CN107557370B - Application of rice REL1 gene in improving drought stress resistance of plants - Google Patents
Application of rice REL1 gene in improving drought stress resistance of plants Download PDFInfo
- Publication number
- CN107557370B CN107557370B CN201710873354.0A CN201710873354A CN107557370B CN 107557370 B CN107557370 B CN 107557370B CN 201710873354 A CN201710873354 A CN 201710873354A CN 107557370 B CN107557370 B CN 107557370B
- Authority
- CN
- China
- Prior art keywords
- rel1
- rice
- gene
- drought stress
- drought
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses application of a rice REL1 gene in improving drought stress resistance of plants. Moderate leaf curl and reasonable leaf included angle are beneficial to survival and development of rice under stress conditions, in order to expand the application of the REL1 gene in drought stress resistance of rice, the invention adopts the wild type, REL1 mutant and overexpression REL1 rice materials to carry out drought stress treatment, and the leaf inner roll and SOD activity amplitude are taken as monitoring indexes to prove that the drought stress resistance of REL1 mutant and overexpression REL1 rice is improved relative to the wild type; meanwhile, 5 drought-resistant genes are subjected to expression analysis, and the up-regulation of the expression quantity of the REL1 gene is physiologically and molecularly proved to improve the resistance of the rice to drought stress. The invention enhances the drought stress resistance of rice by increasing the expression level of the REL1 gene, and provides a new choice for genetic improvement and molecular breeding of the drought resistance of rice.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to application of a rice REL1 gene in improving drought stress resistance of plants.
Background
The leaf morphology influences the photosynthesis ability and transpiration of rice and is an important component of an ideal plant type. Plant leaves are usually polarized to the proximal-distal axial end and thus under adverse conditions two different leaf morphologies are formed: distal crimp and proximal crimp.
The rice rel1 mutant shows outward curling of leaves, increased leaf angle, reduced plant height and reduced yield. Electron microscopy revealed that the phenotype of rel1 was due to an increase in the size and number of vesicular cells. The REL1 gene consists of two exons and an intron, encodes an unknown protein, and is highly conserved in monocots. Knocking down the expression quantity of REL 1in the REL1 mutant can restore the phenotype, and simultaneously, up-regulating the expression quantity of REL 1in the wild type, so that the plant has the phenotype similar to the REL1 mutant, and the result shows that REL1 positively regulates the outward rolling of leaves and the included angle of leaves. The REL1 protein was localized in plastids, and GUS staining revealed that REL1 was constitutively expressed in roots, leaves and inflorescences, and accumulated in mature leaves in particular. REL1 is likely to be constructed by regulating rice leaf blade by regulating BR signal gene.
In general, rice leaf rolling is caused by dehydration of the alveolar cells of the upper epidermis due to drought stress. However, the reason for the leaf rolling caused by REL1 is the increase of alveolar cell enlargement, and therefore, it is not known whether the REL1 gene has other functions or applications.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides application of the rice REL1 gene in improving the drought stress resistance of plants.
The purpose of the invention is realized by the following technical scheme: the application of the rice REL1 gene in improving the drought stress resistance of plants, wherein the gene number of the rice REL1 gene in a rice genome annotation plan is LOC _ Os01g 64380.
The plant is preferably a monocotyledonous plant.
The monocotyledon is rice; preferably, it is the medium flower 11 of rice variety.
The application of the recombinant vector, the expression cassette, the transgenic cell line, the recombinant bacteria or the recombinant virus containing the rice REL1 gene in improving the drought stress of plants.
Application of the rice REL1 gene in cultivating drought stress resistant rice.
The application of the rice REL1 gene in cultivating drought stress resistant rice is realized by the following method: the expression level of the REL1 gene is increased in rice to improve the drought stress resistance of the rice.
The method for improving the expression level of the REL1 gene in the rice is preferably realized by the following method: improving the expression of endogenous REL1 gene in rice, or over-expressing exogenous REL1 gene in rice.
The method for improving the expression of the rice endogenous REL1 gene is characterized in that T-DNA is inserted into the 3' end of the REL1 gene, so that the expression quantity of the rice endogenous REL1 gene is increased.
The exogenous REL1 gene overexpressed in rice is obtained by transferring a vector carrying the exogenous REL1 gene overexpressed in rice into the rice through a transgenic technology so as to cause the exogenous REL1 gene to be overexpressed in the rice.
The application of the recombinant vector, the expression cassette, the transgenic cell line, the recombinant bacteria or the recombinant virus containing the rice REL1 gene in cultivating drought-resistant rice.
The application of the rice REL1 gene in improving the expression level of the rice drought-resistant gene can improve the expression level of the REL1 gene and can improve the expression level of the drought-resistant gene.
The drought-resistant genes comprise LOC _ Os05g12400, LOC _ Os05g12640, LOC _ Os10g26940, LOC _ Os11g06980 and LOC _ Os03g 20090.
Compared with the prior art, the invention has the following advantages and effects:
1. the invention firstly provides application of the REL1 gene in drought stress resistance of rice. In order to verify the effect of the gene in plant drought stress response, the invention applies PEG treatment with different concentrations to wild type, REL1 mutant and overexpression REL1 rice which grow for 14 days under normal conditions, the wild type generates leaf inward rolling under the PEG treatment with lower concentration, and the REL1 mutant and overexpression REL1 rice generate leaf inward rolling under the PEG treatment with higher concentration. Meanwhile, the activity of superoxide dismutase (SOD) at 4 time points after 20% (w/w) PEG4000 treatment is measured, and the change range of the SOD activity of the REL1 mutant and the over-expression REL1 rice is larger than that of the wild type. The invention further determines the difference of the expression levels of 5 drought-resistant related genes in wild type and rel1 mutant, and the expression levels of 5 drought-resistant related genes in rel1 mutant are improved. These results indicate that increasing the expression level of REL1 can increase the resistance of rice to drought stress.
2. When the REL1 provided by the invention is applied to drought stress resistance of rice, proper leaf curling and reasonable leaf angle are beneficial to survival and development of rice under stress conditions. The application range of the REL1 gene is expanded, and a new choice is provided for genetic improvement and molecular breeding of rice drought resistance.
3. The PEG treatment of the invention simulates drought stress, the wild type, REL1 mutant and overexpression REL1 rice material are subjected to drought stress treatment, the change of the activity of the leaf inward rolling and SOD are used as monitoring indexes, the effect of the REL1 gene in the drought stress resistance of rice is researched, and the improvement of the drought stress resistance of the REL1 mutant and overexpression REL1 rice compared with the wild type is proved. Meanwhile, expression analysis is carried out on 5 drought-resistant genes, and the physiological and molecular evidence shows that the resistance of the rice to drought stress can be improved by up-regulating the expression quantity of the REL1 gene, which indicates that the method is feasible for enhancing the drought stress resistance of the rice by increasing the expression quantity of the REL1 gene.
Drawings
FIG. 1 is a graph showing the comparison of the curling degree of leaves treated with different concentrations of PEG in example 1.
FIG. 2 is a graph showing the results of determination of SOD activity after PEG treatment in example 2.
FIG. 3 is a graph showing the difference in expression of 5 drought-resistant genes between the wild type and rel1 mutant in example 3.
Detailed Description
The present invention will be described in further detail with reference to examples, but the embodiments of the present invention are not limited thereto.
1. The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. The materials, reagents and the like used are commercially available unless otherwise specified.
2. The wild rice related to the present invention is Zhonghua 11.
3. (1) the REL1 mutant involved in the present invention is derived from a T-DNA insertion mutant with Zhonghua 11 as a background, the T-DNA insertion position being at the 3' end of the REL1 gene;
(2) the overexpression REL1 rice (OE3) related in the invention is derived from transferring a vector with overexpression REL1 gene into the background of middle flower 11 by using transgenic technology;
the REL1 mutant and the rice overexpressing REL1(OE3) can be prepared by the following methods: characterizationoff Rolled and Erect Leaf 1in regulating Leaf similarity in rice, doi:10.1093/jxb/erv 319.
Example 1 degree of leaf curling after PEG treatment
The drought stress water loss of rice is typically expressed by the appearance of involution of leaves, and in order to identify the drought resistance of Wild Type (WT), REL1 mutant and over-expression REL1(OE3) rice, the leaves treated by PEG (polyethylene glycol) with different concentrations are observed, the specific steps are as follows:
(1) wild type, rel1 mutant and over-expressed OE3 rice were germinated at 37 ℃ and subsequently transferred to 1/2MS medium and cultured for 14 days at 28 ℃ under 16 h light (natural light) and 8 h dark conditions.
(2) Treating the plants obtained in step (1) with 0%, 10%, 20%, 30%, 40% (w/w) PEG6000 solution for 24 hours.
(3) Observing the cross section of the treated plant leaves and analyzing the result. Results as shown in fig. 1, rel1 mutant and overexpressed OE3 both exhibited outward leaf rolling and WT neither involution nor involution under 0% PEG treatment. At 10% (w/w) PEG treatment, the WT began to show involution, whereas rel1 mutant and overexpressing OE3 leaf showed only a reduced degree of involution and remained involuted at 20% (w/w) PEG treatment. All materials showed rolling with 30% (w/w) PEG treatment, but the rel1 mutant and overexpressed OE3 showed less rolling than WT. The results show that the REL1 mutant with increased expression level of REL1 and the over-expressed OE3 have lower sensitivity to drought stress than the wild type.
EXAMPLE 2SOD Activity assay
SOD activity is considered to be an important indicator of drought resistance. In order to identify the drought resistance of wild type, REL1 mutant and over-expression REL1(OE3) rice, the SOD activity after PEG treatment is determined, and the specific steps are as follows:
(1) the rice was cultivated in the same manner as in example 1.
(2) Treating the plants obtained in step (1) with 20% (w/w) PEG6000 solution, and measuring SOD activity at 3 hours, 6 hours, 12 hours and 24 hours after the treatment, respectively.
(3) And (5) analyzing the SOD activity measurement result. The results are shown in FIG. 2, where the SOD activity decreased 6 hours after treatment and peaked at 12 hours for wild type, rel1 mutant and overexpressed OE 3. In 3 processes of 3-6 hours, 6-12 hours and 12-24 hours of treatment time, the ascending amplitude and the descending amplitude of the SOD enzyme activity are sequentially sequenced, namely rel1 is larger than OE3 is larger than WT.
Example 3 expression differences between wild type and rel1 mutant drought-resistant genes
To find out the molecular evidence leading to the expression of the drought-resistant phenotype of rel1 mutant, the expression levels of 5 drought-resistant genes (LOC _ Os05g12400, LOC _ Os05g12640, LOC _ Os10g26940, LOC _ Os11g06980, LOC _ Os03g20090) in the wild-type and rel1 mutants were examined, respectively. The method comprises the following specific steps:
(1) the Trizol method extracts RNA from the wild type and rel1 mutant.
(2) First Strand (cDNA) synthesis was performed by reverse transcription using TransScript First-Strand cDNA Synthesis SuperMix from TransGen Biotech, Inc., as described.
(3) By Takara
Premix Ex TaqTMII (Tli RNaseH plus) kit for carrying out fluorescence quantitative PCR detection on the cDNA synthesized in the step (2), wherein the Primer pairs are Primer1/2, Primer3/4, Primer5/6, Primer7/8 and Primer9/10 respectively, and the internal reference Primer pair is Actin1/2, and the operation is carried out according to the instruction.
Primer1(5’-3’):TCCGACATGCCCACACTAAC；
Primer2(5’-3’):GCAGACAGGTGGTAGGCATT；
Primer3(5’-3’):GTGCGCAACTGAATGAAGCA；
Primer4(5’-3’):ATTTCGGGACAGAGGGGAGA；
Primer5(5’-3’):TGCCACTCGGTGCCTAAAAT；
Primer6(5’-3’):TGACCCAGGTCATAGAGCCA；
Primer7(5’-3’):TCTTCGCCCGTTTCTTTTGC；
Primer8(5’-3’):AACAGCAGGCAAGTAAGGGT；
Primer9(5’-3’):GGGCTGAAACGCACAGGCAAGA；
Primer10(5’-3’):CTGCTTGGCGTGCTTCTGC。
The PCR reaction process is as follows: denaturation at 95 deg.C for 2 min; cycling (denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 1min) for 40 cycles; melting curve analysis, stop at 0.5 deg.C for 1s from 65 deg.C to 95 deg.C, and read the plate 1 time.
(4) The relative expression of 5 drought-resistant genes in the wild type and rel1 mutant were analyzed. By use of 2△△CtThe relative expression of 5 drought-resistant genes was calculated by the method, and the results showed that the expression of 5 drought-resistant genes in rel1 was higher than that in the wild type (FIG. 3). The expression level of the REL1 gene in the REL1 mutant is increased, so that the expression level of the drought-resistant gene is increased, and the drought resistance of the REL1 mutant is improved.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
Sequence listing
<110> southern China university of agriculture
Application of <120> rice REL1 gene in improving drought stress resistance of plants
<160>10
<170>SIPOSequenceListing 1.0
<210>1
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
<210>2
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
<210>3
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
<210>4
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
<210>5
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
<210>6
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
<210>7
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
<210>8
<211>20
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
<210>9
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
gggctgaaac gcacaggcaa ga 22
<210>10
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
ctgcttggcg tgcttctgc 19
Claims (5)
1. The application of the rice REL1 gene in improving the drought stress resistance of plants is characterized in that: the plant is rice.
2. Application of the rice REL1 gene in cultivating drought stress resistant rice.
3. The application of the rice REL1 gene in cultivating drought stress resistant rice as claimed in claim 2, wherein: the expression level of the REL1 gene is increased in rice to improve the drought stress resistance of the rice.
4. The application of the rice REL1 gene in cultivating drought stress resistant rice as claimed in claim 3, wherein the improvement of the expression level of the REL1 gene in rice is realized by the following method: improving the expression of endogenous REL1 gene in rice, or over-expressing exogenous REL1 gene in rice.
5. The application of the rice REL1 gene in cultivating drought stress resistant rice as claimed in claim 4, wherein:
the expression of the rice endogenous REL1 gene is improved by inserting T-DNA into the 3' end of the REL1 gene;
the overexpression exogenous REL1 gene in rice is obtained by transferring a vector with an overexpression REL1 gene into rice through a transgenic technology.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710873354.0A CN107557370B (en) | 2017-09-25 | 2017-09-25 | Application of rice REL1 gene in improving drought stress resistance of plants |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710873354.0A CN107557370B (en) | 2017-09-25 | 2017-09-25 | Application of rice REL1 gene in improving drought stress resistance of plants |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107557370A CN107557370A (en) | 2018-01-09 |
| CN107557370B true CN107557370B (en) | 2020-03-17 |
Family
ID=60982815
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710873354.0A Active CN107557370B (en) | 2017-09-25 | 2017-09-25 | Application of rice REL1 gene in improving drought stress resistance of plants |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107557370B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016210291A1 (en) * | 2015-06-26 | 2016-12-29 | Dana-Farber Cancer Institute, Inc. | Fused bicyclic pyrimidine derivatives and uses thereof |
| CN106318952A (en) * | 2015-07-03 | 2017-01-11 | 复旦大学 | Rice gene OsAPM1 and application thereof in improving drought tolerance and high temperature stress tolerance of rice |
| CN107163112A (en) * | 2017-07-07 | 2017-09-15 | 中国水稻研究所 | Paddy rice semidominant leaf roll controlling gene ERL1 and its application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101899449B (en) * | 2010-06-29 | 2011-09-07 | 山东省农业科学院高新技术研究中心 | Application of gene PHYB for controlling rice drought stress toleration |
-
2017
- 2017-09-25 CN CN201710873354.0A patent/CN107557370B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016210291A1 (en) * | 2015-06-26 | 2016-12-29 | Dana-Farber Cancer Institute, Inc. | Fused bicyclic pyrimidine derivatives and uses thereof |
| CN106318952A (en) * | 2015-07-03 | 2017-01-11 | 复旦大学 | Rice gene OsAPM1 and application thereof in improving drought tolerance and high temperature stress tolerance of rice |
| CN107163112A (en) * | 2017-07-07 | 2017-09-15 | 中国水稻研究所 | Paddy rice semidominant leaf roll controlling gene ERL1 and its application |
Non-Patent Citations (2)
| Title |
|---|
| Characterization of Rolled and Erect Leaf 1 in regulating leave morphology in rice;Chen, Qiaoling等;《JOURNAL OF EXPERIMENTAL BOTANY》;20150930;第66卷(第19期);第6047-6058页，参见全文 * |
| 水稻半显性卷叶突变体erll的遗传分析与基因定位;徐静;《中国优秀硕士学位论文全文数据库（农业科技辑）》;20141231;第D047-64页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107557370A (en) | 2018-01-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2007335706B2 (en) | Polynucleotides and polypeptides involved in plant fiber development and methods of using same | |
| CN107523574B (en) | Rice disease spot gene SPL35 for regulating and controlling programmed cell death and disease resistance and application thereof | |
| CN110317249A (en) | Albumen and the application of wax plum CpAP1 gene and its coding | |
| CN109134632A (en) | The albumen and its encoding gene of regulation plant root development and application | |
| CN108017699B (en) | Rice Os NBL1 albumen relevant to plant senescence and its encoding gene and application | |
| Shibuya et al. | Expression of autophagy-associated ATG8 genes during petal senescence in Japanese morning glory | |
| CN104087561A (en) | White green leaf gene WGL1 of rice and application thereof | |
| CN106749580B (en) | Plant salt tolerance GAP-associated protein GAP TaPUB15-D and its encoding gene and application | |
| CN105441396A (en) | Eggplant constitutively photomorphogenic SmCOP1 protein and coding gene thereof | |
| CN105440115A (en) | Eggplant SmHY5 protein and coding gene thereof | |
| CN105087508A (en) | Eggplant flavanone 3-hydroxylase SmF3H as well as gene and application thereof | |
| CN104745560A (en) | Eggplant chalcone synthase SmCHS1 protein and coding gene thereof | |
| CN107557370B (en) | Application of rice REL1 gene in improving drought stress resistance of plants | |
| CN111593064B (en) | Method for improving salt tolerance of rice by inhibiting OsSDM gene expression | |
| CN104945492B (en) | Plant stress tolerance correlative protein TaAREB3 and its encoding gene and application | |
| JP2015171326A (en) | Gene that provides plants with disease resistance, drought resistance, salinity tolerance, increased photosynthesis efficiency and increased number of tillers | |
| CN114507674B (en) | Application of circadian rhythm gene LUX of tea tree in improving cold resistance of plants | |
| CN114369616B (en) | Application of tomato SISPS gene in improving high temperature resistance of plants | |
| JP5444560B2 (en) | Plants whose root elongation is promoted and methods for producing the same | |
| CN113583990B (en) | Rice full-fertility half-dwarf phenotype regulatory gene SD38 and application thereof | |
| CN108823220A (en) | The clone of wax synthesis related gene MdCER1 and its application in a kind of apple | |
| CN111454340B (en) | Elytrigia elongata external rectification potassium channel protein and coding gene and application thereof | |
| CN111518803B (en) | RNAi fragment and application thereof in regulation and control of lignin synthesis | |
| CN111499708A (en) | Application of grape VabH L H036 gene in improving cold resistance of plants | |
| CN110283240A (en) | Albumen and the application of wax plum CpUFO gene and its coding |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |