CN107557433A - A kind of visible detection method of nucleic acid amplification product - Google Patents
A kind of visible detection method of nucleic acid amplification product Download PDFInfo
- Publication number
- CN107557433A CN107557433A CN201710730077.8A CN201710730077A CN107557433A CN 107557433 A CN107557433 A CN 107557433A CN 201710730077 A CN201710730077 A CN 201710730077A CN 107557433 A CN107557433 A CN 107557433A
- Authority
- CN
- China
- Prior art keywords
- amplified production
- filter plate
- light filter
- detection method
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention discloses a kind of visible detection method of nucleic acid amplification product, before this method is included in nucleic acid amplification reaction, the fluorescence probe or fluorescent dye of certain concentration are added into amplification system, the amplified production of acquisition is after processing, it is placed in visual detection device and detects, whether shows that fluorescence determines the presence or absence of amplified production according to detection means；If showing fluorescence, amplified production be present；Conversely, then without；The visual detection device includes the housing of inner hollow, and housing sidewall is provided with the pore for being used for placing amplified reaction pipe and exciting light filter plate and transmitting light filter plate, visible light source is provided with above the exciting light filter plate.That the inventive method can obtain is accurate, directly perceived, qualitatively augmentation detection result, the dependence to non-portable instrument and equipment is broken away from, and operation of uncapping need not be carried out, Aerosol Pollution will not be caused, both Visual retrieval is realized, make that simple to operate, cost is cheap again, be advantageous to Site Detection and be widely applied.
Description
Technical field
The present invention relates to the visualization inspection of nucleic acid amplification product detection technique field, more particularly to a kind of nucleic acid amplification product
Survey method.
Background technology
The advantages that nucleic acid amplification detection method is because of its high specific, high sensitivity, is widely used in medical diagnosis, food
The fields such as safety detection.
Detection for amplified production, traditional method are to use gel electrophoresis, and this method wastes time and energy, and are existed to human body
Harm, it is most important that uncap and easily cause Aerosol Pollution.And another method, i.e.,：Real-time fluorescence detection method needs integrated
Expensive fluorescence equipment, substantially increases testing cost.
Above two method is required to technical professional and non-portable instrument and equipment, limits the technology at the scene
The application of context of detection.
Quickly, simply and intuitively visible detection method turns into a development trend of Site Detection.At present, it is existing big
The report of the visible detection method on nucleic acid amplification product is measured, such as：Nephelometry, colorimetric method, electrochemical process etc..Although these
Method simplifies the operating procedure of nucleic acid amplification product or has broken away from dependence to non-portable instrument and equipment to a certain extent,
But still have many shortcomings；Such as：Certain methods need operation of uncapping, and easily cause Aerosol Pollution；Also some compare
In color method, detection both front and back color change is very close to being not easy to judge amplification etc..
Therefore, developing a kind of nucleic acid amplification product visible detection method that is simple, directly perceived, not producing Aerosol Pollution should
Become very necessary for Site Detection.
The content of the invention
The invention provides a kind of visible detection method of nucleic acid amplification product, that this method can obtain is accurate, directly perceived,
Qualitatively augmentation detection result, the dependence to non-portable instrument and equipment is broken away from, and operation of uncapping need not be carried out, gas will not be caused
Colloidal sol pollutes, and both realizes Visual retrieval, causes that simple to operate, cost is cheap again, is advantageous to Site Detection and big face
Product is promoted.
Technical scheme provided by the invention is as follows：
(1) before nucleic acid amplification reaction, the fluorescence probe that concentration is 0.01~1 μM is added into amplification system；After amplification,
Obtain amplified production；
(2) amplified production is placed in visual detection device and detected, it is glimmering according to whether detection means shows
Light determines the presence or absence of amplified production；If showing fluorescence, amplified production be present；Conversely, then without；
Or
(A) before nucleic acid amplification reaction, the fluorescent dye that concentration is 0.5~8 μM is added into amplification system；After amplification,
Obtain amplified production；
(B) after the amplified production being heated into 50~80 DEG C, then it is placed in visual detection device and is detected, according to
Whether detection means shows that fluorescence determines the presence or absence of amplified production；If showing fluorescence, amplified production be present；Conversely, then without；
The visual detection device includes the housing of inner hollow, and housing sidewall, which is provided with, to be used to place amplified reaction pipe
Pore and exciting light filter plate and transmitting light filter plate, visible light source is installed above the exciting light filter plate.
The amplified reaction pipe is the test tube for nucleic acid amplification；If there is amplified production, it is positive reaction to define the pipe
Pipe；If without amplified production, it is negative reaction pipe to define the pipe.
Specifically, the method for the nucleic acid amplification is PCR or nucleic acid constant-temperature amplification.
Preferably, the fluorescence probe is hydrolysis probes or molecular beacon.
Hydrolysis probes keep completely, with amplification procedure specific for hydrolysis in positive reaction pipe, making in negative reaction pipe
Obtain fluorophor and quencher separation.
Molecular beacon keeps cyclic structure in negative reaction pipe, with amplification procedure specificity exhibition in positive reaction pipe
Open so that fluorophor and quencher separation.
Preferably, the concentration of the fluorescence probe is 0.03~1 μM；It is further preferred that the concentration of the fluorescence probe is
0.05~0.5 μM；Most preferably, the concentration of the fluorescence probe is 0.1~0.3 μM.Concentration is too low, Visual retrieval fluorescence signal
It is not enough to be visually observed, excessive concentration, can produces dimer between probe, influence the generation of fluorescence signal.
After amplification terminates, visual detection device gives amplified production one certain wave by light source and exciting light filter plate
Long exciting light, positive amplification launch fluorescence, and naked eyes are visible after the transmitting light filter plate filtering of specific wavelength, and negative expansion
Increase and do not show fluorescence.
The wavelength of the exciting light filter plate is 460nm；The wavelength for launching light filter plate is 520nm.
Preferably, the fluorescent dye is double-stranded DNA fluorescent dyestuff.
Specifically, the double-stranded DNA fluorescent dyestuff be SYBR Green I, Ethidium bromide, SYBR Gold or
SYTO。
Visual retrieval is carried out using fluorescent dye, the concentration of dyestuff crosses background signal and suppression that conference improves detection
The progress of nucleic acid amplification reaction.Preferably, the concentration of the fluorescent dye is 0.5~8 μM；It is further preferred that the fluorescent dye
Concentration be 2~6 μM；Most preferably, the concentration of the fluorescent dye is 3~5 μM.
With the progress of amplified reaction, fluorescent dye can be embedded in the double-stranded DNA being continuously generated, after amplification terminates, need to first by
Reaction system is heated to certain temperature and removes background signal, then the exciting light to one specific wavelength of amplified production, positive amplification
Launch fluorescence, naked eyes are visible after the filter plate filtering of specific wavelength, and negative amplification does not show fluorescence.
Under room temperature condition, primer can produce secondary structure in amplification system, and double-stranded DNA fluorescent dyestuff is embedded and produced
Background signal.The melting temperature of primer secondary structure is less than the melting temperature of amplified production, and amplification needs first to heat removal after terminating
Background signal.Preferably, in step (B), the amplified production is heated to 55~75 DEG C；It is further preferred that the amplified production adds
Heat is to 65~75 DEG C.
Preferably, visual detection device includes square casing, LED seat and the transmitting light filter plate of inner hollow
Deck；
The pore for placing amplified reaction pipe is provided with a certain side wall of the housing；In the side wall adjacent with pore,
Provided with exciting light filter plate, LED seat is fixed on the top of the exciting light filter plate；It is solid in another side wall adjacent with pore
Surely there is transmitting light filter plate deck, the transmitting light filter plate deck is provided with the visualization window for being used for observing testing result,
Visualization window is embedded with transmitting light filter plate.
Compared with prior art, the invention has the advantages that：
(1) the inventive method is by the combination of visual detection device and corresponding method of detection, obtain it is accurate, directly perceived,
Qualitatively augmentation detection result, this method has broken away from the dependence to non-portable instrument and equipment, and need not carry out operation of uncapping, will not
Aerosol Pollution is caused, both realizes Visual retrieval, causes that simple to operate, cost is cheap again, is advantageous to Site Detection
Be widely applied.
(2) the inventive method has broken away from the demand to expensive instrument and non-portable instrument, simplifies operating procedure, and tie
Fruit is accurate and visual.
(3) the inventive method is not limited to test in laboratory, it may also be used for Site Detection, the Visual retrieval dress in method
Put portable.
Brief description of the drawings
Fig. 1 is the explosive view of visual detection device of the present invention.
Fig. 2 is profile of the visual detection device of the present invention along LED seat axial direction.
Fig. 3 is profile of the visual detection device of the present invention along transmitting light filter plate deck axial direction.
Fig. 4 is the visual test result of embodiment 1.
Fig. 5 is the visual test result of embodiment 2.
Embodiment
The present invention is further explained with reference to specific embodiment, but specific embodiment the present invention is not made it is any
Limit；The NM operation of following examples is routine techniques.
Embodiment 1
As shown in Figure 1, 2, visual detection device includes square casing 1, LED seat 2 and the transmitting light of inner hollow
Filter plate deck 3；
Wherein, the pore 4 for placing amplified reaction pipe is provided with a certain side wall of housing 1, the diameter of pore 4 is slightly less than expansion
Increase the diameter of reaction tube lid so that amplified reaction pipe is just stuck at pore 4, and body is located at the interior of visual detection device
Portion.
Because amplified reaction pipe is taper, it only need to ensure that pore is slightly less than the diameter of amplified reaction pipe lid, will can all expand
Increase reaction tube to be fixed on square casing, amplified reaction pipe body is completely disposed in housing.
In the side wall adjacent with pore 4, provided with the groove 5 for being embedded in exciting light filter plate, the bottom of groove 5, which is provided with, opens
Mouth 11, exciting light filter plate is embedded at groove 5, and is brought into close contact with the inwall of groove 5.LED seat 2 is cylindric, in cylinder
Portion is provided with the duct 12 for fixing LED, and the end face of cylinder is provided with bulge loop 6, and bulge loop 6 is engaged with groove 5, bulge loop 6
The inwall of outer wall and groove 5 is brought into close contact, and LED seat 2 is fixed on housing 1, makes duct 12 just corresponding with opening 11.
LED is connected by circuit with power supply.
In another side wall adjacent with pore 4, provided with transmitting light filter plate deck 3 be engaged groove 7, the bottom of groove 7
Provided with the opening 8 for observing testing result.It is disk post to launch light filter plate deck 3, and the end face of cylinder is provided with bulge loop 9,
Bulge loop 9 is engaged with groove 7, and the inwall of the outer wall and groove 7 of bulge loop 9 is brought into close contact, and transmitting light filter plate deck 3 is fixed on
On housing 1.Transmitting light filter plate deck 3 is provided with visualization window 10, launches light filter plate for embedded, launches light filter plate
It is brought into close contact with the inwall of visualization window 10；Visualization window 10 is corresponding with opening 8, for observing testing result.This can
It can be obtained depending on changing detection means by way of 3D printing.
When carrying out Visual retrieval, the PCR reaction tubes after amplified reaction is terminated are placed in pore, connect LED electricity
Source, testing result can be observed by visualization window.
TaqMan probe+the PCR of embodiment 2 detection Citrus Huanglongbing pathogen bacterium Candidatus Liberibacter
Asiaticus (Las) amplified production
A kind of visible detection method of nucleic acid amplification product, it is specific as follows：
(1) before pcr amplification reaction, fluorescence probe TaqMan is added into amplification system；After amplification, amplification production is obtained
Thing；
(2) amplified production is placed in the visual detection device of embodiment 1 and detected, be according to detection means
No display fluorescence determines the presence or absence of amplified production；If showing fluorescence, amplified production be present, for the positive；Conversely, then without for the moon
Property.
Huanglong germ Las in citrus sample is detected using above-mentioned visible detection method, particular content is as follows：
TaqMan PCR amplification systems：PCR reactions are carried out in 25 μ L volumes, and Taq HS polymerases are contained in the volume
0.5U, Tris-HCl 10mM, KCl 50mM, MgCl2, each 0.2mM of 1.5mM, dNTP, 0.15 μM of TaqMan probe, primer concentration
It is respectively 0.4 μM, the μ L of template DNA 2.
TaqMan PCR amplification programs：95 DEG C of thermal starting 10min, 45 circulations, each circulation include 95 DEG C of reaction 10s,
60 DEG C of reaction 30s.
The primer sequence that PCR amplifications use, it is as follows：
F：5’-CGTATTGCATACGCGCTCGAC-3’；
R：5’-CTACCTTTTTCTACGGGATAACGC-3’.
The probe sequence used：5'-AGACGGGTGAGTAACGCG-3'.
The template sequence of amplification：5’-GTCGAGCGCGTATGCAATACGAGCGGCAGACGGGTGAGTAACGCGTAGGAA
TCTACCTTTTTCTACGGGATAACGCA-3’(GenBank:L22532)。
As a result show：As shown in figure 3, positive findings is presented in Las infection samples, negative findings is presented in non-Las infection sample.
Fluorescent dye+the LAMP of 3 SYTO of embodiment 9 detection Citrus Huanglongbing pathogen bacterium Las
A kind of visible detection method of nucleic acid amplification product, it is specific as follows：
(A) before LAMP nucleic acid amplification reactions, fluorescent dye SYTO 9 is added into amplification system；After amplification, expanded
Increase production thing；
(B) after the amplified production being separately heated into 45,65,75,85 DEG C, then it is placed in the Visual retrieval of embodiment 1
Detected in device, whether show that fluorescence determines the presence or absence of amplified production according to detection means；If showing fluorescence, exist and expand
Increase production thing, for the positive；Conversely, then without for feminine gender.
Huanglong germ Las in citrus sample is detected using above-mentioned visible detection method, particular content is as follows：
LAMP amplification systems：LAMP reactions are carried out in 25 μ L volumes, and Bst archaeal dna polymerase 8U are contained in the volume,
5 μM of 9 fluorescent dye of Tris-HCl 10mM, KCl 50mM, MgSO4 each 0.35mM of 6mM, dNTP, glycine betaine 0.8M, SYTO, outside
Primer concentration is respectively 2.5 μM, and inner primer concentration is respectively respectively 0.5 μM for 0.5 μM of ring primer concentration, the μ L of template DNA 2.
LAMP amplification programs：65 DEG C of reaction 35min, after reaction terminates, different temperatures warm bath 2min, are visualized immediately
Detection.
The primer sequence used：
F3:5’-CCCCGAAATCGGACACTTC-3’；
B3:5’-GTCCCATGCATACGCACAT-3’；
FIP:5’-ACCTCCGCTGAGGCAAAGTTT-TAAGGATTACGGCGAAGAGC-3’；
BIP:5’-TCGACATTGAAACCCGCAGTCC-CTCCGCATAAGCCCAAACC-3’；
LF:5’-GACTCCGATACCTCGGTC-3’；
LB:5’-CTACCTTAGGCAAGGGTTG-3’；
The template sequence of amplification：5’-TGCTTCCCCGAAATCGGACACTTCGGAGTTTAAGGATTACGGCGAAGAGCA
AGACTCCGATACCTCGGTCTCAAACTTTGCCTCAGCGGAGGTGGACTCCGACGCTCTGCCGTGGAACTGATCAATGT
CAAAGCTGTTTATCGACATTGAAACCCGCAGTCCTCAACCCTTGCCTAAGGTAGGGGTTTGGGCTTATGCGGAGCAG
GCGGTTATCACTTTATGTGCGTATGCATGGGACGATGAACCTGTGAA-3’(GenBank:NO.CP001677.5)。
As a result show：As shown in figure 4, after LAMP amplifications, amplified production is carried out using the fluorescent dye determinations of SYTO 9 visual
Change detection, when amplification system temperature is 65 DEG C and 75 DEG C, positive sample and negative sample there can be obvious differentiation.Work as amplification system
When temperature is too high or too low, positive sample and negative sample cannot be distinguished by.
Molecular beacon+the PCR of embodiment 4 detection Citrus Huanglongbing pathogen bacterium Las
A kind of visible detection method of nucleic acid amplification product, it is specific as follows：
(1) before pcr amplification reaction, molecular beacon probe is added into amplification system；After amplification, amplified production is obtained；
(2) amplified production is placed in the visual detection device of embodiment 1 and detected, be according to detection means
No display fluorescence determines the presence or absence of amplified production；If showing fluorescence, amplified production be present, for the positive；Conversely, then without for the moon
Property.
Huanglong germ Las in citrus sample is detected using above-mentioned visible detection method, particular content is as follows：
PCR amplification system：PCR reactions are carried out in 25 μ L volumes, and Taq HS polymerase 0.5U are contained in the volume,
Tris-HCl 10mM, KCl 50mM, MgCl2Each 0.2mM of 1.5mM, dNTP, 0.1 μM of molecular beacon probe, primer concentration are respectively
0.4 μM, the μ L of template DNA 2.
PCR amplification programs：98 DEG C of thermal starting 2min, 40 circulations, each circulation include 98 DEG C of reaction 10s, 55 DEG C of reactions
30s, 72 DEG C of reaction 60s.
The primer sequence used：
F:5’-ATACCTCGGTCTCAAACT-3’；
R:5’-GTCCTATCCCACAACTTC-3’；
The molecular beacon sequences used：5’-GCGTCGAAACCCGCAGTCCTCAACCCGACGC-3’；
The template sequence of amplification：5’-CGTTCAGTTCTTCAAGCATGATGAGCGTTGGGGTGCTTCCCCGAAATCGGA
CACTTCGGAGTTTAAGGATTACGGCGAAGAGCAAGACTCCGATACCTCGGTCTCAAACTTTGCCTCAGCGGAGGTGG
ACTCCGACGCTCTGCCGTGGAACTGATCAATGTCAAAGCTGTTTATCGACATTGAAACCCGCAGTCCTCAACCCTTG
CCTAAGGTAGGGGTTTGGGCTTATGCGGAGCAGGCGGTTATCACTTTATGTGCGTATGCATGGGACGATGAACCTGT
GAAGTTGTGGGATAGGACTGAACAATCTGCTATGCCATCGGATCTTCTGCAGTACTTAAGAGATGAAACGGTGATGT
GTGTTGCAC-3’(GenBank:L22532)。
As a result show：Positive findings is presented in Las infection samples, and negative findings is presented in non-Las infection sample.
Vibrio parahaemolytious in the fluorescent dye+PCR of 5 SYTO of embodiment 9 detection detection shrimp samples
A kind of visible detection method of nucleic acid amplification product, it is specific as follows：
(A) before PCR nucleic acid amplification reactions, fluorescent dye SYTO 9 is added into amplification system；After amplification, expanded
Product；
(B) by after described 75 DEG C of warm bath 2min of amplified production, then it is placed in the visual detection device of embodiment 1 and is examined
Survey, whether show that fluorescence determines the presence or absence of amplified production according to detection means；If showing fluorescence, amplified production be present, for sun
Property；Conversely, then without for feminine gender.
Vibrio parahaemolytious in shrimp sample is detected using above-mentioned visible detection method, particular content is as follows：
PCR amplification system：PCR reactions are carried out in 25 μ L volumes, and Taq HS polymerase 0.5U are contained in the volume,
4 μM of 9 fluorescent dye of Tris-HCl 10mM, KCl 50mM, MgCl2 1.5mM, dNTP each 0.2mM, SYTO, primer concentration are respectively
0.4 μM, the μ L of template DNA 2.
PCR amplification programs：98 DEG C of thermal starting 2min, 40 circulations, each circulation include 98 DEG C of reaction 10s, 58 DEG C of reactions
30s, 72 DEG C of reaction 60s.75 DEG C of warm bath 2min after reaction terminates, carry out Visual retrieval immediately.
The primer sequence used：
F1：5'-CATTACGTTCTTCGCCGCTG-3'；
R1：5'-CACCGAGTGCAACCACTTTG-3'；
Corresponding amplification template sequence (107bp)：
5’-CATTACGTTCTTCGCCGCTGACAATCGCTTCTCATACAACCACACGATCTGGAGCAACGACGCAGC
AATGCAGCCAGATCAAATCAACAAAGTGGTTGCACTCGGTG-3'(GenBank:M36437)。
As a result show：Detection for vibrio parahaemolytious in shrimp sample, positive sample and negative sample can have obvious differentiation.
Molecular beacon+the PCR of embodiment 6 detects GTS 40-3-2 genetically engineered soybeans
A kind of visible detection method of nucleic acid amplification product, it is specific as follows：
(1) before pcr amplification reaction, molecular beacon probe is added into amplification system；After amplification, amplified production is obtained；
(2) amplified production is placed in the visual detection device of embodiment 1 and detected, be according to detection means
No display fluorescence determines the presence or absence of amplified production；If showing fluorescence, amplified production be present, for the positive；Conversely, then without for the moon
Property.
GTS 40-3-2 genes in soybean sample are detected using above-mentioned visible detection method, particular content is as follows：
PCR amplification system：PCR reactions are carried out in 25 μ L volumes, and Taq HS polymerase 0.5U are contained in the volume,
Tris-HCl 10mM, KCl 50mM, MgCl2 each 0.2mM of 1.5mM, dNTP, 0.2 μM of molecular beacon probe, primer concentration are respectively
0.4 μM, the μ L of template DNA 2.
PCR amplification programs：98 DEG C of thermal starting 2min, 40 circulations, each circulation include 98 DEG C of reaction 10s, 56 DEG C of reactions
30s, 72 DEG C of reaction 60s.
Primer sequence：
F:5’-ATCCCACTATCCTTCG-3’；
R：5’-TGTCAGCGTGTCCT-3’；
Molecular beacon sequences：5’-ATAAGGAAGTTCATTTCATTTGGAGAG-3’
The template sequence of amplification：
5’-AGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGC
AAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGACAAGCTGACTCTAGCAGATCTTTC
AAGAATGGCACAAATTAACAACATGGCACAAGGGATACAAA-3'(GenBank:AB209952.1)。
As a result show：Positive findings is presented in GTS 40-3-2 genetically engineered soybeans sample, and Non-transgenic soybean sample presents cloudy
Property result.
The SYBR Green I fluorescent dyes+PCR of embodiment 7 detects GTS 40-3-2 genetically engineered soybeans
A kind of visible detection method of nucleic acid amplification product, it is specific as follows：
(A) before PCR nucleic acid amplification reactions, fluorescent dye SYBR Green I are added into amplification system；After amplification, obtain
Obtain amplified production；
(B) by after described 70 DEG C of warm bath 2min of amplified production, then it is placed in the visual detection device of embodiment 1 and is examined
Survey, whether show that fluorescence determines the presence or absence of amplified production according to detection means；If showing fluorescence, amplified production be present, for sun
Property；Conversely, then without for feminine gender.
GTS 40-3-2 genes in soybean sample are detected using above-mentioned visible detection method, particular content is as follows：
PCR amplification system：PCR reactions are carried out in 25 μ L volumes, and Taq HS polymerase 0.5U are contained in the volume,
3 μM of Tris-HCl 10mM, KCl 50mM, MgCl2 1.5mM, dNTP each 0.2mM, SYBR Green I fluorescent dyes, primer is dense
Degree is respectively 0.4 μM, the μ L of template DNA 2.
PCR amplification programs：98 DEG C of thermal starting 2min, 40 circulations, each circulation include 98 DEG C of reaction 10s, 58 DEG C of reactions
30s, 72 DEG C of reaction 60s.70 DEG C of warm bath 2min after reaction terminates, carry out Visual retrieval immediately.
Primer sequence：
F：5’-'AACAACATGGCACAAGGGATACAAACC-3’；
R：5’-CCACTGATGCTGAAATCCTAAAGGAAC-3’；
The template sequence of amplification：
5’-AACATGGCACAAGGGATACAAACCCTTAATCCCAATTCCAATTTCCATAAACCCCAAGTTCCTAAA
TCTTCAAGTTTTCTTGTTTTTGGATCTAAAAAACTGAAAAATTCAGCAAATTCTATGTTGGTTTTGAAAAAAGATTC
AATTTTTATGCAAAAGTTTTGTTCCTTTAGGATTTCAGCATCAG-3'(GenBank:AB209952.1)。
As a result show：Positive findings is presented in GTS 40-3-2 genetically engineered soybeans sample, and Non-transgenic soybean sample presents cloudy
Property result.
Fluorescent dye+the RPA of 7 SYTO of embodiment 9 detect GTS 40-3-2 genetically engineered soybeans
A kind of visible detection method of nucleic acid amplification product, it is specific as follows：
(A) before RPA nucleic acid amplification reactions, fluorescent dye SYTO 9 is added into amplification system；After amplification, expanded
Product；
(B) by after described 65 DEG C of warm bath 2min of amplified production, then it is placed in the visual detection device of embodiment 1 and is examined
Survey, whether show that fluorescence determines the presence or absence of amplified production according to detection means；If showing fluorescence, amplified production be present, for sun
Property；Conversely, then without for feminine gender.
GTS 40-3-2 genes in soybean sample are detected using above-mentioned visible detection method, particular content is as follows：
CPA amplification programs：37 DEG C of reaction 30min, 65 DEG C of warm bath 2min after reaction terminates, carry out Visual retrieval immediately.
The primer sequence that RPA is used：
FI：5’-ATTAACAACATGGCACAAGGGATACAAACC-3'；
RI：5’-CCACTGATGCTGAAATCCTAAAGGAACAAAAC-3'；
FII：5’-TCCCAATTCCAATTTCCATAAACCCCAAGT-3'；
RII：5’-AGGCTGTAGCCACTGATGCTGAAATCCTA-3'；
FIII：5’-AACAACATGGCACAAGGGATACAAACC-3”；
RIII：5’-CCACTGATGCTGAAATCCTAAAGGAAC-3'.
As a result show：Positive findings is presented in GTS 40-3-2 genetically engineered soybeans sample, and Non-transgenic soybean sample presents cloudy
Property result.
The sample of pork is adulterated in the TaqMan probe+PCR of embodiment 8 detection beef
The present embodiment, except detection object is that the sample of pork is adulterated in beef, in TaqMan PCR amplification systems, probe
Working concentration is 0.2 μM outer；Remaining step is identical with embodiment 2.
As a result show：Pattern detection result for the pork containing doping in beef is the positive, for pure beef pattern detection
As a result it is feminine gender.
The sample of pork is adulterated in the fluorescent dye+LAMP of 9 SYTO of embodiment 9 detection beef
The present embodiment, in addition to detection object is to adulterate the sample of pork in beef, remaining step and 3 complete phase of embodiment
Together.
As a result show：Pattern detection result for the pork containing doping in beef is the positive, for pure beef pattern detection
As a result it is feminine gender.
The sample of pork is adulterated in the molecular beacon+PCR of embodiment 10 detection beef
The present embodiment, except detection object is that the sample of pork is adulterated in beef, in PCR amplification system, the work of molecular beacon
It is outer for 0.15 μM to make concentration, remaining step is identical with embodiment 3.
As a result show：Pattern detection result for the pork containing doping in beef is the positive, for pure beef pattern detection
As a result it is feminine gender.
Claims (9)
- A kind of 1. visible detection method of nucleic acid amplification product, it is characterised in that including：(1) before nucleic acid amplification reaction, the fluorescence probe that concentration is 0.01~1 μM is added into amplification system；After amplification, obtain Amplified production；(2) amplified production is placed in visual detection device and detected, whether show that fluorescence is true according to detection means Determine the presence or absence of amplified production；If showing fluorescence, amplified production be present；Conversely, then without；Or(A) before nucleic acid amplification reaction, the fluorescent dye that concentration is 0.5~8 μM is added into amplification system；After amplification, obtain Amplified production；(B) after the amplified production being heated into 50~80 DEG C, then it is placed in visual detection device and is detected, according to detection Whether device shows that fluorescence determines the presence or absence of amplified production；If showing fluorescence, amplified production be present；Conversely, then without；The visual detection device includes the housing of inner hollow, and housing sidewall is provided with the pipe for being used for placing amplified reaction pipe Hole and exciting light filter plate and transmitting light filter plate, visible light source is installed above the exciting light filter plate.
- 2. visible detection method as claimed in claim 1, it is characterised in that the method for the nucleic acid amplification is PCR or core Sour constant-temperature amplification.
- 3. visible detection method as claimed in claim 1, it is characterised in that the fluorescence probe is hydrolysis probes or molecule Beacon.
- 4. visible detection method as claimed in claim 1, it is characterised in that the concentration of the fluorescence probe is 0.1~0.3 μM。
- 5. visible detection method as claimed in claim 1, it is characterised in that the fluorescent dye is that double-stranded DNA fluorescent is embedding Enter fluorescent dye.
- 6. visible detection method as claimed in claim 5, it is characterised in that the double-stranded DNA fluorescent is embedded in fluorescent dye For SYBR Green I, Ethidium bromide, SYBR Gold or SYTO.
- 7. visible detection method as claimed in claim 1, it is characterised in that the concentration of the fluorescent dye is 3~5 μM.
- 8. visible detection method as claimed in claim 1, it is characterised in that in step (B), the amplified production is heated to 65~75 DEG C.
- 9. visible detection method as claimed in claim 1, it is characterised in that visual detection device includes inner hollow Square casing, LED seat and transmitting light filter plate deck；The pore for placing amplified reaction pipe is provided with a certain side wall of the housing；In the side wall adjacent with pore, it is provided with Exciting light filter plate, LED seat are fixed on the top of the exciting light filter plate；It is fixed with another side wall adjacent with pore Launch light filter plate deck, the transmitting light filter plate deck is provided with the visualization window for being used for observing testing result, visually Change window and be embedded with transmitting light filter plate.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710730077.8A CN107557433A (en) | 2017-08-23 | 2017-08-23 | A kind of visible detection method of nucleic acid amplification product |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710730077.8A CN107557433A (en) | 2017-08-23 | 2017-08-23 | A kind of visible detection method of nucleic acid amplification product |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107557433A true CN107557433A (en) | 2018-01-09 |
Family
ID=60976422
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710730077.8A Pending CN107557433A (en) | 2017-08-23 | 2017-08-23 | A kind of visible detection method of nucleic acid amplification product |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107557433A (en) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109536368A (en) * | 2018-12-29 | 2019-03-29 | 北京化工大学 | A kind of portable convection current PCR amplification detection device |
| CN109609608A (en) * | 2019-01-17 | 2019-04-12 | 浙江大学 | The linear quick dual temperature PCR amplification automatic control device of one kind and control method |
| CN109797091A (en) * | 2019-01-17 | 2019-05-24 | 浙江大学 | A kind of rotary quickly dual temperature PCR amplification automatic control device and control method |
| CN109810891A (en) * | 2019-01-17 | 2019-05-28 | 浙江大学 | A kind of quick dual temperature PCR amplification automatic control device of rocker-type and control method |
| CN110272822A (en) * | 2019-06-06 | 2019-09-24 | 上海交通大学 | A kind of gene magnification real time fluorescent quantitative detection device and detection method |
| CN111269970A (en) * | 2018-12-05 | 2020-06-12 | 浙江大学 | Simple and rapid DNA field visual detection device and method |
| CN111334594A (en) * | 2020-04-03 | 2020-06-26 | 青岛科技大学 | Visual detection platform of nucleic acid amplification paper base |
| CN112143780A (en) * | 2020-09-01 | 2020-12-29 | 浙江大学 | Method for confirming sample in gray zone after nucleic acid amplification |
| CN114045356A (en) * | 2022-01-12 | 2022-02-15 | 仲恺农业工程学院 | Kit and method for visually detecting citrus greening disease based on RPA-CRISPR-Cas12a system |
| CN114703048A (en) * | 2022-06-08 | 2022-07-05 | 珠海市尚维高科生物技术有限公司 | Miniaturized nucleic acid amplification detection device |
| CN117568500A (en) * | 2024-01-16 | 2024-02-20 | 南京农业大学三亚研究院 | Dual PCR detection kit for pathogenic bacteria in aquatic products |
-
2017
- 2017-08-23 CN CN201710730077.8A patent/CN107557433A/en active Pending
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111269970A (en) * | 2018-12-05 | 2020-06-12 | 浙江大学 | Simple and rapid DNA field visual detection device and method |
| CN109536368A (en) * | 2018-12-29 | 2019-03-29 | 北京化工大学 | A kind of portable convection current PCR amplification detection device |
| CN109609608B (en) * | 2019-01-17 | 2021-01-01 | 浙江大学 | Linear rapid double-temperature PCR amplification automatic control device and control method |
| CN109609608A (en) * | 2019-01-17 | 2019-04-12 | 浙江大学 | The linear quick dual temperature PCR amplification automatic control device of one kind and control method |
| CN109797091A (en) * | 2019-01-17 | 2019-05-24 | 浙江大学 | A kind of rotary quickly dual temperature PCR amplification automatic control device and control method |
| CN109810891A (en) * | 2019-01-17 | 2019-05-28 | 浙江大学 | A kind of quick dual temperature PCR amplification automatic control device of rocker-type and control method |
| CN110272822A (en) * | 2019-06-06 | 2019-09-24 | 上海交通大学 | A kind of gene magnification real time fluorescent quantitative detection device and detection method |
| CN111334594A (en) * | 2020-04-03 | 2020-06-26 | 青岛科技大学 | Visual detection platform of nucleic acid amplification paper base |
| CN111334594B (en) * | 2020-04-03 | 2021-06-22 | 青岛科技大学 | Non-diagnosis-purpose nucleic acid amplification paper-based visual detection method |
| CN112143780A (en) * | 2020-09-01 | 2020-12-29 | 浙江大学 | Method for confirming sample in gray zone after nucleic acid amplification |
| CN112143780B (en) * | 2020-09-01 | 2022-04-08 | 浙江大学 | Method for confirming sample in gray zone after nucleic acid amplification |
| CN114045356A (en) * | 2022-01-12 | 2022-02-15 | 仲恺农业工程学院 | Kit and method for visually detecting citrus greening disease based on RPA-CRISPR-Cas12a system |
| CN114703048A (en) * | 2022-06-08 | 2022-07-05 | 珠海市尚维高科生物技术有限公司 | Miniaturized nucleic acid amplification detection device |
| CN117568500A (en) * | 2024-01-16 | 2024-02-20 | 南京农业大学三亚研究院 | Dual PCR detection kit for pathogenic bacteria in aquatic products |
| CN117568500B (en) * | 2024-01-16 | 2024-04-19 | 南京农业大学三亚研究院 | Dual PCR detection kit for pathogenic bacteria in aquatic products |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107557433A (en) | A kind of visible detection method of nucleic acid amplification product | |
| CN105821138B (en) | A kind of method that double loop-stem structure DNA profiling detection nucleic acid are built based on coupled reaction | |
| CN106367492A (en) | Method for rapidly detecting listeria monocytogenes at constant temperature, primer and applications of primer | |
| CN103320434A (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| CN106434917A (en) | LAMP primer group and detection kit for staphylococcus aureus and use method of detection kit | |
| CN109706227A (en) | A kind of quick visualization and the nucleic acid on-site inspection method that Aerosol Pollution can be prevented | |
| CN115029459A (en) | Kit for visually detecting Pasteurella multocida based on CRISPR-Cas12a and application | |
| CN103045469A (en) | Quantitative detector for multi-channel loop-mediated nucleic acid isothermal amplification (LAMP) | |
| CN102747165A (en) | Reagent kit and method for quickly detecting tilapia streptococcus agalactiae by using loop-mediated isothermal amplification technology | |
| CN106119099B (en) | A kind of totally-enclosed more targeting nucleic acid isothermal amplifications detection integrated apparatus | |
| CN108588277A (en) | A kind of canine distemper virus visualization nucleic acid detection method | |
| CN108034757A (en) | A kind of RPA primers and detection method for detecting transgenic corns Bt11 strains | |
| CN112359137A (en) | RT-LAMP amplification system for visual virus nucleic acid RNA detection and application | |
| CN108796091A (en) | Loop-mediated isothermal amplification is applied to the genotyping detection method and detection kit of more room/Echinococcus Granulosus Cysts | |
| CN104975098A (en) | Method for rapid fluorescence detection of polynucleotide target objects simultaneously at room temperature and constant temperature | |
| CN104726594B (en) | The heavy fluorescence PCR detection reagent kit of food-borne pathogens five | |
| CN115703991A (en) | Micro amplification instrument | |
| CN106282375A (en) | The LAMP primer group of a kind of Salmonella typhimurium and test kit and using method | |
| CN101225440B (en) | Detection method of leptospira | |
| CN111004719A (en) | Nucleic acid detection module, detection unit and detection system | |
| CN110499394A (en) | Detect LAMP primer group, kit and the detection method of African swine fever virus | |
| CN209128442U (en) | A kind of gene assaying device | |
| CN207713748U (en) | A kind of visualization of presence nucleic acid isothermal amplification device | |
| CN114107015B (en) | Nucleic acid POCT detection device | |
| CN106434916A (en) | LAMP primer group and kit for enterobacter sakazakii, and use method of kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180109 |
|
| RJ01 | Rejection of invention patent application after publication |