CN107519291A - Schisandra chinens P.E is preparing the application in activating HSP70 medicines - Google Patents
Schisandra chinens P.E is preparing the application in activating HSP70 medicines Download PDFInfo
- Publication number
- CN107519291A CN107519291A CN201710277801.6A CN201710277801A CN107519291A CN 107519291 A CN107519291 A CN 107519291A CN 201710277801 A CN201710277801 A CN 201710277801A CN 107519291 A CN107519291 A CN 107519291A
- Authority
- CN
- China
- Prior art keywords
- hsp70
- schisandra
- medicines
- application
- activating
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/79—Schisandraceae (Schisandra family)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/57—Magnoliaceae (Magnolia family)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
- A61K2236/30—Extraction of the material
- A61K2236/33—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones
- A61K2236/331—Extraction of the material involving extraction with hydrophilic solvents, e.g. lower alcohols, esters or ketones using water, e.g. cold water, infusion, tea, steam distillation, decoction
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
- A61K2236/30—Extraction of the material
- A61K2236/39—Complex extraction schemes, e.g. fractionation or repeated extraction steps
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2236/00—Isolation or extraction methods of medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicine
- A61K2236/50—Methods involving additional extraction steps
- A61K2236/53—Liquid-solid separation, e.g. centrifugation, sedimentation or crystallization
Abstract
The invention discloses a kind of new application of Schisandra chinens P.E, specially Schisandra chinens P.E is preparing the application in activating HSP70 promoter medicines, is belonging to biomedicine field.Schisandra chinens P.E of the present invention is schisandra fruit decoction, HSP70 promoter cell screening models of the invention by the way that schisandra fruit decoction to be acted on to structure, it was found that schisandra fruit decoction can activate HSP70 promoters, it can be applied in activation HSP70 promoters activator or medicine is prepared, there are the potentiality for the treatment of nerve degenerative diseases.
Description
Technical field
The invention belongs to biomedicine field, and in particular to a kind of Chinese medical extract is preparing HSP70 promoter activator
In application and prepare activate HSP70 promoter medicines in application.
Background technology
Heat shock protein (HSP) is widely present in prokaryotic and eukaryotic, one guarded very much in evolution
Class heat stress proteins, it is divided into HSP90 (83-90KD), HSP70 (66-78KD), HSP60 and small HSP etc. according to the size of molecular weight
4 families, wherein HSP70 are most conservative and most important family in heat-shock protein family, while are of greatest concern, study most
For deep one kind (Kiang and Tsokos, 1998).HSP 70 family comprises at least eight gene expression product albumen,
Respectively HSP70-1a, HSP70-1b, HSP70-1t, HSP70-2, HSP70-5, HSP70-6, HSC70, HSP70-9, they are all
It is the product of HSP70 genes diverse location expression, there is highly conserved amino acid sequence and domain, domain bag in structure
Include ATP binding domain, protease-sensitive domain, more peptide binding domains, variable domain, rich in G/P C-terminal domain (Da μ gaard et al.,
2007).Wherein HSP70-1a, HSP70-1b, which are two kinds, stress can induce albumen, and its corresponding promoter is inducible promoter,
Respectively HSPA1A and HSPA1B.It is various stress (including high temperature, oxidative stress, damage etc.), both promoters under environment
Being activated promptly, makes HSP70-1a and HSP70-1b high level expressions, is combined with the hydrophobic residue of protein, stable protein
Structure, false folding and the aggregation of protein are prevented, and then protect cell.
In different tissues and cell, the expression quantity of HSPA1A and HSPA1B genes is different, generally,
HSPA1A expression is higher than HSPA1B.HSPA1A promoter region is located at transcription initiation site -1000bp to 100bp, its
Include two TATA-box, three CCAAT-box, four GC-box, in addition to multiple nGAAn areas, referred to as Binding characteristic
(heatresponseelement, HSE).HSE is functional areas essential in heat stress response, and its presence makes promoter
High-level activated transcription, so that heat shock protein has inducibility.Contain 184 transcription factors in HSPA1A promoters
Binding site, most important of which have HSF1, NF-kappaB1, STAT3 etc..In high temperature, oxidative stress, intracellular environment pH hairs
When changing and cell sustain damage, HSF1 is combined with HSE so as to activate HSPA1A promoters, and induction produces substantial amounts of
HSP70, so as to protect cells from damaging.Therefore can be started using HSPA1A promoters as research object according to HSPA1A
The situation that son is induced, the activator that can substantially activate HSPA1A promoters and then produce substantial amounts of HSP70 is filtered out, for
In the disease treatment related to HSP70.
HSP70 has various biological function, mainly including the following aspects：(1) molecular chaperone function：HSP70 with
Newborn, unfolded, false folding or the protein of aggregation combine, and make some protein dissociations, help to need the protein folded
It is correct to fold.Many nerve degenerative diseases are all closely related with protein Misfolding and aggregation, such as alzheimer, pa
The gloomy disease of gold, ALS.It is now recognized that α-the synuclein of false folding aggregation and cytotoxicity are in Parkinson
Very crucial effect is played in family name's disease and the dull-witted pathogenic process with Lewy corpusculums, and HSP70 can in vivo and in vitro
False folding and the α-synuclein of aggregation species are reduced, and makes body from α-synuclein toxic action.In addition
The HSP70 of overexpression can suppress the aggregation of A β early stages, promote degradeds of the A β in microglia, make the albumen of false folding
Matter folds so as to reduce oligomer again, and the HSP70 of overexpression can also reduce the Tau albumen of the indissoluble of Hyperphosphorylationof, subtract
The accumulation of few Tau albumen.(2) anti-apoptotic acts on：HSP70 overexpression can suppress it is harmful stress caused by JNK,
P38 etc. stress kinases activation, so as to prevent Apoptosis, such as a kind of HSP70 synthesis derivant HGFs HGF
Can be by inducing HSP70 synthesis, to suppress the hepatocellular apoptosis caused by tumor necrosis factor TNF-alpha.(3) immunization：
The HSP70 of overexpression can improve the content of intracellular total glutathione, prevent cell from being attacked by cell factors such as TNF
Hit, can be by suppressing the inducing action of IL-1 and interferon to NO synzyme, so as to protect the physiological function of pancreas.(4) it is thin
Born of the same parents' protective effect：When body cell is by various stress stimulations, such as high fever, oxidation, mechanical damage, cell can produce exception
Albumen, the degraded of paraprotein is can speed up with caused HSP70, or protein peptide chain is folded again, recoverin
The original conformation of matter, strengthen cell homeostasis, so as to play a part of cytoprotection, in addition, HSP70 is considered as damage hindbrain
A kind of important endogenous protection factor caused by tissue.
HSP70 biological function is quite varied, and the function and significance in disease is very great, turns into and solves numerous diseases
The key point of disease, so urgent problem to be solved will be turned into by finding HSP70 activator.Have now been found that some HSP70's
Activator, if any the Teprenone for treating gastric ulcer, for the protease inhibitors in nerve degenerative diseases, for group
Stannous chloride of transfer etc. is knitted, but the toxicity of these activator is larger, and side effect is more, and the toxic side effect of Chinese medicine is relatively
Small, target spot is more, so the activator that significantly activation HSP70 is therefrom filtered out in Drug Storage will be relevant with HSP70 to treating or preventing
Disease it is of great advantage.
Bibliography
Daμgaard,M.,Rohde,M.,and Jaattela,M.(2007).The heat shock protein 70
family:Highly homologous proteins with overlapping and distinct
functions.FEBS letters 581,3702-3710.
Kiang,J.G.,and Tsokos,G.C.(1998).Heat shock protein 70 kDa:molecμLar
biology,biochemistry,and physiology.Pharmacol Ther 80,183-201.
The content of the invention
It is an object of the invention to provide a kind of application of Schisandra chinens P.E in HSP70 promoter activator is prepared.
The fruit of Chinese magnoliavine used is magnoliaceae schisandra Schisandra chinensis (Turcz.) in the present invention
Baill. dry mature fruit, pulp gas is micro-, sour；After seed is broken, aromatic, acrid flavour, slight bitter.With astringe the lung to stop cough,
Puckery essence, the effect of antidiarrheal hidroschesis are nourished, research shows that the fruit of Chinese magnoliavine has many pharmacological actions such as protect liver, cardiac stimulant, antibacterial action.
Wherein, described Schisandra chinens P.E is schisandra fruit decoction.
Further, described schisandra fruit decoction is prepared by following methods：Schisandra chinensis medicinal material is weighed, adds distillation
Water soaks 30 minutes, is decocted 30 minutes after boiling；Filtered through gauze takes filtrate, filter residue to be soaked 30 minutes after adding distilled water, after boiling
Decoct 30 minutes；Merge filtrate twice after filtered through gauze, concentrate；1000rpm is centrifuged 10 minutes after natural cooling, with filter paper mistake
Miscellaneous, constant volume is filtered out, schisandra fruit decoction is made.
Wherein, the crude drug concentration of described schisandra fruit decoction is 1.64mg/mL-12.5mg/mL.
Wherein, the disease relevant with HSP70 promoters is nerve degenerative diseases, angiocardiopathy.
Further, described nerve degenerative diseases are alzheimer, parkinsonism, ALS.
The present invention also aims to provide a kind of Schisandra chinens P.E in preparation prevention or treatment with HSP70 promoters to have
Application in the nerve degenerative diseases medicine of pass.
Wherein, described Schisandra chinens P.E can activate HSP70 by activating HSP70 promoters.
Wherein, described nerve degenerative diseases are alzheimer, parkinsonism, ALS.
Further, described schisandra fruit decoction is prepared by following methods：Schisandra chinensis medicinal material is weighed, adds distillation
Water soaks 30 minutes, is decocted 30 minutes after boiling；Filtered through gauze takes filtrate, filter residue to be soaked 30 minutes after adding distilled water, after boiling
Decoct 30 minutes；Merge filtrate twice after filtered through gauze, concentrate；1000rpm is centrifuged 10 minutes after natural cooling, with filter paper mistake
Miscellaneous, constant volume is filtered out, schisandra fruit decoction is made.
Wherein, the crude drug concentration of described schisandra fruit decoction is 125 μ g/mL-500 μ g/mL.
In the present invention, agent high flux screening cell model is activated by building HSP70 promoters, to schisandra fruit decoction
Being found after being detected, schisandra fruit decoction can substantially activate HSP70 promoters, and by building AD cell models, to that can swash
The schisandra fruit decoction of HSP70 promoters living carries out anti-AD compliance test results, finds schisandra fruit decoction energy in AD cell models
Enough mitigate by A β25-35Caused cellular damage degree.
Brief description of the drawings
Fig. 1 is activation situation of the positive drug HSP70 promoter activator Teprenones to HSP70 promoters
Fig. 2 is the semi-quantitative results that schisandra fruit decoction activates to HSP70 promoters
Fig. 3 is the quantitative result of schisandra fruit decoction HSP70 promoters activation
Fig. 4 is schisandra fruit decoction to PC12 cell growth inhibition results
Fig. 5 is A β 25-35 to PC12 cell growth inhibition results
Fig. 6 is that MTT detects the exercising result that schisandra fruit decoction causes PC12 cellular damage models to A β 25-35
Fig. 7 is that LDH methods detect the exercising result that schisandra fruit decoction causes PC12 cellular damage models to A β 25-35
Embodiment
Specific embodiment presented below with realize Schisandra chinens P.E of the present invention prepare activate HSP70 promoters
Application in medicine, but it is not limited to these embodiments.
Major experimental instrument
PCR instrument (American AB I veriti)；The type gel imagers (GE) of Image Quant 300；HZQ-F16OA type constant temperature
Shaken cultivation case (Shanghai one is permanent)；HDB-PLUS types constant-temperature metal bath (Thermo Fisher)；DYY-8B types electrophoresis apparatus (primary
It is happy)；Ultra-pure water instrument (Millipore)；Ice machine, centrifuge (Hitachi)；Inverted fluorescence microscope (Olympus 1X71)；
Multi-function microplate reader (Varioskan Flash).
Major experimental material
- the HF of restriction enzyme Hind III (NEB Products)；Blood DNA extracts kit；Endotoxin-free plasmid carries greatly
Kit is purchased from Tiangeng biochemical technology Co., Ltd；PrimeSTAR GXL DNA polymerase；SanPrep pillar plasmids
The a small amount of extraction agent boxes of DNA；DNA glue reclaim kits；PCR primer purification kit；RTaq enzymes；Kanamycins；Ammonia benzyl mould
Element；pMDTM19-T Vector Cloning Kit are purchased from Shanghai Sheng Gong bioengineering limited company；Plasmid pEGFP-1
It is purchased from excellent precious biology；PGL3-Enhancer is given by Shanghai Communications University Life Science College professor Jin Weilin；
Lipofectamine2000 is purchased from Invitrogen；Hyclone is purchased from Chinese holly；DMEM/HIGH GLUCOSE；
Penicillin-Streptomycin Solution are purchased from HyClone；Luciferase Assay System
It is purchased from Promega.
Competent escherichia coli cell E.coli DH5 α and Escherichia coli TOP10 are bought from Tiangeng biochemical technology (Beijing)
Co., Ltd.
HEK 293T are purchased from Chinese Academy of Sciences's cell bank.
Foundation of the embodiment 1 based on HSPA1A Promter screening cell models
The clone of 1.HSPA1A Promoter genes
(1) design synthesis HSPA1A Promoter PCR primers
P1：CCCAAGCTTCGGATCAGCCAACGCCCACATACCTC
P2：CGCGGATCCCGGTTCCCTGCTCTCTGTCGGCTCC
(2) PCR is expanded
Human blood is gathered, DNA is extracted according to poba gene group DNA extraction kit specification, using people DNA as template, with
P1 and P2 enters performing PCR amplification respectively as upstream and downstream primer.PCR system (25 μ L) is as follows：
The PCR reaction systems of table 1
PCR reaction conditions：98℃：10s；60℃：15s；68℃：1min；Circulation 40 times.PCR primer is subjected to 1% agar
Sugared gel electrophoresis, as a result display amplify the HSPA1A Promoter DNA bands of about 1000bp sizes.
(3) HSPA1A Promote TA clones
PCR primer is carried out after glue reclaim to it plus " A " processing, reaction system are as follows：The PCR primer HSPA1A of purifying
The μ L of 2 μ L, 10X PCR Buffer of Promoter10 μ L, dNTPs, 1 μ L, rTaq enzymes 0.2.72 DEG C of reactions on PCR instrument device
30min.Add the HSPA1A Promoter genetic fragments of " A " tail with PCR primer Purification Kit.According to pMDTM19-T
Vector Cloning Kit specification carries out TA clones, so as to build the restructuring matter containing HSPA1A Promoter genes
Grain pMD19-T-HSPA1A Promoter carriers, connection product it is heat-shock transformed enter competence E.coli DH5 α, be applied to containing 100
On the LB flat boards of μ g/mL ampicillins (AMP), 37 DEG C are cultivated 12 hours, and the culture of picking single bacterium colony carries out bacterium solution PCR inspections
Survey, and extract carry out DNA restricted enzyme cutting analysis after plasmid and DNA sequencing determine insertion objective gene sequence it is accurate
Property.
The structure of 2.pHSPA1A-EGFP recombinant vectors
This experiment carries out expanding HSPA1A Promoter genes using pMD19-T-HSPA1A Promoter carriers as template
Fragment, design of primers are as follows：
P3：TCTCGAGCTCAAGCTTCGGATCAGCCAACGCCCACATACC
P4：GCAGAATTCGAAGCTTCGGTTCCCTGCTCTCTGTCGGCTCC
PCR reaction systems (25 μ L) are as follows：
The PCR reaction systems of table 2
| ddH2O | 15μL |
| 5xprimeSTAR GXL Buffer | 5μL |
| dNTP Mixture(2.5mM) | 2μL |
| P3(10μM) | 0.75μL |
| P4(10μM) | 0.75μL |
| pMD19-T-HSPA1A Promoter | 1μL |
| PrimeSTAR GXL DNA polymerase | 0.5μL |
PCR reaction conditions：98℃：10s；60℃：15s；68℃：1min；Circulation 40 times.PCR primer is subjected to 1% agar
Sugared gel electrophoresis, as a result display amplify the HSPA1A Promoter DNA bands of about 1000bp sizes.Pass through Ago-Gel
Electrophoresis and glue reclaim kit recovery HSPA1A Promoter DNA fragmentations, with-HF digested plasmid pEGFP-1 the matter of Hind III
Grain, endonuclease reaction system are as follows：5 III-HF of μ L, Hind of pEGFP-110 μ L, Cutsmart 1 μ L, ddH2The μ L of O 34, cumulative volume
For 50 μ L, after 37 DEG C of metal baths react 30 minutes, the pEGFP-1 fragments of linearisation are reclaimed with glue reclaim kit.This experiment
It is attached using seamless clone technology, according to Takara companiesHD Cloning Kit operation manuals are carried out,
It is specific as follows：The configuration of In-Fusion reaction solutions：The HSPA1A Promoter DNA fragmentation 73ng of purifying, linearisation
The μ L of pEGFP-1 carriers 100ng, 5X In-Fusion HD Enzyme Premix 2, cumulative volume is 10 μ L, and mixed liquor is placed in
Reacted 30 minutes on 50 DEG C of metal baths, reaction terminates rear brief centrifugation, and centrifuge tube is placed in into cooled on ice 5 minutes, carries out follow-up
Conversion reaction, conversion reaction is as follows：3 μ L reaction mixtures are taken, 50 μ L TOP10 competent cells is added, gently mixes rearmounted
In iceberg 30 minutes；42 DEG C of heat shocks 45 seconds, place 2 minutes on ice；Add the empty LB culture mediums of 150 μ L antibiotic-frees, 37 DEG C
150rpm recovers 1 hour；Cell after recovery is all spread evenly across on the LB flat boards containing kanamycins, 37 DEG C of incubations 20 are small
When.Picking single bacterium colony is placed in 200rpm on 37 DEG C of shaking tables and cultivated 6.5 hours into LB nutrient solutions of the 900 μ L containing kanamycins
Afterwards, bacterium solution PCR detections are carried out, and DNA restricted enzyme cutting analysis and the mesh of DNA sequencing determination insertion are carried out after extracting plasmid
Gene order accuracy.
3.pGL3-E-HSPA1A the structure of Promoter recombinant vectors
This experiment carries out expanding HSPA1A Promoter gene pieces using pMD19-T-HSPA1A Promoter as template
Section, design of primers are as follows：
P5：CGATCTAAGTAAGCTTCGGATCAGCCAACGCCCACATAC
P6：CCGGAATGCCAAGCTTCGGTTCCCTGCTCTCTGTC
PCR reaction systems (25 μ L) are as follows：
The PCR reaction systems of table 3
| ddH2O | 15μL |
| 5xprimeSTAR GXL Buffer | 5μL |
| dNTP Mixture(2.5mM) | 2μL |
| P5(10μM) | 0.75μL |
| P6(10μM) | 0.75μL |
| PMD19-T-HSPA1A Promoter plasmids | 1μL |
| PrimeSTAR GXL DNA polymerase | 0.5μL |
PCR reaction conditions：98℃10s；60℃15s；68℃1min；Circulation 40 times.PCR primer is subjected to 1% agarose
Gel electrophoresis, as a result display amplify the HSPA1A Promoter DNA bands of about 1000bp sizes.Pass through Ago-Gel electricity
Swimming and glue reclaim kit recovery HSPA1A Promoter DNA fragmentations, with-HF digested plasmids the pGL3- of Hind III
Enhancer, endonuclease reaction system are as follows：10 5 III-HF of μ L, Hind of μ L, Cutsmart of pGL3-Enhancer 1 μ L, ddH2O
34 μ L, cumulative volume are 50 μ L, and after 37 DEG C of metal baths react 30 minutes, the pGL3- of linearisation is reclaimed with glue reclaim kit
Enhancer fragments.It is attached using seamless clone technology, experimental method is the same as described in step 2.
4. the foundation based on HSPA1A Promter screening cell models
After 293T cell recoveries, pass on 4 times, observation cell state is good, standby.
(1) transient transfection of pHSPA1A-EGFP recombinant vectors
A. plating cells：Transfection 24 hours, using 0.25% trypsin digestion cell and is counted, by cell with 1 × 106It is individual thin
Born of the same parents/mL density is inoculated in 6cm culture dishes, cumulative volume 4mL.Require that cell confluency degree is 70-80% during transfection；
B. cell culture supernatant is sopped up before transfecting, after being cleaned one time using the DMEM culture mediums of serum-free, adds 3mL
Opti-MEM subtracts blood serum medium；
C., the pDsRed-Express-N1 plasmids of 4 μ g pHSPA1A-EGFP plasmids and 4 μ g are added to 500 μ L Opti-
MEM subtracts in blood serum medium, jiggles uniformly；
D., the opti-MEM that 16 μ L Lipofectamine 2000 is added to other 500 μ L subtracts in blood serum medium, gently
Jog shakes uniformly, is stored at room temperature 5 minutes；
E. DNA suspensions and the suspensions of Lipofectamine 2000 are mixed, cumulative volume 1mL, gently mixes, be stored at room temperature
20 minutes；F. DNA and the mixed liquors of Lipofectamine 2000 are added in 6cm wares, all around rocks uniformly, be placed in cell
Cultivated in incubator；
H. after transfecting 6 hours, first with after PBS 2 times, add 300 μ L, 0.25% trypsin digestion cells 1 minute, be transferred to
In sterile blue lid bottle, then add 24mL 10%FBS nutrient solutions, carry out 96 orifice plate bed boards, per the μ L of hole 200；After culture 12 hours, enter
Row drug-treated, after continuing culture 24 hours, observed with inverted fluorescence microscope and take pictures green fluorescence and red fluorescence.Utilize
ImageJ seeks the average fluorescent strength of one group of Green fluorescin and red fluorescent protein respectively, with putting down for green fluorescent protein
The average fluorescent strength of equal fluorescence intensity ratio red fluorescent protein, then relative intensity of fluorescence is tried to achieve compared with control group.It is i.e. relative
Fluorescence intensity=(corresponding red glimmering in average fluorescent strength/drug-treated group of drug-treated group Green fluorescin
The average fluorescent strength of photoprotein)/(corresponding red in average fluorescent strength/control group of control group Green fluorescin
The average fluorescent strength of color fluorescin)
(2) transient transfection of pGL3-E-HSPA1A Promoter recombinant vectors
The transient transfection of pHSPA1A-EGFP recombinant vectors in the same step of method (1) of transfection.
It is to be transfected for pGL3-E-HSPA1A Promoter and pRL-TK, mass ratio 23:1, DNA gross mass is 8 μ g.
After agent-feeding treatment, continue culture 24 hours, useLuciferase Assay System detect the work of luciferase
Property.Specific method is as follows：96 orifice plates are taken out from cell culture incubator, balances to room temperature, sucks supernatant；80 μ L are added per hole
Passitive (1X) Lysis cell lysis 1 minute；Piping and druming cell is allowed to fully crack, and takes 40 μ L to be transferred to Corning per hole
In complete white 96 orifice plates of Costar；40 μ L Dual-Glo Luciferase Reagent are added per hole, are rocked 2 minutes, room temperature is incubated
Educate 10 minutes, the activity of firefly luciferase is detected with multi-function microplate reader；40 μ L Dual-Glo Stop＆ are added per hole
Glo Reagent, it is incubated at room temperature 10 minutes, wherein rocking 2 minutes, multi-function microplate reader detects the activity of renilla luciferase.
Checking of the embodiment 2 based on HSPA1A Promter screening cell models
1. effect of the heat shock to HSPA1A Promter
After transfection 6 hours, 96 orifice plate bed boards are carried out, after cultivating 12 hours, carry out Heat thermostability, concrete operations are as follows：Take 3
Hole cell sets blank control wells as Heat thermostability group.After sopping up supernatant, add 20 μ L's with PBS cell once
Pancreatin digests 1 minute, then adds 200 μ L complete culture solutions, is transferred in 1.5mL EP pipes, is placed on 41 DEG C of Heat thermostabilities on metal bath
After 1 hour, it is then transferred in 96 orifice plates, is put into cell culture incubator after continuing culture 24 hours, is seen with inverted fluorescence microscope
Examine and take pictures green fluorescence and red fluorescence, Huo ZheyongLuciferase Assay System detect luciferase
Activity.As a result：As shown in figure 1,41 DEG C can substantially activate HSP70 promoters, illustrate HSP70 promoter cell screening models
Successfully construct.(* represents to compare P with cotrol<0.05, * * represents to compare P with cotrol<0.01)
2. effect of the Teprenone to HSPA1A Promter
Teprenone is the HSPA1A Promter activator of document report, so being used as positive control by the use of Teprenone.
The preparation of Teprenone：Precision weighs 0.3305g Teprenones, is dissolved in the gumwaters of 5mL 5%, is made
200mmol/L Teprenone storing solution, required concentration is diluted to during use.
Agent-feeding treatment：After transfection 6 hours, 96 orifice plate bed boards are carried out, after cultivating 12 hours, add replacing for various concentrations respectively
Puri ketone, after continuing culture 24 hours, observed with inverted fluorescence microscope and take pictures green fluorescence and red fluorescence, Huo ZheyongLuciferase Assay System detect the activity of luciferase.Teprenone is as HSP70 activator
Positive drug, can activate HSP70 promoters in 3.90 μm of ol/L-125.0 μm of ol/L concentration ranges, and further explanation has succeeded
HSP70 promoters activator screening cell model is built, as a result (* represents to compare P with cotrol as shown in Figure 1<0.05, * * tables
Show and compare P with cotrol<0.01).
Effect of the schisandra fruit decoction of embodiment 3 to HSPA1A Promter
1. the preparation of schisandra fruit decoction
25g schisandra chinensis medicinal materials are weighed, add 200mL distilled water immersions 30 minutes；It is cooked by slow fire after boiling by intense fire 30 minutes；
Filtrate is taken with filtered through gauze, is soaked 30 minutes after filter residue addition 150mL distilled water；It is cooked by slow fire again after boiling by intense fire 30 minutes；
Merge filtrate twice after filtered through gauze, slow fire is concentrated into 25mL or so；1000rpm is centrifuged 10 minutes after natural cooling, with filter
Paper filtering and impurity removing, with 25mL volumetric flask constant volumes, institute is diluted to so as to prepare 1g/mL schisandra fruit decoction storing solution, during use
Need concentration.
2.MTT methods determine the active drug activity scope of schisandra fruit decoction
Agent-feeding treatment the previous day carries out 96 orifice plate bed boards, per hole 1 × 104Individual cell, after cultivating 24 hours, addition is different dense
The schisandra fruit decoction of degree, every group of three holes, after handling 24 hours, 5mg/mL MTT is added, makes its final concentration of 0.5mg/mL,
It is put into after being cultivated 4 hours in cell culture incubator, sops up supernatant, 150 μ L DMSO are added per hole, is placed in low speed concussion 10 on shaking table
Minute, with the light absorption value at ELIASA detection 490nm.The active drug activity scope of schisandra fruit decoction is calculated
For：Less than 12.5mg/mL.
3. effect of the schisandra fruit decoction to HSPA1A Promter
After transfection 6 hours, 96 orifice plate bed boards are carried out, after cultivating 12 hours, after diluting schisandra fruit decoction with DMEM, respectively
The schisandra fruit decoction of various concentrations is added, blank control is DMEM nutrient solutions, continues culture 24 hours, inverted fluorescence microscope
Observe and take pictures green fluorescence and red fluorescence, Huo ZheyongLuciferase Assay System detect fluorescein
The activity of enzyme.Qualitative and quantitative screening result is shown, in 2.46mg/mL-12.5mg/mL concentration ranges, fruit of Chinese magnoliavine decocting
Liquid energy enough activates HSP70 promoters, and (* represents to compare P with cotrol as shown in Figures 2 and 3<0.05, * * is represented and cotrol phases
Compare P<0.01).
The schisandra fruit decoction of embodiment 4 is to A β25-35Cause the effect of PC12 cellular damage models
1. schisandra fruit decoction is to PC12 cell growth inhibitions
This experiment detects schisandra fruit decoction to the growth inhibition effect of PC12 cells using mtt assay, and method is the same as embodiment 3
In step 2.Experimental result shows that schisandra fruit decoction does not have toxicity when less than 1.0mg/mL to PC12 cells, therefore selects small
Schisandra fruit decoction is detected to A β in the concentration range equal to 1.0mg/mL25-35The work of caused PC12 cellular damages model
With (* represents to compare P with cotrol as shown in Figure 4<0.05, * * represents to compare P with cotrol<0.01).
2.Aβ25-35To PC12 cell growth inhibitions
Precision weighs A β25-35Powder is dissolved in filtration sterilization deionization distilled water, is made into 1mmol/L storing solution, 0.22 μM
After membrane filtration is degerming, it is incubated 7 days in 37 DEG C of environment, forms it into state of aggregation A β 25-35, is then diluted with DMEM nutrient solutions
It is thin to carry out agent-feeding treatment afterwards into various concentrations gradient (10 μm of ol/L, 15 μm of ol/L, 20 μm of ol/L, 25 μm of ol/L, 30 μm of ol/L)
Born of the same parents, the A β of various concentrations gradient are detected with MTT method25-35To PC12 cell growth inhibitions, to determine A β 25-35 couple
The optium concentration of PC12 cellular damages, specific method is the same as the step 2 in embodiment 3.Experimental result shows, A β25-35It is thin to PC12
Gradient dependence is presented in the toxic action of born of the same parents, and in 30 μm of ol/L, cells survival rate is 54.3%, select this concentration be used as with
Model group A β in testing afterwards25-35Concentration, (* represents with cotrol to compare P as shown in Figure 5<0.05, * * is represented and cotrol
Compared to P<0.01).
3.MTT detects schisandra fruit decoction to A β25-35Cause the effect of PC12 cellular damage models
Agent-feeding treatment the previous day carries out 96 orifice plate bed boards, per hole 1 × 104Individual cell, after cultivating 24 hours, control group adds
Empty culture medium, 30 μm of ol/L A β are added in model group25-35, 30 μm of ol/L A β of experimental group addition25-35With various concentrations (125 μ
G/mL, 250 μ g/mL, 500 μ g/mL) schisandra fruit decoction, every group of three holes, processing detects after 24 hours with MTT method, side
Method is the same as the step 2 in embodiment 3.Experimental result is shown, compared with blank control, schisandra fruit decoction can substantially suppress by A
β25-35Caused PC12 cell deaths, and there is concentration gradient dependence, illustrate that fruit of Chinese magnoliavine decocting can open by activating HSP70
Mover, HSP70 heat shock proteins are produced, are mitigated with this by A β25-35Caused deleterious cellular effects, (* is represented and 0 as shown in Figure 6
μ g/ml groups compare P<0.05, * * represents to compare P with 0 μ g/ml groups<0.01).
4.LDH (lactate dehydrogenase, lactic dehydrogenase) method detects schisandra fruit decoction to A β25-35Cause
The effect of PC12 cellular damage models
Agent-feeding treatment the previous day carries out 96 orifice plate bed boards, per hole 1 × 104Individual cell, per the μ L of hole 200, cultivate 24 hours, make
Cell density is no more than 80%-90%, each culture hole is divided into following several groups：Acellular culture hole (background blank control
Hole), the control cell hole (sample controls hole) without drug-treated, without drug-treated for the cell hole that subsequently cracks
(cell maximum enzyme activity control wells), and the cell hole (drug-treated sample well) of drug-treated, (add including model group
Enter 30 μm of ol/L A β25-35) and experimental group (30 μm of ol/L A β of addition25-35With the schisandra fruit decoction of various concentrations), every group three
Hole, handle 24 hours, to predetermined detection time point before 1 hour, Tissue Culture Plate is taken out from cell culture incubator, in " sample
20 μ L LDH releasing agents are added in maximum enzyme activity control wells ", blows and beats and mixes for several times repeatedly, then incubated in cell culture incubator
Educate.After reaching the scheduled time, Tissue Culture Plate is centrifuged into 5min with porous plate centrifuge 400g.The supernatant in each hole is taken respectively
120 μ L, it is added in 96 new orifice plate respective apertures, carries out sample detection immediately.Sample detection is as follows：60 are separately added into each hole
μ L LDH detect working solution；Mixing, room temperature (about 25 DEG C) lucifuge is incubated 30min, and absorbance is then determined at 490nm, with
600nm wavelength carries out dual wavelength measure as reference wavelength.Cell mortality %=(processing sample absorbance-sample controls
Hole)/(absorbance of cell maximum enzyme activity-sample controls hole absorbance) × 100.Experimental result shows, A β25-35Cause cell
The LDH rises of release, cause cell death to be increased, and after adding fruit of Chinese magnoliavine decocting, the LDH discharged into the cell is substantially reduced, carefully
Born of the same parents' death rate reduces, and illustrates that schisandra fruit decoction can suppress by A β25-35Caused cell death, further prove fruit of Chinese magnoliavine decocting
Liquid energy generates HSP70 heat shock proteins, mitigates A β with this by activating HSP70 promoters25-35Caused cytotoxic is made
With (* represents to compare P with 0 μ g/ml groups as shown in Figure 7<0.05, * * represents to compare P with 0 μ g/ml groups<0.01).
In summary, schisandra fruit decoction can generate HSP70 heat shock proteins, reduce by activating HSP70 promoters
PC12 cell deaths caused by A β, the release of the intracellular lactic dehydrogenases of PC12 caused by A β is reduced, so as to illustrate fruit of Chinese magnoliavine water
Decocting liquid can suppress neurotoxicity caused by A β, have certain anti-AD potentiality.
Claims (8)
1. application of the Schisandra chinens P.E in HSP70 activator is prepared.
2. application of the Schisandra chinens P.E as claimed in claim 1 in HSP70 activator is prepared, it is characterised in that described
HSP70 activator is so as to activating HSP70 by activating HSP70 promoters.
3. Schisandra chinens P.E is preparing the application in activating HSP70 medicines.
4. Schisandra chinens P.E as claimed in claim 3 is preparing the application in activating HSP70 medicines, it is characterised in that：Swash
HSP70 medicines living are so as to activating HSP70 by activating HSP70 promoters.
5. Schisandra chinens P.E as claimed in claim 4 is preparing the application in activating HSP70 medicines, it is characterised in that institute
The activation HSP70 medicines stated are nerve degenerative diseases medicine, cardiovascular disease medicine.
6. Schisandra chinens P.E as claimed in claim 5 is preparing the application in activating HSP70 medicines, it is characterised in that institute
The nerve degenerative diseases stated are alzheimer, parkinsonism, ALS.
7. application of the Schisandra chinens P.E in activation HSP70 medicines are prepared as described in claim 3-6, its feature exist
In the Schisandra chinens P.E is schisandra fruit decoction.
8. Schisandra chinens P.E as claimed in claim 7 is preparing the application in activating HSP70 medicines, it is characterised in that institute
Schisandra fruit decoction is stated to prepare by following methods：Schisandra chinensis medicinal material is weighed, adds distilled water immersion, is decocted after boiling；Yarn
Cloth filters to take filtrate, and filter residue soaks after adding distilled water, is decocted after boiling；Merge filtrate twice after filtered through gauze, concentrate；Treat nature
Centrifuged after cooling, with filter paper filtering and impurity removing, constant volume, schisandra fruit decoction is made.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710277801.6A CN107519291A (en) | 2017-04-25 | 2017-04-25 | Schisandra chinens P.E is preparing the application in activating HSP70 medicines |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710277801.6A CN107519291A (en) | 2017-04-25 | 2017-04-25 | Schisandra chinens P.E is preparing the application in activating HSP70 medicines |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107519291A true CN107519291A (en) | 2017-12-29 |
Family
ID=60748673
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710277801.6A Pending CN107519291A (en) | 2017-04-25 | 2017-04-25 | Schisandra chinens P.E is preparing the application in activating HSP70 medicines |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107519291A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109293621A (en) * | 2018-11-21 | 2019-02-01 | 兰州大学 | A kind of Rhizoma valerianae latifoliae extract monomeric compound and its application in treatment Alzheimer disease drug |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080167372A1 (en) * | 2005-07-22 | 2008-07-10 | The Hong Kong University Of Science And Technology | Schisandrin b preparation |
| CN107693615A (en) * | 2017-11-09 | 2018-02-16 | 黑龙江中医药大学 | A kind of Chinese medical extract for treating senile dementia and preparation method thereof |
-
2017
- 2017-04-25 CN CN201710277801.6A patent/CN107519291A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080167372A1 (en) * | 2005-07-22 | 2008-07-10 | The Hong Kong University Of Science And Technology | Schisandrin b preparation |
| CN107693615A (en) * | 2017-11-09 | 2018-02-16 | 黑龙江中医药大学 | A kind of Chinese medical extract for treating senile dementia and preparation method thereof |
Non-Patent Citations (7)
| Title |
|---|
| LIBO LI，等: ""Schisandrin B attenuates acetaminophen-induced hepatic injury through heat-shock protein 27 and 70 in mice"", 《J GASTROENTEROL HEPATOL》 * |
| 严明敏，等: ""五味子乙素对Aβ25-35诱导PC12细胞损伤的保护作用"", 《卒中与神经疾病》 * |
| 余文雯，等: ""热休克蛋白70对神经炎症的调节作用"", 《药学学报》 * |
| 王亚军: ""基于热休克蛋白HSP70启动子筛选抗AD中药研究"", 《中国优秀硕士学位论文全文数据库 医药卫生科技辑》 * |
| 董霞，等: ""人工胃液酶解对五味子乙素溶出率的影响"", 《儿科药学杂志》 * |
| 鲍娟，等: ""热休克蛋白70在阿尔茨海默病中作用的研究进展"", 《国际神经病学神经外科杂志》 * |
| 鲍宏刚，等: ""热休克蛋白70在心血管疾病中的保护作用"", 《现代生物医学进展》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109293621A (en) * | 2018-11-21 | 2019-02-01 | 兰州大学 | A kind of Rhizoma valerianae latifoliae extract monomeric compound and its application in treatment Alzheimer disease drug |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Moens et al. | Oncogenic potentials of the human polyomavirus regulatory proteins | |
| Harsh et al. | Zika virus non-structural protein NS4A restricts eye growth in Drosophila through regulation of JAK/STAT signaling | |
| CN111904958B (en) | Application of UMI-77 as mitophagy inducer in preparing medicine for treating inflammation and neurodegenerative disease | |
| CN107519323A (en) | Rhizoma valerianae latifoliae extract is preparing the application in activating HSP70 medicines | |
| CN107519291A (en) | Schisandra chinens P.E is preparing the application in activating HSP70 medicines | |
| CN105624162B (en) | For the siRNA of mammal R-Spondin2 gene targets, ShorthairpinRNA and carrier and application | |
| CN107519239A (en) | Baical Skullcap root P.E is preparing the application in activating HSP70 medicines | |
| CN107519339A (en) | Rhizoma Acori Graminei extract is preparing the application in activating HSP70 medicines | |
| CN105018525B (en) | Carry HPV 16 saltant type E7m91The recombined glandulae correlation viral vectors and its construction method of antigen gene and application | |
| NL2030433B1 (en) | Shrna lentivirus for inhibiting the expression of long non-coding rna malat1 and use thereof | |
| CN105177048B (en) | Carry HPV 16 multipoint mutation type E7mmThe recombined glandulae correlation viral vectors and its construction method of antigen gene and application | |
| CN107619434A (en) | Polypeptide Z2 and its purposes in the peptide inhibitor for preparing zika virus infection | |
| CN101117635B (en) | Fusion expression of PTD,HIF ODD and tumour inhibitory gene and uses thereof | |
| CN110092823B (en) | Separated carp antiviral protein Pdcd6ip and antiviral activity | |
| CN106148520A (en) | MACF1 gene and expression product application in preparation diagnosis and treatment osteoporosis agents thereof | |
| CN106282240A (en) | Build the method that stability and high efficiency expresses the rat bone marrow mesenchymal stem cells cell strain of c met albumen | |
| CN101787359B (en) | Recombinant lentivirus for carrying out targeted induction on osteogenic differentiated cell apoptosis as well as preparation method and application thereof | |
| CN105925576B (en) | SiRNA, ShorthairpinRNA and carrier and application for mammal R Spondin3 gene targets | |
| CN105177047B (en) | Carry HPV 16 saltant type E7m94The recombined glandulae correlation viral vectors and its construction method of antigen gene and application | |
| CN105316361B (en) | Carry HPV 16 saltant type E7m58The recombined glandulae correlation viral vectors and its construction method of antigen gene and application | |
| CN109402117A (en) | A kind of adeno-associated virus and its preparation method and application of silencing mouse intestinal RASGRP1 expression | |
| CN109381700A (en) | A kind of promotion localized warmth cure treatment efficient drug target of HPV infection | |
| CN103667431B (en) | A kind of purposes and its related drugs of people CCCH types zinc finger protein expressing gene | |
| CN111840327B (en) | Mesenchymal stem cell preparation for treating diabetic foot and application thereof | |
| CN107828819B (en) | Method for constructing recombinant adenovirus by using ANP or IgANP gene, recombinant adenovirus and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20171229 |