CN104726594B - The heavy fluorescence PCR detection reagent kit of food-borne pathogens five - Google Patents
The heavy fluorescence PCR detection reagent kit of food-borne pathogens five Download PDFInfo
- Publication number
- CN104726594B CN104726594B CN201510139899.XA CN201510139899A CN104726594B CN 104726594 B CN104726594 B CN 104726594B CN 201510139899 A CN201510139899 A CN 201510139899A CN 104726594 B CN104726594 B CN 104726594B
- Authority
- CN
- China
- Prior art keywords
- genes
- food
- sense primers
- pcr
- borne pathogens
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of heavy fluorescence PCR detection reagent kit of food-borne pathogens five, mainly include five pairs of specific primers, EvaGreen PCR premixed liquids, ultra-pure water and positive controls, specific primer includes the specific primer of the ipaH genes of nuc genes, the hlyA genes of Listeria monocytogenes, the invA genes of salmonella, the tlh genes of vibrio parahemolyticus and the Shigella of staphylococcus aureus.Kit detection cycle of the present invention is short, testing cost is low, testing result reliability.
Description
Technical field
The invention belongs to biological technical field, it is related to the weight fluorescence PCR detection reagent kit of food-borne pathogens five and detection side
Method.
Technical background
Bread is the staff of life, eats with An Weixian.Food security is closely bound up with the life of people, and food security is not ensured,
Health and the existence of the mankind can be not only influenceed, but also the development of society and economy can be had a strong impact on.World health is big within 2000
Can pass through《Food security is resolved》, global food security strategy has been formulated, food security is classified as sanitarian preferential neck
Domain.But food safety affair happens occasionally, particularly in recent years, the food poisoning caused by food-borne pathogens is alive
The incidence of most countries significantly rises in the range of boundary, it has also become an important public health problem.Cause food-borne disease
The pathogenic bacteria such as staphylococcus aureus, Listeria monocytogenes, salmonella, vibrio parahemolyticus and the Shigella of disease, hold very much
Easily by directly or indirectly being polluted to food, poisoning is caused to take place frequently.Such as the Salmonella typhimurtum in January, 2009 U.S.
Peanut butter contamination accident, involves 43 states, causes 3 people dead.Quickly and accurately detect and identify that food-borne pathogens are effectively
The precondition that control breaks out with prevention food origin disease.But relevant food-borne pathogens Fast Detection Technique platform is in China
Also weaker, the construction for strengthening food-borne pathogens Fast Detection Technique platform has important economy and social effect.
" goldstandard " or traditional isolated culture method of current food-borne pathogens detection, but its detection cycle it is long,
Detection program is cumbersome, it is impossible to reach the purpose of quick detection.Real-time fluorescence PCR technology is to be released by American AB I companies for 1996
A kind of new detection technique, because real-time fluorescence PCR technology has the advantages that high specificity, sensitivity are high, easy to be quick,
Food-borne pathogens context of detection has achieved great successes.But it is currently employed for the real-time glimmering of food-borne pathogens detection
Light PCR detection kit major part is developed based on Taqman probe techniques, and not only testing cost is high, and carries out multiple inspection
Number of channels during survey to real-time fluorescence PCR instrument has certain requirement.Melting curve（resolution melting）Technology is
Different from another real-time PCR detection technology of probe technique, fluorescent dye is added on the basis of Standard PCR, when glimmering
When photoinitiator dye is with DNA double chain combination, fluorescence is sent；When being discharged from DNA double chain, fluorescence signal drastically weakens, if risen
High-temperature is denatured DNA, and fluorescence signal is mapped by abscissa of temperature, can obtain melting curve.50%DNA molecules are occurred
The temperature of denaturation is referred to as melting point temperature (melting temperature, Tm).If amplified production length is different, its GC ratio
Difference, carries out just having its unique melting curve during dissolving analysis, and melting curve property, position and Tm values are all different
's.If various pathogenic bacteria amplified production length is different, its GC ratio different, the molten of its uniqueness is just had when carrying out liquation
Solution curve.Because the fluorescent dye SYBR Green I of early application are unsaturated dyestuff, stability is poor and there is dyestuff
Redistribution problem, so as to limit the application of melting curve technology.With saturated fluorescence dyestuff LC Green and Eva Green's
Invention, solves the problems, such as unsaturated dye stability difference and there is dyestuff redistribution, based on many of melting curve technology
Weight fluorescent PCR shows big advantage in inspection field.
The content of the invention
It is an object of the invention to provide a kind of weight real-time fluorescence PCR inspection of food-borne pathogens five based on melting curve technology
Test agent box, by primary first-order equation it is quick, it is cheap and reliable completion staphylococcus aureus, Listeria monocytogenes, Salmonella
Five kinds of detections of food-borne pathogens such as bacterium, vibrio parahemolyticus and Shigella.
The present invention is based on melting curve technology, with the nuc genes of staphylococcus aureus, the hlyA bases of Listeria monocytogenes
The ipaH genes of cause, the invA genes of salmonella, the tlh genes of vibrio parahemolyticus and Shigella are target gene.
The weight real-time fluorescence PCR assay kit of food-borne pathogens five includes five couples of specific primers, EvaGreen PCR
Premixed liquid, ultra-pure water and positive control, wherein EvaGreen PCR premixed liquids include that PCR buffer solutions, dNTP mixtures, DNA gather
Synthase and saturated fluorescence dyestuff EvaGreen, positive control are staphylococcus aureus, Listeria monocytogenes, salmonella, pair
Hemolytic vibrios and Shigella reference culture DNA extract solutions.Ultra-pure water can be simultaneously as negative control.
The sequence of five pairs of specific primers is as follows：
Nuc sense primers：5’-AACAAGATCGCTATGGTAGAACATTGGC-3’
Nuc anti-sense primers：5’-CTTCTCTCTAGCAAGTCCCTTTTCCACTA-3’
HlyA sense primers：5’-AAAAGCAAGTTAGCTCATTTCACATCGT-3’
HlyA anti-sense primers：5’-TTACCGTTCTCCACCATTCCCAAG-3’
InvA sense primers：5’-CAATCAGTCCTAACGACGACCCTTC-3’
InvA anti-sense primers：5’-GCCGCCAAACCTAAAACCAGC-3’
Tlh sense primers：5’-CGAACGAGAACGCAGACATTACG-3’
Tlh anti-sense primers：5’-CGGGTTAGGGAAGCGCCATT-3’
IpaH sense primers：5’-GGTAAATCTGCTGTTCAGTCTCACGC-3’
IpaH anti-sense primers：5’-TTTACGGACTGGTTCTCCCTCTGG-3’ .
The design that it is critical only that amplimer of the invention, dye class real-time fluorescence PCR can be used for Multiple detection because
If different amplified production length is different, its GC ratio is different, just had when solubility curve is analyzed the dissolving of its uniqueness
Curve, and solubility curve property, position and Tm values are all different.Therefore not only to be analyzed using blast during design of primers
Ensure the specificity of primer, it is also contemplated that the length of amplified production and GC ratios, it is ensured that carry out different when solubility curve is analyzed
The solubility curve that can be produced with different Tm values of target gene.Other reagents, such as EvaGreen needed for the present invention in addition to primer
PCR premixed liquids, including PCR buffer solutions, dNTP mixtures, archaeal dna polymerase and saturated fluorescence dyestuff EvaGreen, EvaGreen
The EvaGreen PCR premixed liquids of the commercially available commercialization of PCR premixed liquids, also can voluntarily prepare, commodity in use in the present invention
Bio-Rad SsoFast EvaGreen premixed liquids；Positive control is staphylococcus aureus, Listeria monocytogenes, Salmonella
Bacterium, vibrio parahemolyticus and Shigella reference culture DNA extract solutions；Ultra-pure water can be simultaneously as negative control.
The invention further relates to five kinds of heavy real-time fluorescence PCR detection methods of food-borne pathogens five, comprise the following steps：
(1) testing sample DNA is extracted；
(2) specific primer and EvaGreen PCR premixed liquids are taken, negative control, positive control is separately added into or is treated test sample
Product DNA forms amplification reaction system；
The preferred amplification system of the step (2) is shown in Table 1.
(3) being placed in amplification reaction system carries out real-time fluorescence PCR reaction on real-time fluorescence PCR instrument, reaction condition is：95
DEG C predegeneration 2min, 95 DEG C of 5s, 62.3 DEG C of 30s carry out 30 circulations, fluorescence are gathered in annealing stage, finally carry out melting curve
Monitoring, that is, after completing above-mentioned last circulation, temperature rises to 73 DEG C, is gradually risen with the heating rate of 0.1 DEG C/s after insulation 5s
To 88 DEG C, the continuous detection of fluorescence intensity is carried out in this temperature-rise period.And whether contain according in melting curve judgement sample
This five kinds of pathogenic bacteria, the nuc genes of staphylococcus aureus, the hlyA genes of Listeria monocytogenes, the invA bases of salmonella
The Tm values of the ipaH gene amplification products of cause, the tlh genes of vibrio parahemolyticus and Shigella are respectively 75.5 ± 0.3
DEG C, 78.5 ± 0.2 DEG C, 80.8 ± 0.5 DEG C, 84 ± 0.1 DEG C and 86.5 ± 0.2 DEG C.
Advantage of the invention is mainly reflected in：(1) it is quick, sensitive and high degree of automation excellent with real-time fluorescence PCR
Point；(2) detection probe of costliness need not be synthesized, testing cost is low；(3) the weight real-time fluorescence PCR of sonde method five needs 5 differences
Fluorescence channel could complete 5 detections of target gene, therefore be not suitable for part and there was only two real-time fluorescences of fluorescence channel
PCR instrument, such as Bio-Rad MyiQ 2, the present invention complete 5 inspections of target gene by only needing FAM/SYBR passages the most conventional
Survey, be suitable for almost the commercially available real-time fluorescence PCR instrument of institute.
Brief description of the drawings
Fig. 1 is the melting curve analysis figure of staphylococcus aureus reference culture.
Fig. 2 is the melting curve analysis figure of Listeria monocytogenes reference culture.
Fig. 3 is the melting curve analysis figure of salmonella reference culture.
Fig. 4 is the melting curve analysis figure of vibrio parahemolyticus reference culture.
Fig. 5 is the melting curve analysis figure of Shigella reference culture.
Fig. 6 is the corresponding standard curve of staphylococcus aureus reference culture various concentrations DNA profiling.
Fig. 7 is the corresponding standard curve of Listeria monocytogenes reference culture various concentrations DNA profiling.
Fig. 8 is the corresponding standard curve of salmonella reference culture various concentrations DNA profiling.
Fig. 9 is the corresponding standard curve of vibrio parahemolyticus reference culture various concentrations DNA profiling.
Figure 10 is the corresponding standard curve of Shigella reference culture various concentrations DNA profiling.
Specific embodiment
The present invention is further described in conjunction with the accompanying drawings and embodiments.
Embodiment 1：Five kinds of foundation of food-borne pathogens real-time fluorescence PCR detection method
Extract staphylococcus aureus, Listeria monocytogenes, salmonella, vibrio parahemolyticus and Shigella standard bacteria
Strain DNA is template, carries out amplified reaction on real-time fluorescence PCR instrument with five pairs of specific primers, and 20 μ L amplification reaction systems are：
1 μ L, Bio-Rad SsoFast EvaGreen premixed liquids of template DNA 10 μ L, 10 μm of each 1.4 μ L of ol/L nuc upstream and downstream primers,
10 μm of ol/L hlyA upstream and downstream primers each 1.2 μ L, 10 μm of ol/L invA upstream and downstream primers each 1 μ L, 10 μm of ol/L tlh are upper and lower
Trip each 0.8 μ L of primer, 10 μm of each 0.8 μ L of ol/L ipaH upstream and downstream primers, ultra-pure water complements to 20 μ L.Amplification reaction condition
For：95 DEG C of predegeneration 2min, 95 DEG C of 5s, 62.3 DEG C of 30s carry out 30 circulations, fluorescence are gathered in annealing stage, finally melted
Solution curve is monitored, that is, after completing above-mentioned last circulation, temperature rises to 73 DEG C, with the heating rate of 0.1 DEG C/s after insulation 5s
88 DEG C are gradually increased to, the continuous detection of fluorescence intensity is carried out in this temperature-rise period.And be according in melting curve judgement sample
It is no containing this five kinds of pathogenic bacteria, the nuc genes of staphylococcus aureus, the hlyA genes of Listeria monocytogenes, salmonella
The Tm values of the ipaH gene amplification products of invA genes, the tlh genes of vibrio parahemolyticus and Shigella respectively 75.5 ±
0.3 DEG C, 78.5 ± 0.2 DEG C, 80.8 ± 0.5 DEG C, 84 ± 0.1 DEG C and 86.5 ± 0.2 DEG C, melting curve point
Analysis result is as Figure 1-5.
Embodiment 2：Specificity experiments
With Enterobacter sakazakii (ATCC 51329), ETEC (ATCC 25922), pseudomonas aeruginosa (ATCC
27853), yersinia enterocolitica (ATCC 23715), bacillus cereus (ATCC 11778), vibrio mimicus
（ATCC 33653）, vibrio alginolyticus（ATCC 17749）As testing sample, staphylococcus aureus (ATCC 25923), typhoid fever
Detection of Salmonella (ATCC 50097), shigella flexneri (ATCC 12022), vibrio parahemolyticus（ATCC 33847）Increase Lee with single
, used as positive control, ultra-pure water is used as negative control for this special bacterium (CMCC 54006).Enterobacter sakazakii (ATCC 51329), large intestine
Escherichia (ATCC 25922), pseudomonas aeruginosa (ATCC 27853), yersinia enterocolitica (ATCC
23715), bacillus cereus (ATCC 11778), vibrio mimicus（ATCC 33653）, vibrio alginolyticus（ATCC 17749）, gold
Staphylococcus aureus (ATCC 25923), Salmonella typhi (ATCC 50097), shigella flexneri (ATCC 12022) and pair
Hemolytic vibrios（ATCC 33847）From American Type Culture collection warehousing；Listeria monocytogenes (CMCC 54006) are originated
In Chinese medicine bacterium preservation administrative center；Detected that positive control is generated substantially according to the methods described of embodiment 1
Amplification curve, other bacterial strains and negative control are produced without amplification curve.
Embodiment 3：Sensitivity experiment
With staphylococcus aureus, Listeria monocytogenes, salmonella, vibrio parahemolyticus and Shigella reference culture
DNA extract solutions are template, are diluted to form a series of dilution factors with ultra-pure water, and each dilution factor respectively takes 1 μ L template DNAs according to above
Methods described is detected that each dilution factor respectively does 3 multiple holes, is detected according to the methods described of embodiment 1.Result shows
Show, concentration and the Cq values of each reference culture template DNA have good linear relationship, and concentration is higher, and Cq values are lower, testing result ginseng
See Fig. 6-10.
Embodiment 4：The detection of manual simulation's contaminated food sample
Use manual simulation to pollute and detect that five kinds of pathogenic bacteria are negative food sample through GB4789, by Staphylococcus aureus
Bacterium (ATCC 25923), Listeria monocytogenes (CMCC 54006), Salmonella typhi (ATCC 50097), vibrio parahemolyticus
（ATCC 33847）It is negative with shigella flexneri (ATCC 12022) reference culture bacterial suspension inoculation to five kinds of pathogenic bacteria
Food sample, plus improvement SSSLE nutrient solution incubated overnights, are detected according to the methods described of embodiment 1.Each part sample standard deviation can be accurate
The specific melting curve peak of be inoculated with pathogenic bacteria is really detected, is occurred without non-specific melting curve peak.
Embodiment 5：The detection of Commercial Food sample
80 parts of food samples that in the market is bought are added into improvement SSSLE nutrient solution incubated overnights, according to described in embodiment 1
Method is detected.Wherein 21 parts samples are polluted by one or more pathogenic bacteria, and 3 parts of sample salmonellas are positive, 5 parts of sample Lee
This special bacterium is positive, 5 parts of sample S. aureus-positives, and 6 parts of sample vibrio parahemolyticus are positive, 2 parts of sample salmonellas
Positive with vibrio parahemolyticus, 1 part of sample staphylococcus aureus and vibrio parahemolyticus are positive, and Shigella does not detect.Together
Shi Pinghang is also consistent with testing result of the invention according to the result that GB4789 is detected.
<110>Jiaxing Municipal Disease Control and Prevention Center
<120>The heavy fluorescence PCR detection reagent kit of food-borne pathogens five
<160>10
<210>1
<211>28
<212>DNA
<213>Artificial sequence
<400>1
AACAAGATCGCTATGGTAGAACATTGGC 28
<210>2
<211>29
<212>DNA
<213>Artificial sequence
<400>2
CTTCTCTCTAGCAAGTCCCTTTTCCACTA 29
<210>3
<211>28
<212>DNA
<213>Artificial sequence
<400>3
AAAAGCAAGTTAGCTCATTTCACATCGT 28
<210>4
<211>24
<212>DNA
<213>Artificial sequence
<400>4
TTACCGTTCTCCACCATTCCCAAG 24
<210>5
<211>25
<212>DNA
<213>Artificial sequence
<400>5
CAATCAGTCCTAACGACGACCCTTC 25
<210>6
<211>21
<212>DNA
<213>Artificial sequence
<400>6
GCCGCCAAACCTAAAACCAGC 21
<210>7
<211>23
<212>DNA
<213>Artificial sequence
<400>7
CGAACGAGAACGCAGACATTACG 23
<210>8
<211>20
<212>DNA
<213>Artificial sequence
<400>8
CGGGTTAGGGAAGCGCCATT 20
<210>9
<211>26
<212>DNA
<213>Artificial sequence
<400>9
GGTAAATCTGCTGTTCAGTCTCACGC 26
<210>10
<211>24
<212>DNA
<213>Artificial sequence
<400>10
TTTACGGACTGGTTCTCCCTCTGG 24
Claims (2)
1. the heavy fluorescence PCR detection reagent kit of a kind of food-borne pathogens five, it is characterised in that the kit includes five pairs of specificity
Primer, EvaGreen PCR premixed liquids, positive control and ultra-pure water, wherein EvaGreen PCR premixed liquids include PCR buffer solutions,
DNTP mixtures, archaeal dna polymerase and saturated fluorescence dyestuff EvaGreen, positive control are staphylococcus aureus, single increasing Li Si
Special bacterium, salmonella, vibrio parahemolyticus and Shigella reference culture DNA extract solutions, five pairs of specific primer sequences
It is as follows：
Nuc sense primers：5’-AACAAGATCGCTATGGTAGAACATTGGC-3’
Nuc anti-sense primers：5’-CTTCTCTCTAGCAAGTCCCTTTTCCACTA-3’
HlyA sense primers：5’-AAAAGCAAGTTAGCTCATTTCACATCGT-3’
HlyA anti-sense primers：5’-TTACCGTTCTCCACCATTCCCAAG-3’
InvA sense primers：5’-CAATCAGTCCTAACGACGACCCTTC-3’
InvA anti-sense primers：5’-GCCGCCAAACCTAAAACCAGC-3’
Tlh sense primers：5’-CGAACGAGAACGCAGACATTACG-3’
Tlh anti-sense primers：5’-CGGGTTAGGGAAGCGCCATT-3’
IpaH sense primers：5’-GGTAAATCTGCTGTTCAGTCTCACGC-3’
IpaH anti-sense primers：5’-TTTACGGACTGGTTCTCCCTCTGG-3’；
The detection method of the weight fluorescence PCR detection reagent kit of the food-borne pathogens five, comprises the following steps：
(1) testing sample DNA is extracted；
(2) specific primer and EvaGreen PCR premixed liquids are taken, negative control, positive control or testing sample is separately added into
DNA forms amplification reaction system；
(3) being placed in amplification reaction system carries out real-time fluorescence PCR reaction on real-time fluorescence PCR instrument, reaction condition is：95 DEG C pre-
Denaturation 2min, 95 DEG C of 5s, 62.3 DEG C of 30s carry out 30 circulations, in annealing stage collection fluorescence, finally carry out melting curve prison
Survey, that is, after completing above-mentioned last circulation, temperature rises to 73 DEG C, is gradually increased to the heating rate of 0.1 DEG C/s after insulation 5s
88 DEG C, the continuous detection of fluorescence intensity is carried out in this temperature-rise period, and whether contain this according in melting curve judgement sample
Five kinds of pathogenic bacteria, the nuc genes of staphylococcus aureus, the hlyA genes of Listeria monocytogenes, the invA genes of salmonella,
Respectively 75.5 ± 0.3 DEG C of the Tm values of the tlh genes of vibrio parahemolyticus and the ipaH gene amplification products of Shigella,
78.5 ± 0.2 DEG C, 80.8 ± 0.5 DEG C, 84 ± 0.1 DEG C and 86.5 ± 0.2 DEG C；
The amplification system of the step (2) is shown in Table 1：
。
2. the heavy fluorescence PCR detection reagent kit of a kind of food-borne pathogens according to claim 1 five, it is characterised in that super
Pure water is simultaneously as negative control.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510139899.XA CN104726594B (en) | 2015-03-27 | 2015-03-27 | The heavy fluorescence PCR detection reagent kit of food-borne pathogens five |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510139899.XA CN104726594B (en) | 2015-03-27 | 2015-03-27 | The heavy fluorescence PCR detection reagent kit of food-borne pathogens five |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104726594A CN104726594A (en) | 2015-06-24 |
| CN104726594B true CN104726594B (en) | 2017-05-31 |
Family
ID=53451005
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510139899.XA Active CN104726594B (en) | 2015-03-27 | 2015-03-27 | The heavy fluorescence PCR detection reagent kit of food-borne pathogens five |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104726594B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105803058A (en) * | 2016-01-25 | 2016-07-27 | 南昌大学 | Analysis method for flora detection using high-resolution melting curve |
| CN106811535B (en) * | 2017-03-08 | 2020-01-14 | 山东众合天成检验有限公司 | Primer probe composition for simultaneously detecting five pathogenic bacteria and multiple real-time fluorescence PCR method |
| CN108486258A (en) * | 2018-01-29 | 2018-09-04 | 南昌大学 | A kind of kit and its method of visual quickly detection food-borne pathogens |
| CN108841977A (en) * | 2018-07-16 | 2018-11-20 | 中山出入境检验检疫局检验检疫技术中心 | A kind of method of pathogenic bacteria in quick measurement milk powder |
| CN112538544B (en) * | 2020-12-30 | 2022-06-14 | 广东省微生物研究所（广东省微生物分析检测中心） | Detection method and application of food-borne pathogenic bacteria standard strain viable bacteria with specific molecular targets |
-
2015
- 2015-03-27 CN CN201510139899.XA patent/CN104726594B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104726594A (en) | 2015-06-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104726594B (en) | The heavy fluorescence PCR detection reagent kit of food-borne pathogens five | |
| CN103320434B (en) | Salmonella LAMP (loop-mediated isothermal amplification) primer group and kit and detection method | |
| CN102605055B (en) | Multiplex quantitative PCR (polymerase chain reaction) detection kit for vibrio parahaemolyticus and detection method | |
| CN106434888A (en) | Method and primers for rapid isothermal detection of staphylococcus aureus and application of primers | |
| CN103966353B (en) | A kind of detect the rugged Cronobacter sakazakii of slope method and test kit and primer | |
| CN106191298A (en) | A kind of method detecting vibrio parahaemolyticus Vibrio parahaemolyticus | |
| CN103436602B (en) | Kit and method for simultaneous detection of Staphylococcus aureus gene and Escherichia coli gene by using dual molecular beacon-LAMP process | |
| CN102827925A (en) | Non-diagnostic method for detecting Vibrio vulnificus through TaqMan probe fluorescence RT-PCR | |
| Mu et al. | The fluorescent probe-based recombinase-aided amplification for rapid detection of Escherichia coli O157: H7 | |
| Zeng et al. | A polymerase chain reaction based lateral flow test strip with propidium monoazide for detection of viable Vibrio parahaemolyticus in codfish | |
| CN102643919B (en) | Detection kit and detection method for viable bacteria in vibrio parahaemolyticus in food | |
| US20220098645A1 (en) | Fast and portable microfluidic detection system as an alternative to salmonella's classical culture method | |
| CN104846078A (en) | Campylobacter jejuni constant-temperature fluorescence detection primer group, kit, and detection method which are capable of avoiding false negative | |
| CN104263838A (en) | LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for Listeria monocytogenes | |
| CN106381340B (en) | Botrytis cinerea LAMP detection primer, detection kit and its application | |
| Tran et al. | Direct multiplex recombinase polymerase amplification for rapid detection of Staphylococcus aureus and Pseudomonas aeruginosa in food | |
| Milton et al. | Novel saltatory rolling circle amplification assay for rapid and visual detection of Campylobacter jejuni in chicken meat | |
| CN103320435A (en) | Listeria monocytogenes LAMP (loop-mediated isothermal amplification) detection kit containing internal standard | |
| CN100372945C (en) | Method of multiplex fluorescence PCR - improved molecule beacon for detecting pathogenesis bacterium stemmed from eating source | |
| CN103571943A (en) | Nucleic acid detection method for salmonella typhimurium | |
| CN106498054A (en) | The GeXP analysis methods of vibrio cholera and vibrio parahaemolyticus in a kind of synchronous detecting food | |
| CN104673885A (en) | Detection kit and detection method for I-form legionella pneumophila | |
| CN106636437A (en) | Rapid quantitative method for salmonellas in food based on MPN (most probable number) and PCR (polymerase chain reaction) | |
| CN104531860B (en) | A kind of molecular detecting method of Shigella and its application | |
| CN104450930B (en) | A kind of molecular detecting method of vibrio parahemolyticus and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |