances (Hardy-Weinberg Equilibrium, HWE).

The gene frequency and HWE in 4 two groups of sample rs2227513 sites of table are examined

Table 4allele frequency and HWE test for rs2227513loci in two groups of samples

dbSNP:NCBI dbSNP database(http://www.ncbi.nlm.nih.gov/SNP)

obsHET:Heterozygous genotypes observed value

PredHET:Heterozygous genotypes desired value

MAF：Secondary gene frequency

HWE p Val:The probability of Hardy-Weinberg equilibrium detection

Compare between the group in 4.3SNP sites

Rs2227513 sites only find two kinds of genotype of A/A, A/G, the base between statistics group in case group and control group During because of type frequency distribution difference, using A/A genotype and A allele as calculating benchmark.1 is found in 494 HBV infection persons A/G heterozygous genotypes, the genotype frequency is 1.62% (table 5) in corresponding control group.A/G heterozygous genotypes and G equipotential bases Because of the group difference Pearson χ in " HBV infection group " and " control group "²Value is respectively 5.61 and 5.042, corresponding P values difference For 0.018 and 0.025 (two-sided test), it is aobvious to illustrate that the frequency distribution of AG heterozygous genotypes and G allele between two groups is present The difference of work.OR values are also known as odds ratio (odd ratio), and for the very low disease of the incidence of disease, its OR values are phase To the fine estimation of risk factor.OR values are more than 1, and it is a hazards to represent the factor；OR values be less than 1, then it represents that this because Element is a protection factor.Therefore, the genotype frequency in the rs2227513 sites of 494 HBV infection persons and 619 healthy populations Comparative result shows between rate group, and genotype AG OR values are 0.12,95%CI 0.016-0.968, and the upper limit is less than 1, and explanation is taken Band AG genotype person's HBV infection risks are lower, and AG genotype is resistant to the protective factors of HBV infection.

The comparison of frequency between table 5rs2227513 gene pleiomorphism groups

Table 5Comparison of frequencies of rs2227513polymorphism between two groups

Sequence table

--------------------------------------------------------------------------

SEQ ID NO.1 sequence

(i) sequence signature：(A) length：- 679 to -702bp；(B) type：Nucleotides；(C) chain：It is single-stranded.

(ii) molecule type：Nucleotides

(iii) sequence description：SEQ ID NO.1

GGAGATCAGATTTTCAGCATTAG

SEQ ID NO.2 sequence

(i) sequence signature：(A) length：+ 109 to+128；(B) type：Nucleotides；(C) chain：It is single-stranded.

(ii) molecule type：Nucleotides

(iii) sequence description：SEQ ID NO.2

AACCTGGTCGAAGACAACG

SEQ ID NO.3 sequence

(i) sequence signature：(A) length：+ 59bp to+85bp；(B) type：Nucleotides；(C) chain：It is single-stranded.

(ii) molecule type：Nucleotides

(iii) sequence description：SEQ ID NO.3

AGTATTTCATCAAACTAACCAATTG[C/T]

SEQ ID NO.4 sequence

(i) sequence signature：(A) length：+ 34bp to+59bp；(B) type：Nucleotides；(C) chain：It is single-stranded.

(ii) molecule type：Nucleotides

(iii) sequence description：SEQ ID NO.4

ACCAAGTTTGCCGAAACGCTTACCT

SEQ ID NO.5 sequence

(i) sequence signature：(A) length：- 1bp to -771bp；+ 1bp to+400bp；(B) type：Nucleotides；(C) chain： It is single-stranded.

(ii) molecule type：Nucleotides

(iii) sequence description：SEQ ID NO.5

Sequence table

SEQ ID NO.1 sequence

　　　（i）Sequence signature：（A）Length：- 679 to -702bp；（B）Type：Nucleotides；（C）Chain：It is single-stranded.

　　　（ii）Molecule type：Nucleotides

　　　（iii）Sequence description：SEQ ID NO.1

　　　GGAGATCAGATTTTCAGCATTAG

SEQ ID NO.2 sequence

　　　（i）Sequence signature：（A）Length：+ 109 to+128；（B）Type：Nucleotides；（C）Chain：It is single-stranded.

　　　（ii）Molecule type：Nucleotides

　　　（iii）Sequence description：SEQ ID NO.2

　　　AACCTGGTCGAAGACAACG

SEQ ID NO.3 sequence

　　　（i）Sequence signature：（A）Length：+ 59bp to+85bp；（B）Type：Nucleotides；（C）Chain：It is single-stranded.

　　　（ii）Molecule type：Nucleotides

　　　（iii）Sequence description：SEQ ID NO.3

　　　AGTATTTCATCAAACTAACCAATTG[C/T]

SEQ ID NO.4 sequence

　　　（i）Sequence signature：（A）Length：+ 34bp to+59bp；（B）Type：Nucleotides；（C）Chain：It is single-stranded.

　　　（ii）Molecule type：Nucleotides

　　　（iii）Sequence description：SEQ ID NO.4

　　　ACCAAGTTTGCCGAAACGCTTACCT

SEQ ID NO.5 sequence

　　　（i）Sequence signature：（A）Length：- 1bp to -771bp；+ 1bp to+400bp；（B）Type：Nucleotides；（C）Chain Property：It is single-stranded.

　　　（ii）Molecule type：Nucleotides

　　　（iii）Sequence description：SEQ ID NO.5

-771 AAAATTTTAA GATGAACTAT ATCCATGGTA TTCTTTTATT TTAAAAAAAG TTTACATGTT

-711 AAGAAAAAAG GAGATCAGAT TTTCAGCATT AGTATTTACA AACTTAAGTT GATATTGATT

-651 ATAATTCAAT TAATACAATT TTAAGATATA TTTACTTCTG CCTTAATTGT TATGATCACT

-581 TAAAAATAGT TCCAAAAAGG GAAGAAAACA ATAATTAGAT TAGCCAAGAC AGTTATTTTT

-521 GAAACATAAG TCTGGTTTAG AATTCAGCAT GTTTAAAAAT GAGATAAAAT TATTTTAATA

-461 ATGGAATGAT CTGTTAGCTG TCATTACCAT TTACTTTAAA GCAGAGGATA TAGGACATGG

-401 GTCCTTTTTT TCTGATCACC TCCAATGAGA TAAGAATCTA TAAAGCTGGT AGGAAAATGA

-341 GTCCGTGACC AAAATGCTTA CTCAGCCACT ATAGGAGATC AAAACATTTT ATACTAAATC

-281 TGAACTCTAC TAAGACAAAA CAATTGTGTT CTTTGAAAAA TATGTAGGGT TTAGAAAATT

-221 TCTGGGATTT GTCTGTAAAA TACCCTCCGG GCTCTAATAG TGACGTTTTA GGGAAACACT

-161 TGCATCTCAA GGTGGAAAGG ATAGAGGTGG TGTTTTGTGG GCTCCTGTGG TGGTTAGGTC

-101 GTTCTCAGAA GACAGTACTG GAAATTAGAT AATTGCTGAT GTCATATTTT TCACAATTAA

-41 AAAAAAGTCA GTATCCTGGG GGCTATAAAA GCAGCAGCTT CTACCTTCCC CGTCACAAGC

20 AGAATCTTCA GAACAGGTAA GCGTTTCGGC AAACTTGGTA/G CAATTGGTTA GTTTGATGAA

80 ATACTTCTTG ACTAATTTTG TTCCTTCACG TTGTCTTCGA CCAGGTTCTC CTTCCCCAGT

140 CACCAGTTGC TCGAGTTAGA ATTGTCTGCA ATGGCCGCCC TGCAGAAATC TGTGAGCTCT

200 TTCCTTATGG GGACCCTGGC CACCAGCTGC CTCCTTCTCT TGGCCCTCTT GGTACAGGGA

260 GGAGCAGCTG CGCCCATCAG CTCCCACTGC AGGCTTGACA AGTCCAACTT CCAGCAGCCC

340 TATATCACCA ACCGCACCTT CATGCTGGCT AAGGAGGTAT ACATCTCAAT CCTGCTCTTT

Claims

1. a kind of detection reagent for judging HBV infection risk factor, it is characterised in that the detection reagent detects SNP site and is Rs2227513 sites.

2. the detection reagent according to claim 1 for judging HBV infection risk factor, it is characterised in that the detection reagent Detect whether rs2227513 sites are AG genotype.

3. a kind of primer for detecting HBV infection risk factor, it is characterised in that for its forward primer as shown in SEQ ID N01, its is anti- To primer as shown in SEQ ID N02, its TaqMan fluorescence probes primer sequence is as shown in SEQ ID N03 and SEQ ID N04.

4. a kind of detection kit for detecting HBV infection risk factor, it is characterised in that described kit includes detection Whether rs2227513 sites are primers described in the detection reagent and claim 3 of AG genotype.

5. application of the SNP site described in claim 1 in hepatitis b virus infected risk factor is evaluated.