CN107574229A - A kind of probe groups, kit and application for being used to detect oat chromosome - Google Patents
A kind of probe groups, kit and application for being used to detect oat chromosome Download PDFInfo
- Publication number
- CN107574229A CN107574229A CN201710985245.8A CN201710985245A CN107574229A CN 107574229 A CN107574229 A CN 107574229A CN 201710985245 A CN201710985245 A CN 201710985245A CN 107574229 A CN107574229 A CN 107574229A
- Authority
- CN
- China
- Prior art keywords
- probe
- avena
- alcohol
- slide
- chromosome
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of probe groups, kit and application for being used to detect oat chromosome.Probe groups include Aml, (ACT)6、(GAA)6、(TTG)6Four kinds of probes, wherein Aml base sequence are：5′‑GATCCATGTGTGGTTTGTGGAAAGAACAC ACATGCAATGACT CTAGTGGTT‑3′；(ACT)6Base sequence be：5′‑ACTACTACTACTACTACT‑3′；(GAA)6Base sequence be：5′‑GAAGAAGAAGAAGAAGAA‑3′；(TTG)6Base sequence be：5′‑TTGTTGTTGTTGTTGTTG‑3′.The probe groups are 18 51bp few sequence probes of identification oat chromosome, help to establish stable easily FISH reaction system.
Description
Technical field
The invention belongs to the application field of fluorescence in situ hybridization probe, and in particular to one kind is used to detect oat dye
Probe groups, kit and the application of colour solid.
Background technology
The method of existing detection oat chromosome has a C bands, GISH, FISH, etc..C bands can colour heterochromatin,
This heterochromatin is usually located at around centromere and often the DNA containing highly repetitive sequence, the picture that the method is observed are
Black and white picture, signal location are confined to around centromere.GISH, i.e. genomic in situ hybridization technology, it is with total genome sequence
For probe marker chromosome, probe prepares to require a large amount of high concentration genomic DNAs, and limitation is genome chromosome affiliation
It can not be distinguished when near, hybridization signal power will be influenceed by blockading ratio in addition, and slice, thin piece recycling difficulty is big, and experimental repeatability is not
By force, picture is colour.FISH, i.e. fluorescence in situ hybridization technique, more using hundreds of base DNA fragmentations as probe, concentration and probe concentration requirement
Relatively low, usage amount is few, can identify the nearly edge genome chromosome that GISH can not be identified, without blockading, slice, thin piece recycling
Easily, it is easy to carry out multiple hybrid experiment to same slice, thin piece, picture is polychrome.
Few sequence probe of the invention by designing, synthesizing the 18-51bp for detecting oat chromosome, establish
Stable easily FISH reaction system, the problems of existing oat chromosome detection are overcome, are swallow
The detection of wheat platymiscium chromosome provides new method.
The content of the invention
The problem of existing for prior art, the present invention provide a kind of probe for being used to detect oat chromosome
Group, kit and application.The technical scheme is that：
One side, a kind of probe groups for being used to detect oat chromosome of present invention offer, including Aml,
(ACT)6、(GAA)6、(TTG)6Four kinds of probes, wherein the Aml probes are made up of 51 base-pairs, its base sequence is：5′-
GATCCATGTGTGGTTTGTGGAAAGAACACACATGCAATGACTCTAGTGGTT-3 ', for specific recognition Avena C
All chromosomes of genome；(ACT)6The base sequence of probe is：5 '-ACTACTACTACTACTACT-3 ', for identifying
The part-structure of the part-structure of preference C genome portion chromosomes, also faint identification A chromosome group chromosome dyad；It is described
(GAA)6The base sequence of probe is：5 '-GAAGAAGAAGAAGAAGAA-3 ', for identifying that preference A and C genome portion contaminate
The part-structure of colour solid；(TTG)6The base sequence of probe is：5 '-TTGTTGTTGTTGTTGTTG-3 ', for identifying partially
Good A genome portions chromosomal section structure, the part-structure of faint identification C genome portion chromosomes.
Further, the Aml probes mark the 5 ' of its sequence to hold using FAM or TAMRA.
Further, described (ACT)6Probe marks the 5 ' of its sequence to hold using FAM or TAMRA.
Further, described (GAA)6Probe marks the 5 ' of its sequence to hold using FAM or TAMRA.
Further, described (TTG)6Probe marks the 5 ' of its sequence to hold using FAM or TAMRA.
Second aspect, the present invention provide a kind of kit for being used to detect oat chromosome, including：
(1) above-mentioned probe groups；
(2) enzymolysis liquid；
(3) 4% paraformaldehyde liquid；
(4) 2 × SSC buffer solutions；
(5) 70%FA liquid；
(6) hybridization solution.
Further, the compound method of the enzymolysis liquid is：0.04g celluloses are added in citrate buffer solution per 1mL
Enzyme and 0.02g pectases；The compound method of wherein citrate buffer solution is：DdH per 50mL2O adds 0.5707g trisodium citrates
With 0.4324g citric acids.
Further, the compound method of the 4% paraformaldehyde liquid is：It is more that 1 × PBS per 100mL adds 4g
Polyformaldehyde, the water-bath 2-3h in 60 DEG C of water-baths, wherein the compound method of the 1 × PBS is：Per 1000mL
ddH2O adds 8g sodium chloride, 0.2g potassium chloride, 1.42g disodium hydrogen phosphates and 0.27g potassium dihydrogen phosphates.
Further, the compound method of 2 × SSC buffer solutions is：DdH per 1000mL2O adds 8.823g citric acids
Trisodium and 17.532g sodium chloride.
Further, the 70%FA liquid by deionized formamide (FA) and 2 × SSC buffer solutions according to volume ratio 7:3 groups
Into.
Further, the hybridization solution is made up of 1 isometric × TE and 2 × SSC buffer solutions；Wherein 1 × TE preparation
Method is：DdH per 800mL21.211g Tris and 0.372g EDTANa are added in O2·2H2O, pH to 8.0 is adjusted with HCl, it is fixed
Hold 1000mL, produced after sterilizing.
3rd aspect, the present invention provide a kind of method for detecting oat chromosome, are to use above-mentioned examination
Agent box, comprises the following steps：
1) preparation of oat Chromosome glass slide sample：Oat seed is soaked with distilled water, is placed in 4
24h is placed in DEG C environment, sucks excessive moisture, and it is incubated in 22 DEG C, when tip of a root length is to 1.5~2.0cm, clip 1~
1.5cm organizations of root tips, use N successively2O processing 5h, glacial acetic acid processing 5min, are subsequently placed in 75% alcohol in -20 DEG C of preservations；
1~2mm of Root apical meristem is cut after the organization of root tips of Cord blood is cleaned with distilled water, is placed in enzymolysis liquid
45min is digested in 37 DEG C, removes enzymolysis liquid, successively with distilled water, 75% alcohol, 95% alcohol, the 100% alcohol washes tip of a root point
Room temperature is dried after raw tissue；Glacial acetic acid is added in organization of root tips suspension is made；Hanging drop is dried in the air in room temperature on slide
Microscopy after dry, the good slide of microscopy is in -20 DEG C of preservations；
2) FISH：Slide is placed in 4% paraformaldehyde and handles 10min, then with 2 × SSC buffer solutions
Handle twice, each 5min, then dried in the air successively with 75% alcohol, 95% alcohol, the processing of 100% alcohol gradient, each 5min, room temperature
70%FA liquid is added dropwise after dry, covered, 2min is denatured in 80 DEG C；
Slide denaturation is completed after 75% alcohol, 95% alcohol, 100% alcohol gradient that -20 DEG C are sequentially placed into 5s
Processing, each 5min, room temperature are dried；The hybridization solution for being placed with probe is added dropwise on the slide dried, 10 μ are added dropwise in every slide
L is placed with the hybridization solution of probe, wherein every kind of probe contains 0.5 μ L, remaining as hybridization solution；Covered, under dark condition
In 37 DEG C of 1.5~2h of Constant temperature hatch in hybridizing box；
The slide for hatching completion is cleaned with 2 × SSC buffer solution for cleaning 3min, distilled water successively under the conditions of lucifuge
2min, room temperature are dried；
3) signal detection：DAPI, covered, using fluorescence microscope to slide are added on slide after drying
Detected, acquisition testing image；
4) slide reclaims：Film-making is reclaimed after signal acquisition and is put into 2 × SSC buffer solutions in 60 DEG C of water-bath 5min,
Gradient is handled in 75% alcohol, 95% alcohol, 100% alcohol successively, each 5min, and film-making will be reclaimed after the completion of processing in day
12h is placed under light lamp；- 20 DEG C preserve in case next time uses.
The beneficial effects of the present invention are：The present invention is based on fluorescence in situ hybridization technique, there is provided one kind is used to detect swallow
The probe groups of wheat platymiscium chromosome, the probe groups are the 18-51bp of identification oat chromosome few sequence probe, are had
Help establish stable easily chromosome fluorescence in-situ hybridization reaction system；It is used to detect Avena present invention also offers one kind
The kit of plant chromosome, the kit be applied to detection oat chromosome, have it is reproducible, easily to operate
Advantage；Wherein the ratio of components forefathers report of hybridization solution is simple a lot, only includes two kinds of liquid easily prepared.The present invention is also
Provide a kind of method for detecting oat chromosome, this method can Reusability film-making, and probe prepares to hold
Easily, quickly, high sensitivity, demand DNA probe amount is few, good and cheap, and tip of a root film-making is easy, is easily obtained metaphase chromosome, right
Lucifuge requires relatively low, and the time of whole experiment flow shortens, easy to operate.
Brief description of the drawings
Fig. 1 is (ACT) of the invention6The signal site distribution of the Avena diplont (AA genomes) of probe mark
Image, wherein figure a~f represents Avena wiestii, Avena longiglumis, Avena brevis, Avena respectively
Nuda, Avena strigosa, Avena canariensis signal site distributed image；(ACT)6Probe is marked using FAM
5 ' ends, green, scale are 5 μm to display hybridization signal as shown by arrows in FIG.；
Fig. 2 is (ACT) of the invention6The signal site point of the Avena tetraploid plant (AABB genomes) of probe mark
Cloth image, wherein figure a~c represents Avena barbata, Avena abyssinica, Avena vaviloviana letter respectively
Number site distributed image；(ACT)6Probe is held using FAM marks 5 ', shows hybridization signal green as shown by arrows in FIG.,
Scale is 5 μm；
Fig. 3 is (ACT) of the invention6The signal site distribution of the Avena diplont (CC genomes) of probe mark
Image, wherein figure a and b represents Avena ventricosa, Avena eriantha signal site distributed image respectively；
(ACT)6Probe is held using FAM marks 5 ', and green, scale are 5 μm to display hybridization signal as shown by arrows in FIG.；
Fig. 4 is (ACT) of the invention6Probe separate marking and the Avena tetraploid plant with Aml probe mixed marks
The signal site distributed image of (AACC genomes), wherein figure a~f is represented：A.insularis (a~b), A.magna (c~
D), A.murphyi (e~f), (ACT)6Probe is held using FAM marks 5 ', and display hybridization signal as shown by arrows in FIG. believe by green
Number, Am1 probes are held using TAMRM marks 5 ', show danger signal in hybridization signal such as figure, and scale is 5 μm；
Fig. 5 is (ACT) of the invention6Probe separate marking and the Avena hexaploid plant with Aml probe mixed marks
The signal site distributed image of (AACCDD genomes)；Wherein scheme a~d to represent：A.sativa (a~b), A.fatua (c~d),
(ACT)6Probe is held using FAM marks 5 ', and green, Am1 probes use TAMRM to display hybridization signal as shown by arrows in FIG.
Mark 5 ' is held, and shows danger signal in hybridization signal such as figure, and scale is 5 μm；
Fig. 6 is (GAA) of the invention6The signal site distribution of the Avena diplont (AA genomes) of probe mark
Image, wherein figure a, b, e are using TAMRM marks (GAA)65 ' ends of probe, show danger signal as shown by arrows in FIG., point
Not Biao Shi Avena atlantica, Avena brevis, Avena nuda signal site distributed image；Figure c, d, f are to use
FAM marks (GAA)65 ' ends of probe, show green, represent Avena canariensis respectively as shown by arrows in FIG.,
Avena longiglumis, Avena strigosa signal site distributed image；Scale is 5 μm；
Fig. 7 is (GAA) of the invention6The signal site point of the Avena tetraploid plant (AABB genomes) of probe mark
Cloth image, wherein figure a, b, c are using FAM marks (GAA)65 ' ends of probe, show green as shown by arrows in FIG., point
Not Biao Shi Avena abyssinica, Avena barbata, Avena agadiriana signal site distributed image；Scheming d is
Marked (GAA) using TAMRM65 ' ends of probe, show danger signal, represent Avena as shown by arrows in FIG.
Vaviloviana signal site distributed image；Scale is 5 μm；
Fig. 8 is (GAA) of the invention6The signal site distribution of the Avena diplont (CC genomes) of probe mark
Image, wherein figure a and b represents Avena eriantha, A vena ventricosa signal site distributed image respectively；
(GAA)6Probe is held using TAMRM marks 5 ', and danger signal, scale are 5 μm to display hybridization signal as shown by arrows in FIG.；
Fig. 9 is (GAA) of the invention6The signal site point of the Avena tetraploid plant (AACC genomes) of probe mark
Cloth image, wherein figure a and b is using TAMRM marks (GAA)65 ' ends of probe, show danger signal, represent Avena respectively
Insularis, Avena magna signal site distributed image；Figure c is using FAM marks (GAA)65 ' ends of probe, display
Green, represent Avena murphyi signal site distributed image；Scale is 5 μm；
Figure 10 is (GAA) of the invention6The signal position of the Avena hexaploid plant (AACCDD genomes) of probe mark
Point distributed image, wherein figure a is using FAM marks (GAA)65 ' ends of probe, show green, represent Avena sativa's
Signal site distributed image；B is schemed using TAMRM marks (GAA)65 ' ends of probe, show danger signal, represent Avena
Fatua signal site distributed image；Scale is 5 μm；
Figure 11 is (TTG) of the invention6The signal site point of the Avena diplont (AA genomes) of probe mark
Cloth image, wherein figure a~d represents Avena longiglumis, Avena nuda, Avena canariensis, Avena respectively
Strigosa signal site distributed image；(TTG)6Probe is held using FAM marks 5 ', shows arrow institute in hybridization signal such as figure
Show green, scale is 5 μm；
Figure 12 is (TTG) of the invention6The signal site of the Avena tetraploid plant (AABB genomes) of probe mark
Distributed image, wherein figure a~d represents Avena barbata, Avena vaviloviana, Avena abyssinica respectively,
Avena agadiriana signal site distributed image；(TTG)6Probe is held using FAM marks 5 ', and display hybridization signal is as schemed
Green shown in middle arrow, scale are 5 μm；
Figure 13 is (TTG) of the invention6The signal site point of the Avena diplont (CC genomes) of probe mark
Cloth image, wherein figure a and b represents Avena eriantha, Avena ventricosa signal site distributed image respectively；
(TTG)6Probe is held using FAM marks 5 ', and green, scale are 5 μm to display hybridization signal as shown by arrows in FIG.；
Figure 14 is (TTG) of the invention6With the Avena tetraploid plant (AACC genomes) of Aml probe mixed marks
Signal site distributed image；Wherein scheme a~c to represent：A.magna, A.murphyi, A.insularis；(TTG)6Probe uses
FAM marks 5 ' are held, and display hybridization signal as shown by arrows in FIG. using TAMRM marks 5 ' held by green, Am1 probes, display
Danger signal in hybridization signal such as figure, scale are 5 μm；
Figure 15 is (TTG) of the invention6With the Avena hexaploid plant (AACCDD genomes) of Aml probe mixed marks
Signal site distributed image.Wherein figure a and b represents A.sativa, fatua signal site distributed image respectively；(TTG)6
Probe is held using FAM marks 5 ', and green, Am1 probes use TAMRM marks 5 ' to display hybridization signal as shown by arrows in FIG.
End, shows danger signal in hybridization signal such as figure, and scale is 5 μm；
Embodiment
Probe groups are synthesized by Beijing Sheng Gong companies used by the present invention is implemented, and the probe of synthesis is diluted to 1 × TE
100M concentration is stored in -20 DEG C, and probe face concentration needs to be diluted to 10M again, also in -20 DEG C of preservations.
18 Avena species materials are as shown in table 1 used by the present invention is implemented, including 9 diploids, 7 four times
Body, 2 hexaploid species.Wherein diploid species includes 7 AA genomes species and 2 CC genome species；Tetraploid thing
Kind includes 4 AABB genomes species and 3 AACC genome species；Hexaploid species gene group is AACCDD.
Avena species material used by the present invention of table 1 is implemented
The present invention is described in further details with specific embodiment below in conjunction with the accompanying drawings, described is the solution to the present invention
Release rather than limit.
On the one hand, the specific embodiment of the invention provides a kind of probe groups for being used to detect oat chromosome, including
Aml、(ACT)6、(GAA)6、(TTG)6Four kinds of probes, wherein the Aml probes are made up of 51 base-pairs, its base sequence is：
5′-GATCCATGTGTGGTTTGTGGAAAGAACACACATGCAATGACTCTAGTGGTT-3′(SEQ ID NO:1), use
FAM or TAMRA marks the 5 ' of its sequence to hold, for all chromosomes of specific recognition Avena C genomes；(ACT)6
The base sequence of probe is：5′-ACTACTACTACTACTACT-3′(SEQ ID NO:2) it, is marked using FAM or TAMRA
5 ' ends of sequence, for identifying the part-structure of preference C genome portion chromosomes, also faint identification A chromosome group part contaminates
The part-structure of colour solid；(GAA)6The base sequence of probe is：5′-GAAGAAGAAGAAGAAGAA-3′(SEQ ID NO:
3), mark its sequence using FAM or TAMRA 5 ' are held, for identifying that the part of preference A and C genome portion chromosome is tied
Structure；(TTG)6The base sequence of probe is：5′-TTGTTGTTGTTGTTGTTG-3′(SEQ ID NO:4), using FAM or
Person TAMRA marks the 5 ' of its sequence to hold, for identifying preference A genome portion chromosomal section structures, faint identification C genomes
The part-structure of chromosome dyad.
Second aspect, the specific embodiment of the invention provide a kind of kit for being used to detect oat chromosome,
Including：
(1) above-mentioned probe groups；
(2) enzymolysis liquid, compound method are：0.04g cellulases and 0.02g fruits are added in citrate buffer solution per 1mL
Glue enzyme；The compound method of wherein citrate buffer solution is：DdH per 50mL2O adds 0.5707g trisodium citrates and 0.4324g lemons
Lemon acid；
(3) 4% paraformaldehyde liquid, compound method are：1 × PBS per 100mL adds 4g paraformaldehydes, 60
Water-bath 2-3h in DEG C water-bath, wherein the compound method of the 1 × PBS is：DdH per 1000mL2O adds 8g chlorinations
Sodium, 0.2g potassium chloride, 1.42g disodium hydrogen phosphates and 0.27g potassium dihydrogen phosphates；
(4) 2 × SSC buffer solutions, compound method are：DdH per 1000mL2O add 8.823g trisodium citrates and
17.532g sodium chloride；
(5) 70%FA liquid, by deionized formamide (FA) and 2 × SSC buffer solutions according to volume ratio 7:3 compositions；
(6) hybridization solution, it is made up of 1 isometric × TE and 2 × SSC buffer solutions；Wherein 1 × TE compound method is：Often
800mL ddH21.211g Tris and 0.372g EDTANa are added in O2·2H2O, pH to 8.0 is adjusted with HCl, constant volume arrives
1000mL, produced after sterilizing.
3rd aspect, the specific embodiment of the invention provide a kind of method for detecting oat chromosome, are
Using mentioned reagent box, comprise the following steps：
1) preparation of oat Chromosome glass slide sample：Oat seed is soaked with distilled water, is placed in 4
24h is placed in DEG C environment, sucks excessive moisture, and it is incubated in 22 DEG C, when tip of a root length is to 1.5~2.0cm, clip 1~
1.5cm organizations of root tips, use N successively2O processing 5h, glacial acetic acid processing 5min, are subsequently placed in 75% alcohol in -20 DEG C of preservations；
1~2mm of Root apical meristem is cut after the organization of root tips of Cord blood is cleaned with distilled water, is placed in enzymolysis liquid
45min is digested in 37 DEG C, removes enzymolysis liquid, successively with distilled water, 75% alcohol, 95% alcohol, the 100% alcohol washes tip of a root point
Room temperature is dried after raw tissue；Glacial acetic acid is added in organization of root tips suspension is made；Hanging drop is dried in the air in room temperature on slide
Microscopy after dry, the good slide of microscopy is in -20 DEG C of preservations；
2) FISH：Slide is placed in 4% paraformaldehyde and handles 10min, then with 2 × SSC buffer solutions
Handle twice, each 5min, then dried in the air successively with 75% alcohol, 95% alcohol, the processing of 100% alcohol gradient, each 5min, room temperature
70%FA liquid is added dropwise after dry, covered, 2min is denatured in 80 DEG C；
Slide denaturation is completed after 75% alcohol, 95% alcohol, 100% alcohol gradient that -20 DEG C are sequentially placed into 5s
Processing, each 5min, room temperature are dried；The hybridization solution for being placed with probe is added dropwise on the slide dried, 10 μ are added dropwise in every slide
L is placed with the hybridization solution of probe, wherein every kind of probe contains 0.5 μ L, remaining as hybridization solution；Covered, under dark condition
In 37 DEG C of 1.5~2h of Constant temperature hatch in hybridizing box；
The slide for hatching completion is cleaned with 2 × SSC buffer solution for cleaning 3min, distilled water successively under the conditions of lucifuge
2min, room temperature are dried；
3) signal detection：DAPI, covered, using fluorescence microscope to slide are added on slide after drying
Detected, acquisition testing image；
4) slide reclaims：Film-making is reclaimed after signal acquisition and is put into 2 × SSC buffer solutions in 60 DEG C of water-bath 5min,
Gradient is handled in 75% alcohol, 95% alcohol, 100% alcohol successively, each 5min, and film-making will be reclaimed after the completion of processing in day
12h is placed under light lamp；- 20 DEG C preserve in case next time uses.
Embodiment 1
The present embodiment uses (ACT) in kit66 kinds of Avena diplonts of probe mark (AA genomes)：
Avena wiestii, Avena longiglumis, Avena brevis, Avena nuda, Avena strigosa, Avena
canariensis。(ACT)6The base sequence of probe is：5 '-ACTACTACTACTACTACT-3 ', using FAM mark its 5 '
End, green is shown, probe dosage is 0.5 μ L.Can be with clear view to above-mentioned two times of 6 kinds of Avenas by fluorescence microscope
The hybridization signal of body plant, in their signal site distributed image in addition to Avena brevis have four signals, remaining is all
It is two signals, as shown in figure 1, the scale in figure is 5 μm, arrow meaning is (ACT)6Hybridization signal.
Embodiment 2
The present embodiment uses (ACT) in kit63 kinds of Avena tetraploid plants of probe mark (AABB genomes)：
Avena barbata, Avena abyssinica, Avena vaviloviana.(ACT)6The base sequence of probe is：5′-
ACTACTACTACTACTACT-3 ', its 5 ' end is marked using FAM, shows green, probe dosage is 0.5 μ L.Pass through fluorescence
Microscope can be with clear view to above-mentioned 3 kinds of Avena tetraploid plants hybridization signal, each species contain four signals, such as
Shown in Fig. 2, the scale in figure is 5 μm, and arrow meaning is (ACT)6Hybridization signal.
Embodiment 3
The present embodiment uses (ACT) in kit62 kinds of Avena diplonts of probe mark (CC genomes)：
Avena ventricosa, Avena eriantha.(ACT)6The base sequence of probe is：5′-ACTACTACTACTACTACT-
3 ', its 5 ' end is marked using FAM, shows green, probe dosage is 0.5 μ L.Can be with clear view by fluorescence microscope
To the hybridization signal of above-mentioned 2 kinds of Avena diplonts, each species contain six signals, as shown in figure 3, the scale in figure
For 5 μm, arrow meaning is (ACT)6Hybridization signal.
Embodiment 4
The present embodiment uses (ACT) in kit6Probe separate marking or with 3 kinds of oats of Aml probes mixed mark
Belong to tetraploid plant (AACC genomes)：Avena insularis, Avena magna, Avena murphyi.(ACT)6Probe
Base sequence be：5 '-ACTACTACTACTACTACT-3 ', its 5 ' end is marked using FAM, shows green, separate marking
Or the probe dosage of mixed mark is 0.5 μ L.Am1 probes mark its 5 ' end using TAMRM, show danger signal, probe
Dosage is 0.5 μ L.It can be arrived by fluorescence microscope with clear view, Avena insularis are shown 14 (ACT)6Signal,
Avena magna and Avena murphyi are shown 10 (ACT)6Signal, 3 species show 14 Am1 chromosome signals,
Avena insularis show 6 A/C chromosome translocation signals, and Avena magna, Avena murphyi show 8 A/C dyes
Colour solid translocalization signals, as shown in figure 4, the scale in figure is 5 μm, arrow meaning is (ACT)6Hybridization signal.
Embodiment 5
The present embodiment uses (ACT) in kit6Separate marking belongs to six times with 2 kinds of wheats of Aml probes mixed mark
Body plant (AACCDD genomes)：Avena sativa, Avena fatua.(ACT)6The base sequence of probe is：5′-
ACTACTACTACTACTACT-3 ', its 5 ' end is marked using FAM, shows green, the spy of separate marking or mixed mark
Pin dosage is 0.5 μ L.Am1 probes mark its 5 ' end using TAMRM, show danger signal, probe dosage is 0.5 μ L.Pass through
Fluorescence microscope can be arrived with clear view, and Avena sativa contain 14 (ACT)6Signal, Avena fatua contain 12
(ACT)6Signal, 2 species show 14 Am1 chromosome signals, and Avena sativa show 12 A/D-C chromosome translocations
Signal, Avena fatua show 10 A/D-C chromosome translocation signals, as shown in figure 5, the scale in figure is 5 μm, arrow institute
Refer to as (ACT)6Hybridization signal.
Embodiment 6
The present embodiment uses (GAA) in kit66 kinds of Avena diplonts of probe mark (AA genomes)：
Avena atlantica, Avena brevis, Avena canariensis, Avena longiglumis, Avena nuda,
Avena strigosa。(GAA)6The base sequence of probe is：5 '-GAAGAAGAAGAAGAAGAA-3 ', it is marked using FAM
5 ' ends, its 5 ' end is marked using FAM, show green, or its 5 ' end is marked using TAMRM, show danger signal, probe
Dosage is 0.5 μ L.Hybridization signal that can be with clear view to above-mentioned 6 kinds of Avena diplonts by fluorescence microscope, often
Individual species contain two signals, as shown in fig. 6, the scale in figure is 5 μm, arrow meaning is (GAA)6Hybridization signal.
Embodiment 7
The present embodiment uses (GAA) in kit64 kinds of Avena tetraploid plants of probe mark (AABB genomes)：
Avena abyssinica, Avena barbata, Avena agadiriana, Avena vaviloviana.(GAA)6Probe
Base sequence be：5 '-GAAGAAGAAGAAGAAGAA-3 ', its 5 ' end is marked using FAM, shows green, or use
TAMRM marks its 5 ' end, shows danger signal, probe dosage is 0.5 μ L.Can be with clear view to above-mentioned by fluorescence microscope
The hybridization signal of 4 kinds of Avena tetraploid plants, Avenaabyssinica contain 14 signals, and Avena barbata contain 12
Individual signal, Avena agadiriana contain 2 signals, and Avena vaviloviana contain 10 signals, as shown in fig. 7, figure
In scale be 5 μm, arrow meaning is (GAA)6Hybridization signal.
Embodiment 8
The present embodiment uses (GAA) in kit62 kinds of Avena diplonts of probe mark (CC genomes)：
Avena eriantha, Avena ventricosa.(GAA)6The base sequence of probe is：5′-GAAGAAGAAGAAGAAGAA-
3 ', its 5 ' end is marked using TAMRM, shows danger signal, probe dosage is 0.5 μ L.It can be understood by fluorescence microscope and seen
The hybridization signal of above-mentioned 2 kinds of Avena diplonts is observed, each species contain 2 signals, as shown in figure 8, the mark in figure
Chi is 5 μm, and arrow meaning is (GAA)6Hybridization signal.
Embodiment 9
The present embodiment uses (GAA) in kit63 kinds of Avena tetraploid plants of probe mark (AACC genomes)：
Avena insularis, Avena magna, Avena murphyi.(GAA)6The base sequence of probe is：5′-
GAAGAAGAAGAAGAAGAA-3 ', its 5 ' end is marked using FAM, shows green, or its 5 ' end is marked using TAMRM,
Danger signal is shown, probe dosage is 0.5 μ L.Can be with clear view to above-mentioned 3 kinds of Avena tetraploids by fluorescence microscope
The hybridization signal of plant, Avena insularis contain two signals, and Avena magna contain 8 signals, Avena
Murphyi contains 4 signals, as shown in figure 9, the scale in figure is 5 μm, arrow meaning is (GAA)6Hybridization signal.
Embodiment 10
The present embodiment uses (GAA) in kit62 kinds of Avena hexaploid plant (AACCDD genes of probe mark
Group)：Avena sativa, Avena fatua.(GAA)6The base sequence of probe is：5 '-GAAGAAGAAGAAGAAGAA-3 ',
Its 5 ' end is marked using FAM, shows green, or its 5 ' end is marked using TAMRM, shows danger signal, probe dosage
For 0.5 μ L.Hybridization signal that can be with clear view to above-mentioned 2 kinds of Avenas hexaploid plant by fluorescence microscope, Avena
Sativa contains 8 signals, and Avena fatua contain 2 signals, and as shown in Figure 10, the scale in figure is 5 μm, and arrow is signified
For (GAA)6Hybridization signal.
Embodiment 11
The present embodiment uses (TTG) in kit64 kinds of Avena diplonts of probe mark (AA genomes)：
Avena longiglumis, Avena nuda, Avena canariensis, Avena strigosa.(TTG)6The alkali of probe
Motif is classified as：5 '-TTGTTGTTGTTGTTGTTG-3 ', its 5 ' end is marked using FAM, shows green, probe dosage is
0.5μL.Hybridization signal that can be with clear view to above-mentioned 4 kinds of Avena diplonts by fluorescence microscope, each species
Containing six signals, as shown in figure 11, the scale in figure is 5 μm, and arrow meaning is (TTG)6Hybridization signal.
Embodiment 12
The present embodiment uses (TTG) in kit64 kinds of Avena tetraploid plants of probe mark (AABB genomes)：
Avena barbata, Avena vaviloviana, Avena abyssinica, Avena agadiriana.(TTG)6Probe
Base sequence be：5 '-TTGTTGTTGTTGTTGTTG-3 ', its 5 ' end is marked using FAM, shows green, probe dosage
For 0.5 μ L.Hybridization signal that can be with clear view to above-mentioned 4 kinds of Avena tetraploid plants by fluorescence microscope,
Avenabarbata contains 8 signals, and Avena vaviloviana contain 10 signals, and Avena abyssinica contain 14
Individual signal, Avena agadiriana contain 10 signals, and as shown in figure 12, the scale in figure is 5 μm, and arrow meaning is
(TTG)6Hybridization signal.
Embodiment 13
The present embodiment uses (TTG) in kit62 kinds of Avena diplonts of probe mark (CC genomes)：
Avena eriantha, Avena ventricosa.(TTG)6The base sequence of probe is：5′-TTGTTGTTGTTGTTGTTG-
3 ', its 5 ' end is marked using FAM, shows green, probe dosage is 0.5 μ L.Can be with clear view by fluorescence microscope
To the hybridization signal of above-mentioned 2 kinds of Avena diplonts, each species contain 4 signals, as shown in figure 13, the scale in figure
For 5 μm, arrow meaning is (TTG)6Hybridization signal.
Embodiment 14
The present embodiment uses (TTG) in kit6With 3 kinds of Avena tetraploid plant (AACC of Aml probes mixed mark
Genome)：Avena magna, Avena murphyi, Avena insularis.(TTG)6The base sequence of probe is：5′-
TTGTTGTTGTTGTTGTTG-3 ', its 5 ' end is marked using FAM, shows green, probe dosage is 0.5 μ L.Am1 probes
Its 5 ' end is marked using TAMRM, shows danger signal, probe dosage is 0.5 μ L.Can be with clear view by fluorescence microscope
Arrive, Avena magna show 12 (TTG) 6 signals, and Avena murphyi are shown 10 (TTG)6Signal, Avena
Insularis is shown 8 (TTG)6Signal, 3 species show 14 Am1 chromosome signals, Avena magna, Avena
Murphyi shows 8 A/C chromosome translocation signals, and Avena insularis show 6 A/C chromosome translocation signals, such as schemes
Shown in 13, the scale in figure is 5 μm, and arrow meaning is (TTG)6Hybridization signal.
Embodiment 15
The present embodiment uses (TTG) in kit6With 2 kinds of wheat category hexaploid plant (AACCDD of Aml probes mixed mark
Genome)：Avena sativa, Avena fatua.(TTG)6The base sequence of probe is：5′-
TTGTTGTTGTTGTTGTTG-3 ', its 5 ' end is marked using FAM, shows green, probe dosage is 0.5 μ L.Am1 probes
Its 5 ' end is marked using TAMRM, shows danger signal, probe dosage is 0.5 μ L.Can be with clear view by fluorescence microscope
Arrive, Avena sativa contain 18 (TTG)6Signal, Avena fatua contain 16 (TTG)6Signal, 2 species are shown
14 Am1 chromosome signals, Avena sativa show 12 A/D-C chromosome translocation signals, and Avena fatua show 10
A/D-C chromosome translocation signals, as shown in figure 13, the scale in figure is 5 μm, and arrow meaning is (TTG)6Hybridization signal.
Although embodiments of the invention have been shown and described above, it is to be understood that above-described embodiment is example
Property, it is impossible to limitation of the present invention is interpreted as, one of ordinary skill in the art within the scope of the invention can be to above-mentioned
Embodiment is changed, changed, replacing and modification.
Sequence table
<110>Sichuan Agricultural University
<120>A kind of probe groups, kit and application for being used to detect oat chromosome
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 51
<212> DNA
<213>Artificial sequence ()
<400> 1
gatccatgtg tggtttgtgg aaagaacaca catgcaatga ctctagtggt t 51
<210> 2
<211> 18
<212> DNA
<213>Artificial sequence ()
<400> 2
actactacta ctactact 18
<210> 3
<211> 18
<212> DNA
<213>Artificial sequence ()
<400> 3
gaagaagaag aagaagaa 18
<210> 4
<211> 18
<212> DNA
<213>Artificial sequence ()
<400> 4
ttgttgttgt tgttgttg 18
Claims (10)
1. a kind of probe groups for being used to detect oat chromosome, it is characterised in that including Aml, (ACT)6、(GAA)6、
(TTG)6Four kinds of probes, wherein the Aml probes are made up of 51 base-pairs, its base sequence is：5′-
GATCCATGTGTGGTTTGTGGAAAGAACACACATGCAATGACTCTAGTGGTT-3 ', for specific recognition Avena C
All chromosomes of genome；(ACT)6The base sequence of probe is：5 '-ACTACTACTACTACTACT-3 ', for identifying
The part-structure of the part-structure of preference C genome portion chromosomes, also faint identification A chromosome group chromosome dyad；It is described
(GAA)6The base sequence of probe is：5 '-GAAGAAGAAGAAGAAGAA-3 ', for identifying that preference A and C genome portion contaminate
The part-structure of colour solid；(TTG)6The base sequence of probe is：5 '-TTGTTGTTGTTGTTGTTG-3 ', for identifying partially
Good A genome portions chromosomal section structure, the part-structure of faint identification C genome portion chromosomes.
2. a kind of probe groups for being used to detect oat chromosome according to claim 1, it is characterised in that described
Aml probes mark the 5 ' of its sequence to hold using FAM or TAMRA..
3. a kind of probe groups for being used to detect oat chromosome according to claim 1, it is characterised in that described
(ACT)6Probe marks the 5 ' of its sequence to hold using FAM or TAMRA.
4. a kind of probe groups for being used to detect oat chromosome according to claim 1, it is characterised in that described
(GAA)6Probe marks the 5 ' of its sequence to hold using FAM or TAMRA.
5. a kind of probe groups for being used to detect oat chromosome according to claim 1, it is characterised in that described
(TTG)6Probe marks the 5 ' of its sequence to hold using FAM or TAMRA.
A kind of 6. kit for being used to detect oat chromosome, it is characterised in that including：
(1) above-mentioned probe groups；
(2) enzymolysis liquid；
(3) 4% paraformaldehyde liquid；
(4) 2 × SSC buffer solutions；
(5) 70%FA liquid；
(6) hybridization solution；
The hybridization solution is made up of 1 isometric × TE and 2 × SSC buffer solutions；Wherein 1 × TE compound method is：Often
800mL ddH21.211g Tris and 0.372g EDTANa are added in O2·2H2O, pH to 8.0 is adjusted with HCl, constant volume arrives
1000mL, produced after sterilizing.
7. a kind of kit for being used to detect oat chromosome according to claim 6, it is characterised in that described
The compound method of enzymolysis liquid is：0.04g cellulases and 0.02g pectases are added in citrate buffer solution per 1mL；Wherein lemon
The compound method of lemon acid buffer is：DdH per 50mL2O adds 0.5707g trisodium citrates and 0.4324g citric acids.
8. a kind of kit for being used to detect oat chromosome according to claim 6, it is characterised in that described
The compound method of 2 × SSC buffer solutions is：DdH per 1000mL2O adds 8.823g trisodium citrates and 17.532g sodium chloride.
9. a kind of kit for being used to detect oat chromosome according to claim 6, it is characterised in that described
70%FA liquid is by deionized formamide (FA) and 2 × SSC buffer solutions according to volume ratio 7:3 compositions.
10. a kind of method for detecting oat chromosome, it is to use claim 6~9 any one claim
Described kit, it is characterised in that comprise the following steps：
1) preparation of oat Chromosome glass slide sample：Oat seed is soaked with distilled water, is placed in 4 DEG C of rings
24h is placed in border, sucks excessive moisture, and it is incubated in 22 DEG C, when tip of a root length is to 1.5~2.0cm, 1~1.5cm of clip
Organization of root tips, N is used successively2O processing 5h, glacial acetic acid processing 5min, are subsequently placed in 75% alcohol in -20 DEG C of preservations；
1~2mm of Root apical meristem is cut after the organization of root tips of Cord blood is cleaned with distilled water, is placed in enzymolysis liquid in 37
DEG C enzymolysis 45min, remove enzymolysis liquid, successively with distilled water, 75% alcohol, 95% alcohol, mitogenetic group of the 100% alcohol washes tip of a root
Rear room temperature is knitted to dry；Glacial acetic acid is added in organization of root tips suspension is made；By hanging drop after room temperature is dried on slide
Microscopy, the good slide of microscopy is in -20 DEG C of preservations；
2) FISH：Slide is placed in 4% paraformaldehyde and handles 10min, is then handled with 2 × SSC buffer solutions
Twice, each 5min, then successively with 75% alcohol, 95% alcohol, the processing of 100% alcohol gradient, each 5min, after room temperature is dried
70%FA liquid is added dropwise, covered, 2min is denatured in 80 DEG C；
Slide denaturation is completed to handle after 75% alcohol, 95% alcohol, 100% alcohol gradient that are sequentially placed into -20 DEG C in 5s,
Each 5min, room temperature are dried；The hybridization solution for being placed with probe is added dropwise on the slide dried, every slide is added dropwise 10 μ L and is placed with
The hybridization solution of probe, wherein every kind of probe contains 0.5 μ L, remaining as hybridization solution；Covered, hybridizing under dark condition
In 37 DEG C of 1.5~2h of Constant temperature hatch in box；
The slide for hatching completion is cleaned into 2min with 2 × SSC buffer solution for cleaning 3min, distilled water successively under the conditions of lucifuge,
Room temperature is dried；
3) signal detection：DAPI is added on slide after drying, covered, slide is carried out using fluorescence microscope
Detection, acquisition testing image；
4) slide reclaims：Film-making is reclaimed after signal acquisition and is put into 2 × SSC buffer solutions in 60 DEG C of water-bath 5min, successively
Gradient is handled in 75% alcohol, 95% alcohol, 100% alcohol, each 5min, and film-making will be reclaimed after the completion of processing in fluorescent lamp
Lower placement 12h；- 20 DEG C preserve in case next time uses.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710985245.8A CN107574229B (en) | 2017-10-20 | 2017-10-20 | Probe set for detecting oat plant chromosome, kit and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710985245.8A CN107574229B (en) | 2017-10-20 | 2017-10-20 | Probe set for detecting oat plant chromosome, kit and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107574229A true CN107574229A (en) | 2018-01-12 |
| CN107574229B CN107574229B (en) | 2020-09-01 |
Family
ID=61037943
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710985245.8A Expired - Fee Related CN107574229B (en) | 2017-10-20 | 2017-10-20 | Probe set for detecting oat plant chromosome, kit and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107574229B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112798378A (en) * | 2021-01-29 | 2021-05-14 | 四川大学华西医院 | Immunofluorescence dry tablet recovery agent and application thereof |
-
2017
- 2017-10-20 CN CN201710985245.8A patent/CN107574229B/en not_active Expired - Fee Related
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112798378A (en) * | 2021-01-29 | 2021-05-14 | 四川大学华西医院 | Immunofluorescence dry tablet recovery agent and application thereof |
| CN112798378B (en) * | 2021-01-29 | 2023-03-24 | 四川大学华西医院 | Immunofluorescence dry tablet recovery agent and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107574229B (en) | 2020-09-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hasterok et al. | Laying the cytotaxonomic foundations of a new model grass, Brachypodium distachyon (L.) Beauv. | |
| Hasterok et al. | Ribosomal DNA is an effective marker of Brassica chromosomes | |
| Wolny et al. | Comparative cytogenetic analysis of the genomes of the model grass Brachypodium distachyon and its close relatives | |
| Vasconcelos et al. | Heterochromatin and rDNA 5S and 45S sites as reliable cytogenetic markers for castor bean (Ricinus communis, Euphorbiaceae) | |
| CN102334447A (en) | Cultivation method of maize inbred line | |
| CN107475390B (en) | Development and application of decaploid elytrigia elongata series repeat sequence specific probe | |
| CN107400715B (en) | Development and application of special molecular marker and probe of decaploid elytrigia elongata | |
| Luo et al. | Karyotype analysis of Piptanthus concolor based on FISH with a oligonucleotides for rDNA 5S | |
| CN109295179A (en) | A kind of method and its dedicated kit for screening different Zn contents and iron content wheat | |
| Xie et al. | Molecular karyotyping of Siberian wild rye (Elymus sibiricus L.) with oligonucleotide fluorescence in situ hybridization (FISH) probes | |
| Kwon et al. | Localization of 5S and 25S rRNA genes on somatic and meiotic chromosomes in Capsicum species of chili pepper | |
| CN107574229A (en) | A kind of probe groups, kit and application for being used to detect oat chromosome | |
| Baeza et al. | Characterization of geographically isolated accessions in five Alstroemeria L. species (Chile) using FISH of tandemly repeated DNA sequences and RAPD analysis | |
| CN108300801A (en) | The molecular labeling and application that a kind of and rape grain weight and Pod length are closely related | |
| dos Santos Amorim et al. | Cytogenetic, molecular and morphological characterization of Passiflora capsularis L. and Passiflora rubra L. | |
| CN104789678A (en) | Identification method for amblyopyrum muticum chromosome in wheat genome | |
| Lattier et al. | Improved method of enzyme digestion for root tip cytology | |
| CN103571795B (en) | The recombinant cell lines measured for baculovirus titers and measuring method thereof | |
| CN106350594B (en) | It is a kind of identify H. villosa chromosome nucleic acid probe and its application | |
| CN105907864A (en) | FISH detection method for aegilops comosa chromosome in wheat | |
| CN110468225A (en) | Capsicum cytoplasmic male sterility restores the relevant SNP marker of character and its specific primer and application | |
| Muakrong et al. | Two jatropha karyotypes constructed from meiotic pachytene chromosomes: Pericentric distribution of heterochromatin and variation in repetitive DNAs | |
| Tokatlidis et al. | Variability within cotton cultivars for yield, fibre quality and physiological traits | |
| Tang et al. | Identification of chromosomes from multiple rice genomes using a universal molecular cytogenetic marker system | |
| Wang et al. | A novel genome of C and the first autotetraploid species in the Setaria genus identified by genomic in situ hybridization |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200901 Termination date: 20211020 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |