CN105907864A - FISH detection method for aegilops comosa chromosome in wheat - Google Patents
FISH detection method for aegilops comosa chromosome in wheat Download PDFInfo
- Publication number
- CN105907864A CN105907864A CN201610301879.2A CN201610301879A CN105907864A CN 105907864 A CN105907864 A CN 105907864A CN 201610301879 A CN201610301879 A CN 201610301879A CN 105907864 A CN105907864 A CN 105907864A
- Authority
- CN
- China
- Prior art keywords
- chromosome
- fish
- oligo
- signal
- hybridization
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6841—In situ hybridisation
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of plant cytogenetics, and discloses an in-situ hybridization detection method for identifying and authenticating aegilops comosa M chromosome in wheat background. The detection method comprises the following steps of performing double-color FISH (fluorescence in situ hybridization) on the chromosome preparation of tested material by polynucleotides Oligo-pTa535.1-1 and Oligo-pSc119.2-1, using (GAA)8 as a probe, performing secondary FISH on the chromosome of same cell by an elution double-color FISH signal, and authenticating the aegilops comosa chromosome in the wheat background. The method has the advantages that the aegilops comosa chromosome in a wheat chromosome group is quickly and effectively identified, the application of the polynucleotide probe in triticeae species is widened, a detection method is provided for the authenticating of new variety resource of distant hybridization of wheat-aegilops comosa, and a simple and effective cytogenetic authenticating method is provided for transferring the powdery mildew resistance gene on the aegilops comosa chromosome into the wheat.
Description
Technical field
The invention belongs to cytogenetics field, relate to a kind of quick detection and identify the FISH of Aegilops comosa chromosome in Semen Tritici aestivi
Detection method.
Background technology
Aegilops comosa (Ae.comosa also makees Triticum comosum, 2n=2x=14, genome MM), high anti-Semen Tritici aestivi bar
Rust, leaf rust, stem rust, powdery mildew, cereal cyst nematode and Semen Tritici aestivi Hessian fly are sick, have salt alkali tolerance, are little
The favorable genes source of wheat breeding.Eighties of last century sixties, British scientist Riley etc. has carried out the earliest and has been transferred to by Aegilops comosa
The research work of Semen Tritici aestivi, it is thus achieved that Semen Tritici aestivi-Aegilops comosa 2M addition line, 2DL/2M and 2DS/2M translocation line, will be from this
Sr34 and the Yr8 transfer of chromosome gives Semen Tritici aestivi (Riley R, Chapman V, Johnson R.Introduction of yellow rust
resistance of Aegilops comosa into wheat by genetically induced homoeologous recombination.
Nature,1968,217(5126):383-384).Nineteen ninety-five, the leap of Chinese science father-in-law and Dong Yuchen utilize Anther Culture to obtain
A collection of Semen Tritici aestivi-Aegilops comosa cenospecies matter (father-in-law leap, Dong Yuchen. the initiative of common wheat-Aegilops comosa alien addition line and
Identify the effect to initiative common wheat-Aegilops comosa alien addition line of the .I. Wheat midge. Crop Science
Report, 1995,21 (1): 39-44)；1997, this seminar utilized RFLP labelling to identify from Semen Tritici aestivi-Aegilops comosa filial generation
4M (4D) substitution line (father-in-law leaps, Jia Jizeng, Dong Yuchen. utilize RFLP molecular markers for identification Semen Tritici aestivi-Aegilops comosa alien substitution.
Acta Genetica Sinica, 1997,24 (3): 248-254).In addition, have no about these species and Semen Tritici aestivi are carried out distant hybridization, and then obtain
Obtain the report of dyeing system including Semen Tritici aestivi-Aegilops comosa addition line, substitution line or translocation line.
Semen Tritici aestivi-far edge species chromosome system is the important tool positioning remote edge species favorable genes, therefore, it is thus achieved that multiple or a whole set of
Semen Tritici aestivi-far edge species chromosome system is the basis positioning its favorable genes.Up to now, identified go out Semen Tritici aestivi-Aegilops comosa
It is less.Based on this, we have carried out the research that Aegilops comosa kind matter is transferred to Semen Tritici aestivi, it is thus achieved that Semen Tritici aestivi-Aegilops comosa
Amphidiploid, and carry out the chromatinic transfer of Aegilops comosa to Semen Tritici aestivi obtaining based on amphidiploid, it is thus achieved that large quantities of treat
The cenospecies matter identified.Foundation can identify the cytogenetic markers of Aegilops comosa chromosome in chromosome of wheat group, to essence
The cenospecies matter that really qualification has obtained, therefrom obtains more Semen Tritici aestivi-Aegilops comosa dyeing system, and then it is excellent to be accurately positioned it
Allogene and be applied to wheat breeding work significant.
Restricted length polymorphism (Restricted Fragment Length Polymorphism, RFLP) can effectively be identified little
External source species chromosome in wheat background, but be because it operation is complicated, the used time is longer and need to be by shortcomings such as radiosiotope, phase
Ratio Rapid identification can understand that exogenous chromosome hybridization in situ technique of existence in Wheat Background has obvious inferior position.In situ
Hybridization includes the genomic in situ hybridization (Genomic in situ hybridization, GISH) carried out with genomic DNA for probe
With the fluorescence in situ hybridization (Fluorescence in situ hybridization, FISH) carried out for probe with DNA fragmentation.Compare
GISH and FISH, the latter have probe synthesis easily, without DNA and the simple operation and other advantages of blockading, the most by
It is widely used in identification (Tang ZX, Yang ZJ, the Fu SL.Oligonucleotides replacing the roles of of chromosome of wheat
repetitive sequences pAs1,pSc119.2,pTa-535,pTa71,CCS1,and pAWRC.1for FISH analysis.J.
Appl.Genetics 2014,55(3):313-318；Danilova TV,Friebe B,Gill BS.Single-copy gene
fluorescence in situ hybridization and genome analysis:Acc-2loci mark evolutionary chromosomal
Rearrangements in wheat.Chromosoma 2012,121:597-611.) and Wheat Background in the knowledge of external source species chromosome
Not (Gong WP, Li GR, Zhou JP, Li GY, Liu C, Huang CY, Zhao ZD, Yang ZJ.Cytogenetic and
molecular markers for detecting Aegilops uniaristata chromosomes in a wheat background.
Genome 2014,57(9):489-497；Liu C,Li GR,Gong WP,Li GY,Han R,Li HS,Song JM,Liu AF,
Cao XY,Chu XS,Yang ZJ,Huang CY,Zhao ZD,Liu JJ.2015.Molecular and cytogenetic
characterization of powdery mildew resistant wheat-Aegilops mutica partial amphiploid and
addition line.Cytogenetic and Genome Research 147:186-194.)。
Although the Chinese invention patent of Publication No. CN104789678A discloses one and utilizes polynucleotide
Oligo-pTa535-1, Oligo-pSc119.2-1 and (GAA)8For in probe identification chromosome of wheat group without awns goatweed chromosome
Cytogenetic methods, but, Aegilops comosa and be respectively MM and TT without awns goatweed genome, hence it is evident that different.
Additionally, from molecular level, the base of the two chloroplast DNA sequence spacer replaces situation, sequence deletes situation and micro-
Entirely different (Yamane and Kawahara, the Intera-and interspecific phylogenetic relationships of satellite sequence
among diploid Trititum-Aeglops species(Poaceae)based on base-pair substitutions,indels,and
microsatellites in chloroplast noncoding sequences.American Journal of Botany,2005,92(11):
1887-1898.).The two is at 5S ribosomal RNA (Baum et al.Phylogenetic relationships among diploid
Aegilops species inferred from 5S rDNA units.Molecular Phylogenetics and Evolution,2009,53:
34-44), 18S ribosomal RNA (Sallares and Brown, Phylogenetic analysis of complete 59external
transcribed spacers of the 18S ribosomal RNA genes of diploid Aegilops and related species
(Triticeae, Poaceae) .Genetic Resources and Crop Evolution, 2004,51:701 712.) and Gamma-alcohol molten
Protein family (Goryunova et al.Expansion of the gamma-gliadin gene family in Aegilops and Triticum.
BMC Evolutionary Biology, 2012,12:215) the aspect cluster analysis such as, the two can not gather in a class.
From cytogenetics level, the two chromosome C divides band banding pattern widely different (Friebe et al.Standard karyotypes
of Aegilops uniaristata,Ae.mutica,Ae.comosa subspecies comosa and heldreichii(Poaceae)Plant
Syst.Evol.202:199-210(1996)).Display that the two has with ribosomal RNA pTa794 and pTa71 for probe FISH
Different (Badaeva etc., the Genome differentiation in of 3 pairs of chromosome length, arm when signal locations of hybridization signal
Aegilops.2.Physical mapping of 5S and 18S-26S ribosomal RNA gene families in diploid species.
Genome,1996,39:1150-1158.).Showing with the FISH that pSc119 is carried out for probe, pSc119 is without awns goatweed 1T-7T
It is respectively provided with hybridization signal on chromosome, and only on Aegilops comosa 1M, 4M-7M chromosome, has hybridization signal, and the two
Chromosomal hybridation signal location and different (Badaeva etc., the Genome differentiation in of intensity
Aegilops.1.Distributuon of highly repetitive DNA sequences on chromosome of diploid species.
Genome,1996,39:293-306.)。
Although Aegilops comosa and belong to Aegilops together without awns goatweed, but, can from the result utilizing above prior art to report
To find out, either from molecular level, or from cytogenetics level, both differ greatly, and therefore, this area is general
Logical technical staff is unpredictable is applicable to the FISH authentication method without awns goatweed chromosome and whether probe is also applied for tip awn mountain
Leymus chinensis (Trin.) Tzvel., so, it is highly desirable to set up and a kind of identifies the detection method fast and accurately of Aegilops comosa chromosome in Semen Tritici aestivi.
Summary of the invention
In order to solve the problem not having the Testing and appraisal method of Aegilops comosa chromosome in chromosome of wheat in above prior art,
This application provides the FISH detection method of Aegilops comosa chromosome in a kind of Semen Tritici aestivi quickly, accurately detected.
The application is realized by following measures:
The FISH detection method of Aegilops comosa chromosome in a kind of Semen Tritici aestivi, comprises the following steps:
(1) with Semen Tritici aestivi-Aegilops comosa amphidiploid as material, its chromosome specimen is prepared；With polynucleotide
Oligo-pTa535-1 and Oligo-pSc119.2-1 is that probe carries out double-colored FISH to chromosome specimen, it is thus achieved that double-colored FISH schemes；
After FISH signal eluting, then with (GAA)8For probe, same chromosome specimen carried out monochromatic FISH, it is thus achieved that monochromatic FISH
Figure；Double-colored FISH figure is compared with 42 chromosome double-colored FISH standard drawings of Semen Tritici aestivi, identifies 14 dyes of Aegilops comosa
Colour solid；Further according to monochromatic FISH figure, 14 chromosomes of Aegilops comosa are made a distinction pairing；
(2) miscellaneous to Semen Tritici aestivi-Aegilops comosa to be measured with polynucleotide Oligo-pTa535-1 and Oligo-pSc119.2-1 for probe
The chromosome handing over offspring carries out double-colored FISH, it is thus achieved that double-colored FISH schemes；Eluting double-colored FISH signal, then with polynucleotide
(GAA)8Hybridize for the chromosome sectioning after probe FISH double-colored to eluting signal, it is thus achieved that monochromatic FISH figure；By this step
The rapid double-colored and monochromatic FISH figure obtained is compared to the corresponding FISH figure of step (1) respectively, identifies Semen Tritici aestivi-tip awn goat
The chromosome of grass crossing offspring；
Wherein,
Oligo-pSc119.2-1:CCGTTTTGTGGACTATTACTCACCGCTTTGGGGTCCCAT AGCTAT,
As shown in SEQ ID NO.1；
Oligo-pTa535-1:
AAAAACTTGACGCACGTCACGTACAAATTGGACAAACTCTTTCGGAGTATCAGGGT
TTC, as shown in SEQ ID NO.2；
(GAA) 8:GAAGAAGAAGAAGAAGAAGAAGAA, as shown in SEQ ID NO.3；
Described Semen Tritici aestivi-Aegilops comosa amphidiploid, is to be obtained hybrid F by Chinese spring with Aegilops comosa hybridization1, then by miscellaneous
Plant F1Through doubling the material obtained.
Described Semen Tritici aestivi-Aegilops comosa hands over offspring, refers to the hybridization of Chinese spring-Aegilops comosa amphidiploid and Chinese spring
Backcross progeny.
The FISH standard drawing of described 42 chromosomes of Semen Tritici aestivi, is with polynucleotide Oligo-pTa535-1 and Oligo-pSc119.2-1
Obtain after chromosome of wheat being carried out double-colored FISH for probe.
The present invention first with Oligo-pTa535-1 and Oligo-pSc119.2-1 for probe to Semen Tritici aestivi-Aegilops comosa amphidiploid
XX039 carries out double-colored FISH, it is thus achieved that double-colored FISH schemes；Compare with the FISH standard drawing of 42 chromosomes of Semen Tritici aestivi and divide
Analysis, it was found that the hybridization signal of 21 pairs of chromosomes of wheat in XX039 is different, and contaminates with 14 Aegilops comosas
Colour solid FISH signal is different (Figure 1A).Above-mentioned double-colored FISH signal is carried out eluting, then, then with (GAA)8For probe pair
Same chromosome sectioning carries out monochromatic FISH, it is thus achieved that monochromatic FISH figure.Owing to monochromatic FISH and double-colored FISH is at same cell
Carry out on chromosome, so, monochrome FISH figure is compared with double-colored FISH figure, Aegilops comosa can be directly obtained
Article 14, (GAA) of chromosome8Hybridization information.(GAA)8Hybridization signal shows, 14 Aegilops comosa chromosomal hybridation signals can
It is divided into 7 classes, i.e. can carry out 14 Aegilops comosa chromosomes being paired into 7 to (numbering according to M1-M7 at random).M1-M7
Monochromatic FISH signal different (Figure 1B), illustrate, with (GAA)8For the monochromatic FISH of probe, can be the most effective
Identify Aegilops comosa chromosome.
Because (GAA)8Chromosome of wheat 1A and 3D-6D does not has hybridization signal or signal the faintest (Danilova etc.,
2012), i.e. can not disposably all chromosomes of wheat be made a distinction；Again because with Oligo-pTa535-1 and
The FISH signal of Oligo-pSc119.2-1 may be in material crossover process because the Cytoplasm on chromosome sectioning is how many, liquid transfer gun head
Quality different and additionally pick that probe is how many and FISH film-making eluting degree and cause weak signal to lose and the situation such as strong signal weaker；
Therefore, this research is thought, the double-colored FISH first carried out with Oligo-pTa535-1 and Oligo-pSc119.2-1 for probe, eluting
After signal, more same chromosome sectioning is carried out with (GAA)8The monochromatic FISH carried out for probe, just can disposably identify clear
All chromosomes of Chu little Mai-Aegilops comosa cenospecies matter.(GAA)8Hybridization signal is too strong, and signal is difficult to eluting, therefore,
Double-colored FISH and monochromatic FISH sequencing can not change.
In the present invention, concretely comprising the following steps of fluorescence in situ hybridization:
(1) tip of a root processes: takes the 2-3cm tip of a root and is placed in the vial containing 0.2mol/L hydrochloric acid, processes under 60 DEG C of water bath condition
7min；
(2) film-making: the tip of a root is taken out and is put on microscope slide, cut root cap, strip out meristematic cell with dissecting needle, drip upper
Dripping glacial acetic acid, the tabletting of 45%, room temperature is dried, it is thus achieved that division phases chromosome specimen；
(3) join hybridization solution: as a example by individual chromosome specimen, take 8ng probe Oligo-pTa535-1 and 8ng probe
Oligo-pSc119.2-1 (double-colored FISH) joins in the buffer of 8 μ l, mixing, is made into hybridization solution；The concentration of probe is
10μmol/L；Described buffer: 1 × TE+2 × SSC, PH=7.Monochromatic FISH probe (GAA)8For 6ng, other condition is not
Become.
(4) hybridization: be added drop-wise on chromosome specimen by hybridization solution, covered, is positioned over bottom and is covered with moulding of moistening filter paper
In magazine, cover lid, be placed in the hybridization case of 37 DEG C hybridization and be not less than 5h；
(5) eluting: after having hybridized, taking-up chromosome specimen is put into and is dipped to coverslip nature in the eluting cylinder filling distilled water
Landing, tweezers clamp chromosome specimen move up and down in distilled water cleaning 2-3 time, take out chromosome specimen, lucifuge leading to
Wind cupboard dries；
(6) photograph: add the 5 μ l anti-color fading agent containing DAPI (4', 6-diamidino-2-phenylindone) to dried chromosome specimen,
Covered, microscopy photograph under fluorescence microscope.
Step (4), during covered, it is to avoid bubble occurs；The soak time of step 5 is preferably: 30-60s.
The present invention is with polynucleotide Oligo-pTa535.1 and Oligo-pSc119.2, (GAA)8) it is probe, utilize FISH to little
Wheat-Aegilops comosa partial amphidiploid is analyzed, and result shows, with Oligo-pTa535.1 and Oligo-pSc119.2 for visiting
The double-colored FISH of pin, with (GAA)8Monochromatic FISH for probe all can be at Aegilops comosa 7 to producing difference hybridization on chromosome
Signal, and entirely different with chromosome of wheat hybridization signal, it is thus achieved that the tip awn with above-mentioned 3 polynucleotide sequence as probe
The FISH of goatweed without awns of the Chinese invention patent report of goatweed chromosome FISH banding pattern and Publication No. CN104789678A
Banding pattern difference is huge, is the most unpredictable, is that above three polymerized nucleoside acid probe is at Aegilops comosa chromosome
The reported first of upper location, is also the cytogenetic markers that Aegilops comosa chromosome is new.In order to above-mentioned two FISH to little
Wheat-Aegilops comosa Introgressed line is identified, it was found that use two kinds of FISH methods can effectively identify Wheat Background simultaneously
Middle Aegilops comosa chromosome, therefore, it can be widely used in screening and the appraisal of Semen Tritici aestivi-Aegilops comosa breeding new germ plasm.
The present invention establishes the Aegilops comosa M new labelling of chromosome cytogenetics, it is provided that tip awn in detection chromosome of wheat group
The new method of goatweed M chromosome.Aegilops comosa immunity wheat powdery mildew, is the important gene source of wheat breeding for disease resistance.I
Carried out the research that Aegilops comosa kind matter is imported Semen Tritici aestivi, it is thus achieved that what a collection of needs were identified includes high resist powdery mildew of wheat
Semen Tritici aestivi-Aegilops comosa filial generation material.Bond material disease resistance survey result, utilizes Aegilops comosa chromosome FISH to mark
The quasi-figure 37 portions of Semen Tritici aestivis-Aegilops comosa filial generation material (numbered XX040-XX076) to randomly selecting carries out cytology
Identify, therefrom identified the Special germplasm resources 22 parts containing Aegilops comosa chromosome (or chromosome segment), wherein anti-white
6 parts of powder disease.The Aegilops comosa chromosome FISH method that the present invention sets up, has widened polymerized nucleoside acid probe at Tribe Triticeae
Range of application in species, can be applied to Semen Tritici aestivi-Aegilops comosa distant hybridization New idioplasm resource as its cytogenetic markers
Identify, transfer to Semen Tritici aestivi provides effective cytogenetics authentication method for desirable genes on Aegilops comosa chromosome.
Accompanying drawing explanation
Fig. 1 is with Oligo-pTa535.1-1 and Oligo-pSc119.2-1, (GAA)8For probe, double to China spring-Aegilops comosa
The FISH result of diploid XX039 Metaphase Chromosomes, figure A is that Oligo-pTa535.1-1 is (light grey
Signal) and the double-colored FISH figure of Oligo-pSc119.2-1 (white signal), figure B is (GAA)8FISH figure
(white signal).M1-M7 is Aegilops comosa chromosome, do not mark for chromosome of wheat.Length of the scale is
10μm；
Fig. 2 is with Oligo-pTa535.1-1 (light grey signal) and Oligo-pSc119.2-1 (white signal), (GAA)8(white
Signal) it is probe, the standard FISH figure of Aegilops comosa.M1-M7 be Aegilops comosa 7 pairs of chromosomes (because of
Do not determine its Homoeologous groups temporarily, thus according to its FISH signal, its homologous chromosome is ordered according to M1-M7 side by side
Name).A row is the form of the prochromosome not being FISH, B row be with Oligo-pTa535.1-1 and
Oligo-pSc119.2-1 is the FISH figure of probe, and C row is by Oligo-pTa535.1-1 and Oligo-pSc119.2-1
After signal eluting, then with (GAA)8Carry out the FISH figure hybridized；
Fig. 3 China spring-Aegilops comosa Introgressed line XX044 (figure A, B) and the FISH figure of XX042 (figure C, D).Figure
A and C, probe is Oligo-pTa535.1-1 (light grey signal) and Oligo-pSc119.2-1 (white signal)；
Figure B and D, probe is (GAA)8(light grey signal).Arrow show Aegilops comosa chromosome.Yellow mark
Chi represents 10 μm；
Fig. 4 China spring-Aegilops comosa Introgressed line XX043 (figure A, B) and the FISH figure of XX045 (figure C, D).
Figure A and C, probe is Oligo-pTa535.1-1 (light grey signal) and Oligo-pSc119.2-1 (white letter
Number)；Figure B and D, probe is (GAA)8(light grey signal).Arrow show Aegilops comosa chromosome.
Yellow scale represents 10 μm；
Fig. 5 China spring-Aegilops comosa Introgressed line XX041 (figure A, B) and the FISH figure of XX046 (figure C, D).Figure
A and C, probe is Oligo-pTa535.1-1 (light grey signal) and Oligo-pSc119.2-1 (white signal)；
Figure B and D, probe is (GAA)8(white signal).Arrow show Aegilops comosa chromosome.Yellow mark
Chi represents 10 μm；
Fig. 6 Aegilops comosa (TA1967), China spring-Aegilops comosa Introgressed line XX041 (containing M6 chromosome), XX042
(containing M3 chromosome), XX043 (containing M4 chromosome), XX044 (containing M2 chromosome), XX045 (contain
M5 chromosome), XX049 (containing M5 chromosome), XX040 (containing M7 chromosome) and China spring (CS)
Powder mildew resistance identifies figure.
Detailed description of the invention
In following embodiment, if no special instructions, FISH method used is identical with the FISH method that Summary describes,
The synthesis of probe is completed by Chengdu Rui Xin biotech firm, and each probe with iridescent FAM and Tamra labelling, is i.e. selected respectively
Different fluorescein-labeled same probes all may produce red or green hybridization signal.Semen Tritici aestivi China spring (CS) is by electronics technology
University life science and technology institute professor Li Guangrong provides.Aegilops comosa (TA1967) is little by the state university of kansas, U.S.A
Wheat genomics provides with genetic resources center Raupp doctor J.During China spring-Aegilops comosa amphidiploid (XX039) is
State's spring hybridizes with Aegilops comosa, hybrid F1Through doubling acquisition.XX040-XX076 is after the hybridization of XX039 Yu CS backcrosses
For material.The Disease Resistance Identification reference literature of vegetable material (Liu becomes. the separation of the perennial new repetitive sequence of haynaldia villosa genome and
Its application [D] in disease-resistant wheat new germ plasm is identified. University of Electronic Science and Technology .2010.).
Concretely comprising the following steps of fluorescence in situ hybridization:
(1) tip of a root processes: takes the 2-3cm tip of a root and is placed in the vial containing 0.2mol/L hydrochloric acid, processes under 60 DEG C of water bath condition
7min；
(2) film-making: the tip of a root is taken out and is put on microscope slide, cut root cap, strip out meristematic cell with dissecting needle, drip upper
Dripping glacial acetic acid, the tabletting of 45%, room temperature is dried, it is thus achieved that division phases chromosome specimen；
(3) join hybridization solution: as a example by individual chromosome specimen, take 8ng probe Oligo-pTa535-1 and 8ng probe
Oligo-pSc119.2-1 (double-colored FISH) joins in the buffer of 8 μ l, mixing, is made into hybridization solution；The concentration of probe is
10μmol/L；Described buffer: 1 × TE+2 × SSC, PH=7.Monochromatic FISH probe (GAA)8For 6ng, other condition is not
Become.
(4) hybridization: be added drop-wise on chromosome specimen by hybridization solution, covered, is positioned over bottom and is covered with moulding of moistening filter paper
In magazine, cover lid, be placed in the hybridization case of 37 DEG C hybridization and be not less than 5h；
(5) eluting: after having hybridized, taking-up chromosome specimen is put into and is dipped to coverslip nature in the eluting cylinder filling distilled water
Landing, tweezers clamp chromosome specimen move up and down in distilled water cleaning 2-3 time, take out chromosome specimen, lucifuge leading to
Wind cupboard dries；
(6) photograph: add the 5 μ l anti-color fading agent containing DAPI (4', 6-diamidino-2-phenylindone) to dried chromosome specimen,
Covered, microscopy photograph under fluorescence microscope.
1. the cytological Identification of China spring-Aegilops comosa amphidiploid
Can reflect with the double-colored FISH that polynucleotide Oligo-pTa535.1-1 and Oligo-pSc119.2-1 is carried out for probe simultaneously
Determine 42 chromosomes of cultivated wheat (Tang etc., 2014), it is also possible to be applied to identify the goatweed without awns in chromosome of wheat group
Chromosome (Liu etc., 2015), but, if there is not been reported to can apply to the qualification of Aegilops comosa, if can apply to
Identify that the Aegilops comosa chromosome in chromosome of wheat group is the most on the knees of the gods.This research with Oligo-pTa535.1-1 and
Oligo-pSc119.2-1 is that probe has carried out fish analysis, warp and Semen Tritici aestivi 42 to Semen Tritici aestivi-Aegilops comosa amphidiploid XX039
Bar chromosome standard FISH signal (Tang etc., 2014) comparison, it was found that containing 21 pairs of FISH signals in XX039
Different chromosomes of wheat；Residue 7 different to signal and different from the hybridization signal of 21 pairs of chromosomes of wheat chromosomes are
Aegilops comosa M1-M7 chromosome (Figure 1A).The above-mentioned chromosome sectioning being double-colored FISH is carried out signal eluting, so
After, with (GAA)8For probe, it is analyzed again, it was found that (GAA)8At Aegilops comosa 7 on chromosome
Hybridization signal different (Figure 1B), and signal is different from chromosome of wheat signal.
2. the polynucleotide FISH banding pattern of Aegilops comosa
Because Aegilops comosa chromosome set is MM, therefore, according to the hybridization signal situation of above-mentioned 3 probes in XX039
7 pairs of Aegilops comosa chromosomes at random according to M1-M7 number.For the clear polynucleotide to Aegilops comosa
FISH banding pattern is analyzed describing, and 7 pairs of Aegilops comosa chromosomes in XX039 has been carried out extraction and analysis, such as Fig. 2 institute
Show.
In M1-M7 chromosome, M1 and M2 is non-isochromosome and M2 relatively M1 length；M4 has satellite.M1 is at silk
Grain district and long-armed end have Oligo-pTa535.1-1 hybridization signal, and centric region signal is stronger；M2 is at galianconism end, short
In the middle part of arm, long-armed proximal end and end be respectively provided with Oligo-pTa535.1-1 signal, have stronger at long-armed end
Oligo-pSc119.2-1 signal；M3 has Oligo-pTa535.1-1 signal at galianconism end and proximal end, and distal tip signal is relatively
By force, proximal end signal is the most weak；M4 has stronger Oligo-pSc119.2-1 signal at long-armed end, at secondary constriction and galianconism end
End has weak Oligo-pTa535.1-1 signal；M5 has Oligo-pSc119.2-1 signal at long-armed end and galianconism proximal end,
There is at the nearly centromere of galianconism weak Oligo-pTa535.1-1 signal；M6 has at galianconism end and long-armed end
Oligo-pTa535.1-1 signal, has Oligo-pSc119.2-1 signal at long-armed proximal end；M7 has at galianconism end strongly
Oligo-pSc119.2-1 signal.
(GAA)8In M1 X chromosome centric, long-armed nearly centric region and long-armed proximal end there is hybridization signal, centric region
Signal is stronger；In the middle part of M2 end, with long-armed nearly centric region, there is stronger signal, have at centric region and long-armed proximal end
Weaker signal；It is respectively provided with weak hybridization signal at M3 galianconism end and middle part and long-armed nearly centric region；M4 centric region,
Long-armed nearly centric region and middle part are respectively provided with hybridization signal；It is respectively provided with at M5 centric region, the nearly centric region of long galianconism and middle part
Stronger hybridization signal；It is respectively provided with the faintest hybridization signal at M6 galianconism end, long-armed middle part and end；Silk at M7
In the middle part of grain district and galianconism, there is stronger hybridization signal.
3. pair China spring-Aegilops comosa hybridization germ plasm resource carries out the practicality of identification and detection method
For the practicality to checking detection method (double-colored FISH+ monochrome FISH), to randomly selecting 37 parts little of this research
Wheat-Aegilops comosa filial generation has carried out CYTOGENETIC ANALYSIS OF ONE.It was found that in the 37 parts of materials identified, do not identify
Containing the filial generation of M1 chromosome, illustrate to identify that colony is the least or this chromosome transport is the lowest；XX044、XX051、XX058
With in XX062 all containing 1 pair of Aegilops comosa M2 chromosome, wherein the FISH of XX044 schemes as shown in figs.3 a and 3b；
Containing 1 Aegilops comosa M3 chromosome in XX042, containing 1 pair of Aegilops comosa M3 chromosome in XX056 and XX057,
Wherein the FISH of XX042 schemes as illustrated in figures 3 c and 3d；Containing 1 to top in XX043, XX063, XX065 and XX069
Awns goatweed M4 chromosome, wherein the FISH of XX043 schemes as illustrated in figures 4 a and 4b；XX045、XX049、XX064
With in XX070 containing 1 pair of Aegilops comosa M5 chromosome, wherein the FISH of XX045 schemes as shown in figures 4 c and 4d；XX041、
Containing 1 pair of Aegilops comosa M6 chromosome in XX054, XX066 and XX071, wherein the FISH of XX041 schemes such as Fig. 5 A
Shown in 5B；Containing 1 couple of Aegilops comosa M7 in XX040, XX046, XX068, XX072, XX073 and XX076
Chromosome, wherein the FISH of XX046 schemes as seen in figs. 5c and 5d；XX047、XX048、XX050、XX052、XX053、
Without Aegilops comosa chromosome in XX055, XX059, XX060, XX061, XX067, XX074 and XX075.Institute
Selecting in 37 filial generations has 25 can identify containing Aegilops comosa chromosome, illustrates that this detection method can apply to little
In the qualification of wheat-Aegilops comosa germ plasm resource.
The cytogenetics random detection situation of table 1 Semen Tritici aestivi-Aegilops comosa germ plasm resource
| Material number | Containing M chromosome situation | Material number | Containing M chromosome situation | Material number | Containing M chromosome situation |
| XX040 | 1 couple of M7 | XX053 | - | XX066 | 1 couple of M6 |
| XX041 | 1 couple of M6 | XX054 | 1 couple of M6 | XX067 | - |
| XX042 | Article 1, M3 | XX055 | - | XX068 | 1 couple of M7 |
| XX043 | 1 couple of M4 | XX056 | 1 couple of M3 | XX069 | 1 couple of M4 |
| XX044 | 1 couple of M2 | XX057 | 1 couple of M3 | XX070 | 1 couple of M5 |
| XX045 | 1 couple of M5 | XX058 | 1 couple of M2 | XX071 | 1 couple of M6 |
| XX046 | 1 couple of M7 | XX059 | - | XX072 | 1 couple of M7 |
| XX047 | - | XX060 | - | XX073 | 1 couple of M7 |
| XX048 | - | XX061 | - | XX074 | - |
| XX049 | 1 couple of M5 | XX062 | 1 couple of M2 | XX075 | - |
| XX050 | - | XX063 | Article 1, M4 | XX076 | 1 couple of M7 |
| XX051 | 1 couple of M2 | XX064 | 1 couple of M5 | ||
| XX052 | - | XX065 | 1 couple of M4 |
4. China spring-Aegilops comosa hybridization germ plasm resource resist powdery mildew of wheat is identified
Shandong Province is that China's second largest Semen Tritici aestivi main product saves, and wheat powdery mildew is occurred frequently over the years, therefore, identifies a collection of new resistance source and stores up
Standby disease-resistant new gene, significant to sustainable breeding for disease resistance.Aegilops comosa height resist powdery mildew of wheat, this research is to upper
Stating 37 parts of China spring-Aegilops comosa filial generation, to carry out wheat powdery mildew (Shandong Province's wheat powdery mildew mixing biological strain) anti-
Property identify, it was found that Aegilops comosa (TA1967) and containing the highest resist powdery mildew of wheat of material of M7 chromosome, and
Comparison China spring (CS) and the China spring-Aegilops comosa amphidiploid XX001 without M7 chromosome then the highest sense white wheat
Powder is sick (Fig. 6), therefore, M7 chromosome may contain resist powdery mildew of wheat new gene.Therefore, this material can apply to
Wheat anti-powdery mildew breeding work.The cytogenetics detection side of Aegilops comosa in the detection chromosome of wheat group that the present invention sets up
Method can be widely applied to the cytogenetics detection of Aegilops comosa improvement wheat powdery mildew resistance.Wherein, TA1967,
The powder mildew resistance of XX040-XX045, XX049 and CS identifies figure as shown in Figure 6.
Above-described embodiment is the present invention preferably embodiment, but embodiments of the present invention should not be limited by the examples, other
The change made under any spirit without departing from the present invention and principle, modify, combine, substitute, simplify and all should be equivalence and replace
Change mode, within being included in protection scope of the present invention.
<110>the FISH detection method of Aegilops comosa chromosome in Semen Tritici aestivi
<120>Crop Inst. of shandong Prov. Agriculture science Academy
<160> 3
<210> 1
<211>45
<212> DNA
<213>synthetic
<400> 1
CCGTTTTGTG GACTATTACT CACCGCTTTG GGGTCCCATA
GCTAT 45
<210> 2
<211> 59
<212> DNA
<213>synthetic
<400> 2
AAAAACTTGA CGCACGTCAC GTACAAATTG GACAAACTCT
TTCGGAGTAT CAGGGTTTC 59
<210> 3
<211> 24
<212> DNA
<213>synthetic
<400> 3
GAAGAAGAAG AAGAAGAAGA AGAA 24
Claims (6)
1. the FISH detection method of Aegilops comosa chromosome in Semen Tritici aestivi, it is characterized in that for probe, the chromosome specimen of Semen Tritici aestivi to be checked-Aegilops comosa filial generation being carried out double-colored FISH with polynucleotide Oligo-pTa535-1 and Oligo-pSc119.2-1, it is thus achieved that double-colored FISH schemes；After FISH signal eluting, then with (GAA)8For probe, same chromosome specimen carrying out monochromatic FISH, it is thus achieved that monochromatic FISH figure, the double-colored FISH and the monochrome FISH that obtain through same operation with Semen Tritici aestivi-Aegilops comosa amphidiploid the most respectively compare.
FISH detection method the most according to claim 1, it is characterised in that scheme to compare with 42 chromosome double-colored FISH standard drawings of Semen Tritici aestivi by the double-colored FISH of Semen Tritici aestivi-Aegilops comosa amphidiploid, identify 14 chromosomes of Aegilops comosa；Further according to monochromatic FISH figure, 14 chromosomes of Aegilops comosa are made a distinction pairing.
FISH detection method the most according to claim 1, it is characterised in that Oligo-pSc119.2-1 base sequence is shown in that sequence 2 in sequence table are seen in sequence 1 in sequence table, Oligo-pTa535-1 base sequence, (GAA)8Sequence is shown in sequence 3 in sequence table.
FISH detection method the most according to claim 2, it is characterized in that to 7 pairs of Aegilops comosa chromosome random number in Semen Tritici aestivi-Aegilops comosa amphidiploid be M1, M2, M3, M4, M5, M6, M7, M1 and M2 is non-isochromosome and M2 relatively M1 length, and M4 has satellite；
M1 has Oligo-pTa535.1-1 hybridization signal at centric region and long-armed end；M2 in the middle part of galianconism end, galianconism, long-armed proximal end and end be respectively provided with Oligo-pTa535.1-1 signal, at long-armed end, there is Oligo-pSc119.2-1 signal；M3 has Oligo-pTa535.1-1 signal at galianconism end and proximal end；M4 has Oligo-pSc119.2-1 signal at long-armed end, has Oligo-pTa535.1-1 signal at secondary constriction and galianconism end；M5 has Oligo-pSc119.2-1 signal at long-armed end and galianconism proximal end, has Oligo-pTa535.1-1 signal at the nearly centromere of galianconism；M6 has Oligo-pTa535.1-1 signal at galianconism end and long-armed end, has Oligo-pSc119.2-1 signal at long-armed proximal end；M7 has Oligo-pSc119.2-1 signal at galianconism end；
(GAA)8In M1 X chromosome centric, long-armed nearly centric region and long-armed proximal end there is hybridization signal；In the middle part of M2 end, with long-armed nearly centric region, there is signal, at centric region and long-armed proximal end, there is signal；It is respectively provided with hybridization signal at M3 galianconism end and middle part and long-armed nearly centric region；It is respectively provided with hybridization signal at M4 centric region, long-armed nearly centric region and middle part；It is respectively provided with hybridization signal at M5 centric region, the nearly centric region of long galianconism and middle part；It is respectively provided with hybridization signal at M6 galianconism end, long-armed middle part and end；In the middle part of M7 centric region and galianconism, there is hybridization signal.
FISH detection method the most according to claim 4, it is characterised in that the chromosome specimen of Semen Tritici aestivi to be checked-Aegilops comosa filial generation contains the more than one pair of chromosome in claim 4 in M1-M7, containing Aegilops comosa chromosome in chromosome the most to be checked.
FISH detection method the most according to claim 1, it is characterised in that fluorescence in-situ hybridization method operating procedure is as follows:
(1) tip of a root processes: takes the 2-3cm tip of a root and is placed in the vial containing 0.2 mol/L hydrochloric acid, processes 7min under 60 DEG C of water bath condition；
(2) film-making: taken out by the tip of a root processed through step (1) and be put on microscope slide, cut root cap, strip out meristematic cell with dissecting needle, drips glacial acetic acid, the tabletting of upper one 45%, and room temperature is dried, it is thus achieved that division phases chromosome specimen；
(3) configuration hybridization solution: as a example by individual division phases chromosome specimen, take in the buffer that 8ng probe Oligo-pTa535-1 and 8ng probe Oligo-pSc119.2-1 joins 8 μ l, mixing, it is made into hybridization solution；The concentration of probe is 10 μm ol/L；Described buffer: 1 × TE+2 × SSC, PH=7, monochromatic FISH probe (GAA)8For 6ng；
(4) hybridization: be added drop-wise to by hybridization solution on division phases chromosome specimen, covered, is positioned over bottom and is covered with in the plastic casing of moistening filter paper, cover lid, is placed in the hybridization case of 37 DEG C hybridization and is not less than 5h；
(5) eluting: after having hybridized, taking-up chromosome specimen is put into and is dipped to coverslip nature landing in the eluting cylinder filling distilled water, tweezers clamp chromosome specimen move up and down in distilled water cleaning 2-3 time, taking-up chromosome specimen, dry in the fume hood of lucifuge；
(6) photograph: add the 5 μ l anti-color fading agent containing 4', 6-diamidino-2-phenylindone, covered, microscopy photograph under fluorescence microscope to dried chromosome specimen.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610301879.2A CN105907864A (en) | 2016-05-06 | 2016-05-06 | FISH detection method for aegilops comosa chromosome in wheat |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610301879.2A CN105907864A (en) | 2016-05-06 | 2016-05-06 | FISH detection method for aegilops comosa chromosome in wheat |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105907864A true CN105907864A (en) | 2016-08-31 |
Family
ID=56747838
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610301879.2A Pending CN105907864A (en) | 2016-05-06 | 2016-05-06 | FISH detection method for aegilops comosa chromosome in wheat |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105907864A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111218523A (en) * | 2020-03-25 | 2020-06-02 | 山东省农业科学院作物研究所 | Leymus divaricata 7SbChromosome specific molecular marker and application thereof |
| CN116926232A (en) * | 2023-08-28 | 2023-10-24 | 四川农业大学 | Molecular marker primer for detecting aegilops on top-miscanthus 1M chromosome and application thereof |
| CN116970733A (en) * | 2023-08-28 | 2023-10-31 | 四川农业大学 | Molecular marker primer for detecting aegilops tenuis 7M chromosome and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103710455A (en) * | 2014-01-02 | 2014-04-09 | 四川农业大学 | Method for obtaining oligonucleotide probe |
| CN104789678A (en) * | 2015-04-21 | 2015-07-22 | 山东省农业科学院作物研究所 | Identification method for amblyopyrum muticum chromosome in wheat genome |
-
2016
- 2016-05-06 CN CN201610301879.2A patent/CN105907864A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103710455A (en) * | 2014-01-02 | 2014-04-09 | 四川农业大学 | Method for obtaining oligonucleotide probe |
| CN104789678A (en) * | 2015-04-21 | 2015-07-22 | 山东省农业科学院作物研究所 | Identification method for amblyopyrum muticum chromosome in wheat genome |
Non-Patent Citations (1)
| Title |
|---|
| 刘成等: "将6个山羊草新种质向小麦中转移的研究初报", 《2014年中国作物学会学术年会论文集》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111218523A (en) * | 2020-03-25 | 2020-06-02 | 山东省农业科学院作物研究所 | Leymus divaricata 7SbChromosome specific molecular marker and application thereof |
| CN111218523B (en) * | 2020-03-25 | 2022-01-25 | 山东省农业科学院作物研究所 | Leymus divaricata 7SbChromosome specific molecular marker and application thereof |
| CN116926232A (en) * | 2023-08-28 | 2023-10-24 | 四川农业大学 | Molecular marker primer for detecting aegilops on top-miscanthus 1M chromosome and application thereof |
| CN116970733A (en) * | 2023-08-28 | 2023-10-31 | 四川农业大学 | Molecular marker primer for detecting aegilops tenuis 7M chromosome and application thereof |
| CN116926232B (en) * | 2023-08-28 | 2024-02-09 | 四川农业大学 | Molecular marker primer for detecting aegilops on top-miscanthus 1M chromosome and application thereof |
| CN116970733B (en) * | 2023-08-28 | 2024-03-08 | 四川农业大学 | Molecular marker primer for detecting aegilops tenuis 7M chromosome and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Luo et al. | Genetic diversity of mango cultivars estimated using SCoT and ISSR markers | |
| Zhou et al. | Genetic diversity of rice false smut fungus, Ustilaginoidea virens and its pronounced differentiation of populations in North China | |
| CN106868131B (en) | SNP molecular marker of upland cotton No. 6 chromosome related to fiber strength | |
| Tian-Mei et al. | Analysis of genetic diversity and trapping elite alleles for plant height in drought-tolerant wheat cultivars | |
| Zhang et al. | Deletion mapping and verification of an enhanced-grain number per spike locus from the 6PL chromosome arm of Agropyron cristatum in common wheat | |
| CN105907864A (en) | FISH detection method for aegilops comosa chromosome in wheat | |
| Gan et al. | Individual chromosome identification, chromosomal collinearity and genetic-physical integrated map in Gossypium darwinii and four D genome cotton species revealed by BAC-FISH | |
| CN107475390B (en) | Development and application of decaploid elytrigia elongata series repeat sequence specific probe | |
| CN107400715B (en) | Development and application of special molecular marker and probe of decaploid elytrigia elongata | |
| CN107312870A (en) | With molecular labeling, method and the application of capsicum sterile restoring gene close linkage | |
| CN104789678A (en) | Identification method for amblyopyrum muticum chromosome in wheat genome | |
| CN110607382B (en) | SNP molecular marker of single ring weight major gene from Xinluzao 24 | |
| CN102586238A (en) | Function specific molecular marker PilFNP of rice blast resistance gene Pil as well as method and application thereof | |
| CN108330208A (en) | A kind of molecular labeling of detection capsicum cytoplasmic male sterility restoring gene | |
| CN105063206A (en) | Molecular breeding method using plant anti-disease gene enriched clusters, and applications thereof | |
| CN104531859B (en) | A kind of detection method for the molecular labeling primer and aneuploid hybrid generation plant for detecting aneuploid hybrid generation plant | |
| CN106434930A (en) | Primer for purity identification of cucumber 'Yueqing 1' hybrid seed and method | |
| Grisi et al. | Genetic variability of passion fruit multispecific hybrids and their respective wild parents determined by microsatellite markers | |
| CN110453008A (en) | One with the molecular labeling ZMM6206 and its application of gingili leaf length of a film and wide major gene loci close linkage | |
| CN103290028B (en) | Paddy rice thermo sensitive genic male sterile gene tms 9 and functional marker thereof | |
| CN113832251B (en) | SNP locus combination for detecting tomato mosaic virus resistance and application thereof | |
| CN105524994B (en) | The molecular labeling HRM7 of barley grain length gene Lkl2 a kind of and its application | |
| Tang et al. | Molecular cytogenetic characterization and phylogenetic analysis of four Miscanthus species (Poaceae) | |
| Jin et al. | Molecular and cytogenetic characterization of an Oryza officinalis–O. sativa chromosome 4 addition line and its progenies | |
| CN109504797B (en) | SNP (Single nucleotide polymorphism) marker for identifying early blossoming of pear tree based on high-resolution dissolution curve and application of SNP marker |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20160831 |