CN107488223A - One grows tobacco nicotine content controlling gene Ribosomal L4/L1 and its cloning process and application - Google Patents

One grows tobacco nicotine content controlling gene Ribosomal L4/L1 and its cloning process and application Download PDF

Info

Publication number
CN107488223A
CN107488223A CN201710803440.4A CN201710803440A CN107488223A CN 107488223 A CN107488223 A CN 107488223A CN 201710803440 A CN201710803440 A CN 201710803440A CN 107488223 A CN107488223 A CN 107488223A
Authority
CN
China
Prior art keywords
ribosomal
tobacco
gene
nicotine content
controlling gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710803440.4A
Other languages
Chinese (zh)
Other versions
CN107488223B (en
Inventor
白戈
逄涛
谢贺
杨大海
李勇
姚恒
李永平
肖炳光
张谊寒
陈学军
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yunnan Academy of Tobacco Agricultural Sciences
Original Assignee
Yunnan Academy of Tobacco Agricultural Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yunnan Academy of Tobacco Agricultural Sciences filed Critical Yunnan Academy of Tobacco Agricultural Sciences
Priority to CN201710803440.4A priority Critical patent/CN107488223B/en
Publication of CN107488223A publication Critical patent/CN107488223A/en
Application granted granted Critical
Publication of CN107488223B publication Critical patent/CN107488223B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1096—Processes for the isolation, preparation or purification of DNA or RNA cDNA Synthesis; Subtracted cDNA library construction, e.g. RT, RT-PCR
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Nutrition Science (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Virology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

Grown tobacco nicotine content controlling gene the invention discloses oneRibosomal L4/L1, a kind of polypeptide of regulation and control tobacco nicotine content of gene code, the amino acid sequence that the polypeptide includes such as SEQ ID：Shown in No.2；The tobacco nicotine content controlling geneRibosomal L4/L1Comprising nucleotide sequence such as SEQ ID：The invention also discloses the controlling gene shown in No.1Ribosomal L4/L1Cloning process and its application.Suppress in tobacco plantRibosomal L4/L1The expression of gene, the content of nicotine in tobacco leaf can be substantially reduced, gathers around and has broad application prospects in actual production.

Description

One grows tobacco nicotine content controlling gene Ribosomal L4/L1 and its clone side Method and application
Technical field
The invention belongs to genetic engineering technology field, further belongs to the synthesis for being related to tobacco nicotine and regulation and control dependency basis Cause a, and in particular to controlling gene for growing tobacco nicotine contentRibosomal L4/L1And its cloning process and application.
Background technology
The metabolic regulation of research tobacco nicotine is a significantly job, can be provided not by gene regulation With the tobacco bred of nicotine content, raw material are provided for tobacco commodity production personalization nicotine tobacco product.Nicotine pair Human body has very strong physiological stimulation effect, is the material base that tobacco commerciality uses.Many top tobacco companies of the world such as phenanthrene The company such as Li Pumolisi, empire tobacco, Japan Tobacco, BAT all put into huge fund to the metabolic pathway of tobacco nicotine, Regulatory mechanism is studied.
Nicotine is a kind of pyridine alkaloid, be primarily present in Solanaceae Nicotiana (Nicotiana) it is tobacco in plant A kind of internal important secondary metabolite.The synthesis and transhipment of tobacco nicotine are regulated and controled by Multiple factors, at present Through differentiating and cloning the key gene come in some nicotine route of synthesis, such asQPT、PMT、MPO、JAZ、MYC2aDeng.
Metabolic pathway of synthesizing research from molecular biology angle to nicotine is not yet completely thorough.Pass through chloride channel Regulate and control nicotine synthetic gene, report is had no so as to influence the research of nicotine content.Nicotine controlling gene is for tobacconist Industry production is most important, and current most nicotine synthetic gene Patents are all rested in foreign tobacco company hand.Cause This, research nicotine route of synthesis related regulatory genes, which improve nicotine content in tobacco product to Chinese tobacco enterprise, has weight Want meaning.
The content of the invention
The first object of the present invention is to provide one and grown tobacco nicotine content controlling geneRibosomal L4/L1, institute State a kind of polypeptide of regulation and control tobacco nicotine content of gene code, the amino acid sequence that the polypeptide includes such as SEQ ID：No.2 It is shown.
The second object of the present invention is to provide the tobacco nicotine content controlling geneRibosomal L4/L1Comprising Nucleotide sequence, the nucleotide sequence such as SEQ ID：Shown in No.1.
The third object of the present invention is to provide a kind of tobacco nicotine content controlling geneRibosomal L4/L1 Cloning process, comprise the following steps：
（1）Tobacco leaf cDNA is synthesized：Tobacco RNA is extracted, reverse transcription obtains the first chain cDNA；
（2）Ribosomal L4/L1The PCR amplifications of gene：Using tobacco leaf cDNA as template, according toRibosomal L4/L1 Gene order designs primer, enters performing PCR amplification, recovery and purifying pcr amplification product, and be sequenced.
The fourth object of the present invention is to provide a kind of tobacco nicotine content controlling geneRibosomal L4/L1 Application, i.e., in tobacco plant body suppress described inRibosomal L4/L1The expression of gene, Nicotine in Tobacco can be reduced Content.
The fifth object of the present invention is to provide a kind of tobacco nicotine content controlling geneRibosomal L4/L1 Recombinant vector.
The sixth object of the present invention is to provide a kind of tobacco nicotine content controlling geneRibosomal L4/L1 Expression cassette.
The seventh object of the present invention is to provide a kind of tobacco nicotine content controlling geneRibosomal L4/L1 Transgenic cell line.
The eigth object of the present invention is to provide a kind of tobacco nicotine content controlling geneRibosomal L4/L1 Recombinant bacterium.
Brief description of the drawings
Fig. 1Ribosomal L4/L1PCR primer electrophoretogram；
In figure, M- molecular weight markers；1- PCR primers；
Fig. 2 intermediate carriers pdonr-zeo schemes；
Fig. 3Ribosomal L4/L1Gene plant RNAi interference carriers pHellsgate12 schemes；
Fig. 4 turnsRibosomal L4/L1The tobacco line gene expression dose block diagram of gene RNAi interference carrier；
In figure, K326- wild type controls；RNAi-1 and RNAi-1 is transgenosis cigarette strain；
Fig. 5Ribosomal L4/L1Gene RNAi disturbs the nicotine content of tobacco plant；
In figure, K326- wild type controls；RNAi-1 and RNAi-1 is transgenosis cigarette strain.
Embodiment
The present invention is further illustrated below in conjunction with the accompanying drawings, but the present invention is not any limitation as in any way, base In present invention teach that any conversion or replacement done, belong to protection scope of the present invention.
Tobacco nicotine content controlling gene of the present inventionRibosomal L4/L1A kind of regulation and control tobacco Buddhist nun of coding is ancient The polypeptide of fourth content, the amino acid sequence that the polypeptide includes such as SEQ ID：Shown in No.2.The polypeptide is also possible to as by SEQ ID No：Amino acid sequence shown in 2 shape by the substitution of one or several amino acid residues and/or missing and/or addition Into, and with the derivative polypeptide of regulation and control tobacco nicotine content.The substitution of one or several amino acid residues and/or missing And/or addition refers to substitution and/or missing and/or addition no more than 10 amino acid residues.
Tobacco nicotine content controlling gene of the present inventionRibosomal L4/L1Comprising nucleotide sequence such as SEQ ID：Shown in No.1.Or can be with SEQ ID No in sequence table under high high stringency conditions：The nucleosides of the 1 DNA sequence dna hybridization limited Acid sequence；Or with SEQ ID No in sequence table：1 DNA sequence dna limited has more than 70% homology, and encodes identical work( Can protein DNA sequence.
Tobacco nicotine content controlling gene of the present inventionRibosomal L4/L1Cloning process include following step Suddenly：
（1）Tobacco leaf cDNA is synthesized：Tobacco RNA is extracted, reverse transcription obtains the first chain cDNA；
（2）Ribosomal L4/L1The PCR amplifications of gene：Using tobacco leaf cDNA as template, according toRibosomal L4/L1 Gene order designs primer, enters performing PCR amplification, recovery and purifying pcr amplification product and is sequenced.
Preferably, the primer is one kind as the present invention：
Forward primer：5’- CCGCTGCCGCCATTCCCACCACCACCGTTC -3’
Reverse primer：5’- GTGAAACAGCTCGTCCGGTACCCCATG -3’.
Tobacco nicotine content controlling gene of the present inventionRibosomal L4/L1Application be in tobacco plant body Described in suppressionRibosomal L4/L1The expression of gene, the content of Nicotine in Tobacco can be reduced.Can be by being mediated by RNA A variety of methods suppressRibosomal L4/L1The expression of gene, such as：The method of plant viral vector mediated gene silencing, agriculture bar The methods of bacterium mediated transformation RNAi interference carriers, optimization modification gene code are rectified, optimization gene promoter.Suppression of the present invention The method of gene expression processed is not limited to above-mentioned several method, as long as can suppressRibosomal L4/L1Expression.
The present invention'sRibosomal L4/L1Gene is when being building up in plant expression vector, in its transcription initiation nucleosides Any enhancing promoter or inducible promoter can be added before acid.For the ease of to transgenic plant cells or plant progress Identify and screen, used carrier can be processed, marked as added plant alternative (GUSGene, luciferase base Because etc.) or resistant antibiotic marker (gentamicin, kanamycins etc.).The plant host being converted both can be single Cotyledon plant or dicotyledon, such as：Tobacco, rice, wheat, corn, cucumber, tomato, willow, turfgrass or lucerne Mu etc..Carry the present inventionRibosomal L4/L1The expression vector of gene can be by using Ti-plasmids, Ri plasmids, phytopathy The conventional biology methods such as poisonous carrier, directly delivered DNA, microinjection, conductance, agriculture bacillus mediated convert plant cell or group Knit, and by the plant of conversion through tissue cultivating into plant.
Containing of the present inventionRibosomal L4/L1The recombinant vector of gene, expression cassette, transgenic cell line and again The gene engineering products such as group bacterium belong to protection scope of the present invention.
The tobacco nicotine regulation and control GAP-associated protein GAP and its encoding gene of the present invention is that crops especially tobacco nicotine contains Measure the support that breeding provides gene and technology.
In the present invention, suppress tobacco endogenous gene in tobacco plantRibosomal L4/L1Expression, tobacco smoke can be made The nicotine content of leaf substantially reduces, and is had broad application prospects in plant nicotine breeding field, its economic efficient latent It is huge.
Below in conjunction with specific embodiment, the present invention is further detailed.
All plant tissue materials are derived from flue-cured tobacco in embodiment（Nicotiania tabacum) kind ' K326 ' and RNAi is disturbedRibosomal L4/L1The K326 transfer-gen plants of gene expression.The growth and development stage of tobacco plant is all In in the controlled environment chamber, and growth temperature is kept between 22-25 DEG C, to reduce outside environmental elements as far as possible to tobacco nicotine Influence in building-up process.The tobacco-containing material that experiment is chosen is prosperous long-term, develops non-transgenic cigarette strain similar in phenotype and turns base Because of cigarette strain.Take the top, middle part and lower blade of non-transgenic cigarette strain and transgenosis cigarette strain.For another group, turn base to non- Because cigarette strain and transgenosis cigarette strain carry out topping treatment, then take the top of non-transgenic cigarette strain and transgenosis cigarette strain, middle part and Lower blade.These tobacco-containing materials are finished to carry out nicotine content inspection.
Embodiment 1：CloneRibosomal L4/L1Gene
Using tobacco leaf cDNA as template, primer is designed according to tobacco gene group database information, carried outRibosomal L4/L1 The PCR amplifications of gene, obtain pcr amplification product.It is as follows to design primer：
Forward primer：5’- CCGCTGCCGCCATTCCCACCACCACCGTTC -3’；
Reverse primer：5’- GTGAAACAGCTCGTCCGGTACCCCATG -3’.
PCR reaction systems and amplification condition are as shown in table 1.
The PCR reaction systems of table 1 and condition
Agarose gel electrophoresis of the PCR primer obtained 0.8% will be expanded, Gel electrophoresis results are as shown in Figure 1.Electrophoresis terminates Afterwards, using Qiagen companies PCR primer purification kit, according to the PCR primer described in description of product recovery purifying, and send Invitrogen is sequenced, and verifies sequence results.
Embodiment 2:The structure of plant RNA i carriers
With in embodiment 1Ribosomal L4/L1Full length fragment is template, is carried out with the primer containing gateway joint sequences PCR is expanded, and amplified production after purification, invitrogen companies pdonr-zeo carriers is inserted into by BP reactions through PCR primer （Fig. 2）In.The BP reaction carriers built are reacted by LR willRibosomal L4/L1PHellsgate12 is arrived in fragment displacement RNAi interference carriers（Fig. 3）In.
（1）Gateway reaction primer sequences are as follows：
Ribosomal L4/L1_F：5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGGAGGAGCCAACTCGATTA GTAG -3’；
Ribosomal L4/L1_R：5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGTTCCCCTTTTTACCGCTT TTTG-3’。
（2）PCR reactions enter performing PCR clone using Phusion exo+ polymerases.
PCR reaction systems and condition are same as Example 1.
（3）BP reacts：
（a）Prepare 8 μ L reaction system in 200 μ L centrifuge tubes, including：1-7 μ L attB-PCR products（About 15 ~ 150 ng, the ng/ μ L of mass concentration >=10）, the ng/ μ L of 1 μ L 150 pdonr-zeo carriers and appropriate TE buffer solutions（pH 8.0）, mix at room temperature；
（b）BP Clonase II enzymatic mixtures are stood to 2 min thawings on ice, gently shaken 2 times, are mixed stand-by；
（c）To（1）2 μ L BP Clonase II enzymatic mixtures are added in the sample of preparation, lightly mix system；
（d）BP Clonase II enzymatic mixtures are put back into -20 °C or -80 °C preservations；
（e）Reaction system is placed on 25 °C of h of warm bath 1；
（f）1 μ L Proteinase K Solution is added into reaction system, is gently shaken, sample is then placed on 37 °C of warm bath 10 Min, to terminate BP reactions；
（g）After mixed liquor is converted into Escherichia coli, transformed bacteria solution is taken to be coated on the LB flat boards of the resistance containing Zeacin, picking colony is extremely Bacterium culture is shaken in culture medium solution containing corresponding antibiotic, the pDONR-Zeocin plasmids of positive colony are extracted after confirmation（Fig. 2）It is standby With.
（4）LR reacts：
（a）Prepare 8 μ L reactant in 200 μ L centrifuge tubes, including：The pDONR-Zeocin plasmids of 1-7 μ L acquisition （50-150 ng）, 1 μ L150 ng/ μ L purpose carrier and appropriate TE buffer solutions（pH 8.0）, mix at room temperature；
（b）LR Clonase II enzymatic mixtures are rested on into 2 min thawings on ice, gently shake 2 times to mix；
（c）2 μ L LR Clonase II enzymatic mixtures are added, gently shakes and mixes system；
（d）LR Clonase II enzymatic mixtures are put back into -20 DEG C or -80 DEG C of refrigerators preserve；
（e）Reaction system is placed on 25 DEG C of warm bath and reacts 1 h；
（f）1 μ L Proteinase K Solution is added into reaction system to terminate LR reactions, after gently shaking, sample is placed on 37 DEG C stand 10 min；Obtain pHellsgate12 RNAi interference carriers。
Embodiment 3：The identification of agriculture bacillus mediated Transformation of tobacco and transfer-gen plant
（1）Freeze-thaw method converts Agrobacterium
By 1 μ g（200 ng/μL）PB2GW7 recombinant vectors are added in 100 μ L competence Agrobacterium LBA4404s, after mixing 5 min are stood on ice, is put into liquid nitrogen and freezes 5 min, then taken out from liquid nitrogen, are put into the min of water-bath 5 in 37 DEG C of water-baths, After standing 5 min on ice again, 500 μ L LB solution are added, the h of renewal cultivation 4 under the conditions of 28 DEG C, fully shaking, finally will Bacterium solution is uniformly applied on selective plating medium, and 48 h are cultivated at 28 DEG C.
(2) leaf disk method transformation of tobacco kind K326.
Specific method is as follows:
(a) under aseptic condition, tobacco K326 seeds is put into EP pipes and use aseptic water washing 2-3 times；
(b) 30-60 s are soaked in 75% alcohol；
(c) 5min is handled with 0.1% mercuric chloride again, finally with aseptic water washing 5 times；
(d) it is seeded on MS culture mediums, cultivates in Yunnan tobacco academy of agricultural science tissue culture room, the d of light culture 4, 25 DEG C of illumination cultivation 20-30 d.
(e) when tobacco seedling length is to 3-5cm（20-30d）, take terminal bud to be put in the mg/L of MS+BA 0.2（Strong bud, makes its fast Short-term training is long）On culture medium, squamous subculture.
(f) squamous subculture is after 14 days（There are vanelets）, blade is taken, size 1cm × 1cm, cuts petiole, blade table Face and leaf edge torn, it is put on MS+ BA1.0mg/L pH 6.0-6.5 precultivation medium, face down is close to cultivate Base is placed, the preculture 2-3 d under dark condition.
(g) blade or stem section of preculture are then taken out, Agrobacterium is put into and infects in liquid and infected.Infect the previous day At night, 2 bottles of bacterium Agrobacterium is shaken.2 mL centrifuge tubes are filled into bacterium solution, 4000 r/min centrifugation 5min, cleaned twice with outstanding bacterium solution. With 1:10 ratios（10 mL, which hang bacterium solution, puts the mL thalline of 1 pipe 1.5）Outstanding bacterium solution is put into, adds the mg/L of As 25（Add 40 μ in 40 mL L As）Constantly rock and infect liquid, it is fully contacted with blade and stem section incision, after 10 min, take out, be put in sterilized Bacterium solution is blotted on dry filter paper.
Wherein, Agrobacterium infect liquid preparation method it is as follows：
1) Agrobacterium being converted for taking -80 DEG C of refrigerators to preserve, flat board culture is drawn, 50mg/L is added in LB solid plates Spec and 50mg/L Rif；
2) picking single bacterium spot is put into 28 in shaking table into spec containing 50mg/L and 50mg/L Rif 5mL LB fluid nutrient mediums DEG C, 200 r/min overnight incubations（12-16h）；
3) strain is preserved, 750 μ L bacterium solutions add the sterilized μ L of glycerine 250, and -80 DEG C of refrigerators save backup.
4) bacterium is shaken, the mL of LB fluid nutrient mediums 10 adds spec（Required concentration 50mg/L）10 μL、Rif（Required concentration 50mg/L）10 μ L and bacterium solution 10 μ L, 28 DEG C, 200r/min is incubated overnight（12-16h）.
5) when bacterial concentration reaches OD600When=1.5 or so, 2mL bacterium solutions are taken to be added in centrifuge tube, 4000r/min centrifugations 5min；
6) supernatant is outwelled, inhales the new MS fluid nutrient mediums of 1mL, Agrobacterium, 4000 r/min centrifugations 5min is resuspended.
7) repeat step（6）1 time；
8) after bacterium being resuspended with 1mL MS fluid nutrient mediums, in the fluid nutrient medium for the MS for being then added to 40mL（Containing 40 μ L 25mg/L As）, as infect liquid.More than 2h is placed, then is infected.
200 mL hang being formulated as follows for bacterium solution：
The mL of 20 × a great number of elements 10
200 × organic element 1ml
200 × molysite 1mL
200 × micro- 1mL
Sucrose 5.6g
(h) blade and stem section are put back on pre-culture medium, co-cultured 2-3 days under 28 DEG C of dark conditions, to around paddle cutout There is germ spot to be formed；
(i) bacterium is washed, takes out the tobacco leaf and stem section of co-cultivation, with 500 mg/L Cef of addition aseptic water washing 5 times, the Once be positioned over shaking table and shake 30 min, behind 5 min every time, to wash away the Agrobacterium on explant surface；
(j) take out after, blotted with filter paper, be transferred to tobacco and lure on bud culture medium, lure bud culture medium for MS+ BA 1.0mg/L+ Hyg 25mg/L + Cef 500 mg/L pH 5.8；Spend 2 weeks and observe, if it find that not long bacterium, then reduce Cef concentration.If Long bacterium, then continue to keep Cef concentration.
(k) 1 subculture is changed within every 2 weeks, until growing adventitious bud（Ordinary circumstance is 2 weeks）.Cut the seedling of regeneration（1 Cm or so）, it is transferred to subculture medium MS+ BA 0.2-0.1mg/L+ Hyg 25mg/L+Cef 500mg/L pH 5.8；
(l) to seedling length to 2cm it is long when（There is budlet）, transfer on root media MS+ NAA 0.2-0.1mg/L, 24 1 DEG C of scholars, 12h illumination, 1500 lx are cultivated 3 weeks or so, grow sturdy root system.
(m) treat root growth to 2-3cm.During height of seedling 7-10cm or so, remove triangular flask wash away root culture medium, transplant in In flowerpot, hot-house culture.
（3）The transgenic line stablized
Using Qiagen companies DNA extraction kit, the genomic DNA of transgene tobacco seedling is extracted, designs Kan resistant genes Primer enters performing PCR amplification, screens positive plant, detects 25 plants of positive plants.
Kan resistant gene primers are
Kan F：TCTGGACGAAGAGCATCAGG
Kan R：ATGAATCCAGAAAAGCGGCC
WT lines are extracted according to method described in example 2 and 25 plants turnRibosomal L4/L1RNA
Gene T0 carries out Real time-PCR analyses, reference gene 26s, analyzes the tables of different strains for the total serum IgE of plant Up to situation.Choose 2 plants of minimum plant of expression quantity（Fig. 4）.Individual plant is collected seed and sowed respectively, with Kan antibiotic-screening Tl generations The separation situation of plant, so it is repeated up to the transgenic line of T3 generation acquisition inheritance stabilities.
Ribosomal L4/L1QRT-PCR primers are：
Ribosomal L4/L1_qRT_F：5’- AGGTCCAGTCTGTTGTGAGG-3’；
Ribosomal L4/L1_qRT_R：5’- TTTGCCTTAACCCGTTGAGC-3’.
26s reference gene primers are：
26s_F：5’-GAAGAAGGTCCCAAGGGTTC-3’；
26s_R：5’-TCTCCCTTTAACACCAACGG-3’.
Embodiment 4：Determine nicotine content in tobacco leaf
The nicotine content of tobacco-containing material in establishing criteria YC/T 160-2002 detections.The tobacco-containing material of selection is prosperous long-term, hair Non-transgenic cigarette strain similar in phenotype and transgenosis cigarette strain are educated for process object, using wild-type tobacco K326 as control.Take 5 plants it is non- The top of transgenosis cigarette strain and transgenosis cigarette strain, middle part and lower blade.For another group, to 5 plants of non-transgenic cigarette strains and turn Gene cigarette strain carries out topping treatment, then takes the top, middle part and lower blade of non-transgenic cigarette strain and transgenosis cigarette strain.
With 5% acetic acid aqueous solution extracted tobacco sample, the total alkaloid in extract（In terms of nicotine）With p-aminophenyl sulphur Acid and cyanogen chloride reaction, cyanogen chloride react generation online by potassium cyanide and toluene-sodium-sulfonchloramide.Reaction product colorimeter is surveyed in 460nm It is fixed.
Key instrument equipment：Continuous Flow Analysis instrument (U.S. API) (German SEAL AA3) (French ALLIANCE).
Configure reagent：
The solution of Brij 35（Polyethoxy bay ether）：In water plus 5 drip 22% Brij35, stir.
Cushioning liquid A：Weigh 2.35g sodium chloride (NaCl), 7.60g Boratexes (Na2B4O3·10H2O), dissolved with water, Then it is transferred in 1L volumetric flasks, 1 mL Brij 35 is added, with distilled water diluting to 1L.Filtered using preceding with qualitative filter paper.
Cushioning liquid B：Claim 26g disodium hydrogen phosphates (Na2HPO4), 10.4g citric acids [COH (COOH) (CH2COOH)2· H2O], 7g p-aminobenzene sulfonic acid (NH2C6H4SO3H), dissolved, be then transferred in 1L volumetric flasks with water, add 1 mL Brij 35, With distilled water diluting to 1L.Filtered using preceding with qualitative filter paper.
Toluene-sodium-sulfonchloramide solution（The chloro- 4- methyl benzenesulfonamide sodium salts of N-）[CH3C6H4SO2N（Na）Cl·3H2O]：Take 8.65g chloramines T, it is soluble in water, then it is transferred in 500mL volumetric flask, scale is settled to water.Filtered using preceding with qualitative filter paper.
0.22 mol/L NaOH buffer solutions：NaOH 8.8g, Na2HPO426.0g C6H8O7•H2O (Citric Acid Mono) 10.4g, dissolved with water and be settled to 1000mL.
P-aminobenzene sulfonic acid buffer solution：Weigh C6H7NO3S (p-aminobenzene sulfonic acid) 7g, Na2HPO426.0g C6H8O7• H2O (Citric Acid Mono) 10.4g, is dissolved with water and is settled to 1000mL.
Toluene-sodium-sulfonchloramide：Toluene-sodium-sulfonchloramide 1.2g is weighed, 100mL is settled to pure water dissolving, is preserved with brown reagent bottle.
Potassium cyanide：KCN 0.4g, 100mL is settled to pure water dissolving.
NaCO3 Solution：10 g NaCO3, distilled water dissolves and is settled to 1000mL.
Analytical procedure：0.3g cigarettes sample is weighed in 150mL triangular flasks or plastic bottle（It is accurate to 0.0001g）；Add 50 mL 5% acetic acid solution covers plug；The oscillation extraction 30min on common shaking table, rotating speed control 170 r/min, filtered with filter paper Machine.（As sample liquid concentration exceed working stamndard liquid concentration range, then should dilute）.
As a result calculating and statement：
The content of total alkaloid in terms of butt, is drawn by formula below：
In formula：
The Instrument observation value of C --- sample liquid total alkaloid, unit mg/mL;
The volume of V --- extract, unit mL；
The quality of m --- sample, unit mg；
The moisture of W --- sample, unit %.
As a result average value to determine twice is accurate to 0.01% as measurement result.
Result of the test shows：Test result indicates that the nicotine content of RNAi-1 and RNAi-2 topping upper leafs is about non-turn The half of gene cigarette strain, and the nicotine content of RNAi-1 and RNAi-2 topping inferior leads is about 75% compareed（Fig. 5）.Topping The upper, middle and lower portion tobacco leaf nicotine content of cigarette strain all shows significantly to reduce.ExplanationRibosomal L4/L1Gene being capable of shadow Ring tobacco nicotine content after pinching.
Sequence table
<110>Yunnan Academy of Tobacco Agricultural Science
<120>One grows tobacco nicotine content controlling gene Ribosomal L4/L1 and its cloning process and application
<130> 2017
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 6090
<212> DNA
<213> Nicotiana sp.
<400> 1
atggctaccg ctgccgccat tcccaccacc accgttcaag ccctagaaaa tgacatggct 60
actgacggcg ccgtccctct ccccgccgtc atgaaagctc cgatccgtcc cgacgttgta 120
acctacgtcc actccaacat ttccaaaaac gcccgtcaac cttatgctgt atcaaaaaaa 180
gccggccacc aaacctcagc tgagtcatgg ggtaccggac gagctgtttc acgtattccc 240
cgtgttcccg gtggtggtac ccaccgcgcc ggtcaagctg ctttcggtaa catgtgtcgt 300
ggtggtcgaa tgtttgctcc gacgaagatc tggcgccgat ggcaccgtaa gattcccgtg 360
aaccaaaaac gatatgccgt tgcttcagct atcgccgctt cttcagttcc atcccttgtc 420
ctcgcacgtg gccatcgtat cgagaccgtc cccgagcttc ctctcgttgt ttctgattcg 480
atcgaaggga ttgaaaagac taacaacgct atcaaggctt tgaagcaagt cggcgcttat 540
ccagatgctg aaaaggctaa ggacagtcac gctattcgtc ccggaaaggg aaaaatgcgt 600
aaccgtcgct acatttcccg caaaggccca ctgattgtgt acggaacaga aggtgcaaag 660
ctcgtgaaag cttttaggaa cattcccggt gttgaaattt gccacgtgga tcgattgaac 720
ttactcaagc ttgctccagg tggtcactta ggaaggtttg ttatttggac taaatcggct 780
tatgagaaat tagattcgat ttatggatca ttcgataagc cttcggagaa aaagaagggg 840
tatttattgc caaggcccaa aatggttaat gctgatttgg ctagaattat aaactcggat 900
gaggtccagt ctgttgtgag gccgattaag aaggatgtta ataagagggc tacgttgaag 960
aagaatccat tgaagaaccc gaatgtgtta ctgaagctca atccttatgc taagactgct 1020
aggaggatgt cgcttttggc cgaggctcaa cgggttaagg caaagaaaga gaagctagac 1080
aagaagaggc atcaaattac aaaggaggag gcatccgcta tcaggtctgc aagccattcg 1140
tggtacaaga caatgatctc agattccgac tatgcagagt tcgacaactt cacaaagtgg 1200
cttggagttt ctcagtgaat ggctaccgct gccgccattc ccaccaccac cgttcaagcc 1260
ctagaaaatg acatggctac tgacggcgcc gtccctctcc ccgccgtcat gaaagctccg 1320
atccgtcccg acgttgtaac ctacgtccac tccaacattt ccaaaaacgc ccgtcaacct 1380
tatgctgtat caaaaaaagc cggccaccaa acctcagctg agtcatgggg taccggacga 1440
gctgtttcac gtattccccg tgttcccggt ggtggtaccc accgcgccgg tcaagctgct 1500
ttcggtaaca tgtgtcgtgg tggtcgaatg tttgctccga cgaagatctg gcgccgatgg 1560
caccgtaaga ttcccgtgaa ccaaaaacga tatgccgttg cttcagctat cgccgcttct 1620
tcagttccat cccttgtcct cgcacgtggc catcgtatcg agaccgtccc cgagcttcct 1680
ctcgttgttt ctgattcgat cgaagggatt gaaaagacta acaacgctat caaggctttg 1740
aagcaagtcg gcgcttatcc agatgctgaa aaggctaagg acagtcacgc tattcgtccc 1800
ggaaagggaa aaatgcgtaa ccgtcgctac atttcccgca aaggcccact gattgtgtac 1860
ggaacagaag gtgcaaagct cgtgaaagct tttaggaaca ttcccggtgt tgaaatttgc 1920
cacgtggatc gattgaactt actcaagctt gctccaggtg gtcacttagg aaggtttgtt 1980
atttggacta aatcggctta tgagaaatta gattcgattt atggatcatt cgataagcct 2040
tcggagaaaa agaaggggta tttattgcca aggcccaaaa tggttaatgc tgatttggct 2100
agaattataa actcggatga ggtccagtct gttgtgaggc cgattaagaa ggatgttaat 2160
aagagggcta cgttgaagaa gaatccattg aagaacccga atgtgttact gaagctcaat 2220
ccttatgcta agactgctag gaggatgtcg cttttggccg aggctcaacg ggttaaggca 2280
aagaaagaga agctagacaa gaagaggcat caaattacaa aggaggaggc atccgctatc 2340
aggtctgcaa gccattcgtg gtacaagaca atgatctcag attccgacta tgcagagttc 2400
gacaacttca caaagtggct tggagtttct cagtgaatgg ctaccgctgc cgccattccc 2460
accaccaccg ttcaagccct agaaaatgac atggctactg acggcgccgt ccctctcccc 2520
gccgtcatga aagctccgat ccgtcccgac gttgtaacct acgtccactc caacatttcc 2580
aaaaacgccc gtcaacctta tgctgtatca aaaaaagccg gccaccaaac ctcagctgag 2640
tcatggggta ccggacgagc tgtttcacgt attccccgtg ttcccggtgg tggtacccac 2700
cgcgccggtc aagctgcttt cggtaacatg tgtcgtggtg gtcgaatgtt tgctccgacg 2760
aagatctggc gccgatggca ccgtaagatt cccgtgaacc aaaaacgata tgccgttgct 2820
tcagctatcg ccgcttcttc agttccatcc cttgtcctcg cacgtggcca tcgtatcgag 2880
accgtccccg agcttcctct cgttgtttct gattcgatcg aagggattga aaagactaac 2940
aacgctatca aggctttgaa gcaagtcggc gcttatccag atgctgaaaa ggctaaggac 3000
agtcacgcta ttcgtcccgg aaagggaaaa atgcgtaacc gtcgctacat ttcccgcaaa 3060
ggcccactga ttgtgtacgg aacagaaggt gcaaagctcg tgaaagcttt taggaacatt 3120
cccggtgttg aaatttgcca cgtggatcga ttgaacttac tcaagcttgc tccaggtggt 3180
cacttaggaa ggtttgttat ttggactaaa tcggcttatg agaaattaga ttcgatttat 3240
ggatcattcg ataagccttc ggagaaaaag aaggggtatt tattgccaag gcccaaaatg 3300
gttaatgctg atttggctag aattataaac tcggatgagg tccagtctgt tgtgaggccg 3360
attaagaagg atgttaataa gagggctacg ttgaagaaga atccattgaa gaacccgaat 3420
gtgttactga agctcaatcc ttatgctaag actgctagga ggatgtcgct tttggccgag 3480
gctcaacggg ttaaggcaaa gaaagagaag ctagacaaga agaggcatca aattacaaag 3540
gaggaggcat ccgctatcag gtctgcaagc cattcgtggt acaagacaat gatctcagat 3600
tccgactatg cagagttcga caacttcaca aagtggcttg gagtttctca gtgaatggct 3660
accgctgccg ccattcccac caccaccgtt caagccctag aaaatgacat ggctactgac 3720
ggcgccgtcc ctctccccgc cgtcatgaaa gctccgatcc gtcccgacgt tgtaacctac 3780
gtccactcca acatttccaa aaacgcccgt caaccttatg ctgtatcaaa aaaagccggc 3840
caccaaacct cagctgagtc atggggtacc ggacgagctg tttcacgtat tccccgtgtt 3900
cccggtggtg gtacccaccg cgccggtcaa gctgctttcg gtaacatgtg tcgtggtggt 3960
cgaatgtttg ctccgacgaa gatctggcgc cgatggcacc gtaagattcc cgtgaaccaa 4020
aaacgatatg ccgttgcttc agctatcgcc gcttcttcag ttccatccct tgtcctcgca 4080
cgtggccatc gtatcgagac cgtccccgag cttcctctcg ttgtttctga ttcgatcgaa 4140
gggattgaaa agactaacaa cgctatcaag gctttgaagc aagtcggcgc ttatccagat 4200
gctgaaaagg ctaaggacag tcacgctatt cgtcccggaa agggaaaaat gcgtaaccgt 4260
cgctacattt cccgcaaagg cccactgatt gtgtacggaa cagaaggtgc aaagctcgtg 4320
aaagctttta ggaacattcc cggtgttgaa atttgccacg tggatcgatt gaacttactc 4380
aagcttgctc caggtggtca cttaggaagg tttgttattt ggactaaatc ggcttatgag 4440
aaattagatt cgatttatgg atcattcgat aagccttcgg agaaaaagaa ggggtattta 4500
ttgccaaggc ccaaaatggt taatgctgat ttggctagaa ttataaactc ggatgaggtc 4560
cagtctgttg tgaggccgat taagaaggat gttaataaga gggctacgtt gaagaagaat 4620
ccattgaaga acccgaatgt gttactgaag ctcaatcctt atgctaagac tgctaggagg 4680
atgtcgcttt tggccgaggc tcaacgggtt aaggcaaaga aagagaagct agacaagaag 4740
aggcatcaaa ttacaaagga ggaggcatcc gctatcaggt ctgcaagcca ttcgtggtac 4800
aagacaatga tctcagattc cgactatgca gagttcgaca acttcacaaa gtggcttgga 4860
gtttctcagt gaatggctac cgctgccgcc attcccacca ccaccgttca agccctagaa 4920
aatgacatgg ctactgacgg cgccgtccct ctccccgccg tcatgaaagc tccgatccgt 4980
cccgacgttg taacctacgt ccactccaac atttccaaaa acgcccgtca accttatgct 5040
gtatcaaaaa aagccggcca ccaaacctca gctgagtcat ggggtaccgg acgagctgtt 5100
tcacgtattc cccgtgttcc cggtggtggt acccaccgcg ccggtcaagc tgctttcggt 5160
aacatgtgtc gtggtggtcg aatgtttgct ccgacgaaga tctggcgccg atggcaccgt 5220
aagattcccg tgaaccaaaa acgatatgcc gttgcttcag ctatcgccgc ttcttcagtt 5280
ccatcccttg tcctcgcacg tggccatcgt atcgagaccg tccccgagct tcctctcgtt 5340
gtttctgatt cgatcgaagg gattgaaaag actaacaacg ctatcaaggc tttgaagcaa 5400
gtcggcgctt atccagatgc tgaaaaggct aaggacagtc acgctattcg tcccggaaag 5460
ggaaaaatgc gtaaccgtcg ctacatttcc cgcaaaggcc cactgattgt gtacggaaca 5520
gaaggtgcaa agctcgtgaa agcttttagg aacattcccg gtgttgaaat ttgccacgtg 5580
gatcgattga acttactcaa gcttgctcca ggtggtcact taggaaggtt tgttatttgg 5640
actaaatcgg cttatgagaa attagattcg atttatggat cattcgataa gccttcggag 5700
aaaaagaagg ggtatttatt gccaaggccc aaaatggtta atgctgattt ggctagaatt 5760
ataaactcgg atgaggtcca gtctgttgtg aggccgatta agaaggatgt taataagagg 5820
gctacgttga agaagaatcc attgaagaac ccgaatgtgt tactgaagct caatccttat 5880
gctaagactg ctaggaggat gtcgcttttg gccgaggctc aacgggttaa ggcaaagaaa 5940
gagaagctag acaagaagag gcatcaaatt acaaaggagg aggcatccgc tatcaggtct 6000
gcaagccatt cgtggtacaa gacaatgatc tcagattccg actatgcaga gttcgacaac 6060
ttcacaaagt ggcttggagt ttctcagtga 6090
<210> 2
<211> 405
<212> PRT
<213> Nicotiana sp.
<400> 2
Met Ala Thr Ala Ala Ala Ile Pro Thr Thr Thr Val Gln Ala Leu Glu
1 5 10 15
Asn Asp Met Ala Thr Asp Gly Ala Val Pro Leu Pro Ala Val Met Lys
20 25 30
Ala Pro Ile Arg Pro Asp Val Val Thr Tyr Val His Ser Asn Ile Ser
35 40 45
Lys Asn Ala Arg Gln Pro Tyr Ala Val Ser Lys Lys Ala Gly His Gln
50 55 60
Thr Ser Ala Glu Ser Trp Gly Thr Gly Arg Ala Val Ser Arg Ile Pro
65 70 75 80
Arg Val Pro Gly Gly Gly Thr His Arg Ala Gly Gln Ala Ala Phe Gly
85 90 95
Asn Met Cys Arg Gly Gly Arg Met Phe Ala Pro Thr Lys Ile Trp Arg
100 105 110
Arg Trp His Arg Lys Ile Pro Val Asn Gln Lys Arg Tyr Ala Val Ala
115 120 125
Ser Ala Ile Ala Ala Ser Ser Val Pro Ser Leu Val Leu Ala Arg Gly
130 135 140
His Arg Ile Glu Thr Val Pro Glu Leu Pro Leu Val Val Ser Asp Ser
145 150 155 160
Ile Glu Gly Ile Glu Lys Thr Asn Asn Ala Ile Lys Ala Leu Lys Gln
165 170 175
Val Gly Ala Tyr Pro Asp Ala Glu Lys Ala Lys Asp Ser His Ala Ile
180 185 190
Arg Pro Gly Lys Gly Lys Met Arg Asn Arg Arg Tyr Ile Ser Arg Lys
195 200 205
Gly Pro Leu Ile Val Tyr Gly Thr Glu Gly Ala Lys Leu Val Lys Ala
210 215 220
Phe Arg Asn Ile Pro Gly Val Glu Ile Cys His Val Asp Arg Leu Asn
225 230 235 240
Leu Leu Lys Leu Ala Pro Gly Gly His Leu Gly Arg Phe Val Ile Trp
245 250 255
Thr Lys Ser Ala Tyr Glu Lys Leu Asp Ser Ile Tyr Gly Ser Phe Asp
260 265 270
Lys Pro Ser Glu Lys Lys Lys Gly Tyr Leu Leu Pro Arg Pro Lys Met
275 280 285
Val Asn Ala Asp Leu Ala Arg Ile Ile Asn Ser Asp Glu Val Gln Ser
290 295 300
Val Val Arg Pro Ile Lys Lys Asp Val Asn Lys Arg Ala Thr Leu Lys
305 310 315 320
Lys Asn Pro Leu Lys Asn Pro Asn Val Leu Leu Lys Leu Asn Pro Tyr
325 330 335
Ala Lys Thr Ala Arg Arg Met Ser Leu Leu Ala Glu Ala Gln Arg Val
340 345 350
Lys Ala Lys Lys Glu Lys Leu Asp Lys Lys Arg His Gln Ile Thr Lys
355 360 365
Glu Glu Ala Ser Ala Ile Arg Ser Ala Ser His Ser Trp Tyr Lys Thr
370 375 380
Met Ile Ser Asp Ser Asp Tyr Ala Glu Phe Asp Asn Phe Thr Lys Trp
385 390 395 400
Leu Gly Val Ser Gln
405

Claims (10)

1. one grows tobacco nicotine content controlling geneRibosomal L4/L1, it is characterised in that the gene code is a kind of to be adjusted The polypeptide of Tobacco Control grass nicotine content, the amino acid sequence that the polypeptide includes such as SEQ ID：Shown in No.2.
2. tobacco nicotine content controlling gene according to claim 1Ribosomal L4/L1, it is characterised in that it is described Tobacco nicotine content controlling geneRibosomal L4/L1Comprising nucleotide sequence such as SEQ ID：Shown in No.1.
A kind of 3. any tobacco nicotine content controlling gene of claim 1 or 2Ribosomal L4/L1Clone side Method, it is characterised in that comprise the following steps：
（1）Tobacco leaf cDNA is synthesized：Tobacco RNA is extracted, reverse transcription obtains the first chain cDNA；
（2）Ribosomal L4/L1 The PCR amplifications of gene：Using tobacco leaf cDNA as template, according toRibosomal L4/L1 Gene order designs primer, enters performing PCR amplification, recovery and purifying pcr amplification product, and be sequenced.
4. tobacco nicotine content controlling gene according to claim 3Ribosomal L4/L1Cloning process, its feature It is, the primer is
Forward primer：5’- CCGCTGCCGCCATTCCCACCACCACCGTTC -3’；
Reverse primer：5’- GTGAAACAGCTCGTCCGGTACCCCATG -3’.
A kind of 5. any tobacco nicotine content controlling gene of claim 1 or 2Ribosomal L4/L1Application, its It is characterised by, in tobacco plant body described in suppressionRibosomal L4/L1The expression of gene, Nicotine in Tobacco can be reduced Content.
A kind of 6. tobacco nicotine content controlling gene according to claim 5Ribosomal L4/L1Application, its feature It is, the suppressionRibosomal L4/L1The method of gene expression is by the method for the inhibition of gene expression of RNA mediations.
7. one kind contains any tobacco nicotine content controlling gene of claim 1 or 2Ribosomal L4/L1Restructuring Carrier.
8. one kind contains any tobacco nicotine content controlling gene of claim 1 or 2Ribosomal L4/L1Expression Box.
9. one kind contains any tobacco nicotine content controlling gene of claim 1 or 2Ribosomal L4/L1Turn base Because of cell line.
10. one kind contains any tobacco nicotine content controlling gene of claim 1 or 2Ribosomal L4/L1Weight Group bacterium.
CN201710803440.4A 2017-09-08 2017-09-08 Tobacco nicotine content regulating gene Ribosomal L4/L1 and cloning method and application thereof Active CN107488223B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710803440.4A CN107488223B (en) 2017-09-08 2017-09-08 Tobacco nicotine content regulating gene Ribosomal L4/L1 and cloning method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710803440.4A CN107488223B (en) 2017-09-08 2017-09-08 Tobacco nicotine content regulating gene Ribosomal L4/L1 and cloning method and application thereof

Publications (2)

Publication Number Publication Date
CN107488223A true CN107488223A (en) 2017-12-19
CN107488223B CN107488223B (en) 2020-05-19

Family

ID=60651358

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710803440.4A Active CN107488223B (en) 2017-09-08 2017-09-08 Tobacco nicotine content regulating gene Ribosomal L4/L1 and cloning method and application thereof

Country Status (1)

Country Link
CN (1) CN107488223B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10405571B2 (en) 2015-06-26 2019-09-10 Altria Client Services Llc Compositions and methods for producing tobacco plants and products having altered alkaloid levels

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103012571A (en) * 2012-12-05 2013-04-03 北京师范大学 Gene capable of reducing nicotine content of tobacco and application thereof
CN104388431A (en) * 2014-11-01 2015-03-04 云南省烟草农业科学研究院 Genes capable of regulating and controlling nicotine content of tobacco and application of genes
CN104498480A (en) * 2014-11-20 2015-04-08 浙江大学 Tobacco nicotine synthesis related long non-coding RNA gene and application of tobacco nicotine synthesis related long non-coding RNA gene

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103012571A (en) * 2012-12-05 2013-04-03 北京师范大学 Gene capable of reducing nicotine content of tobacco and application thereof
CN104388431A (en) * 2014-11-01 2015-03-04 云南省烟草农业科学研究院 Genes capable of regulating and controlling nicotine content of tobacco and application of genes
CN104498480A (en) * 2014-11-20 2015-04-08 浙江大学 Tobacco nicotine synthesis related long non-coding RNA gene and application of tobacco nicotine synthesis related long non-coding RNA gene

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
XM_016644167.1: "Nicotiana tabacum 60S ribosomal protein L4-like (LOC107818213), mRNA", 《GENBANK》 *
杨惠娟: "打顶前后烤烟叶片蛋白质表达差异的研究", 《中国烟草学报》 *
谢丽娟: "ＲNA 干扰技术及其在烟草中的应用研究进展", 《云南农业大学学报( 自然科学)》 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10405571B2 (en) 2015-06-26 2019-09-10 Altria Client Services Llc Compositions and methods for producing tobacco plants and products having altered alkaloid levels

Also Published As

Publication number Publication date
CN107488223B (en) 2020-05-19

Similar Documents

Publication Publication Date Title
CN109456982B (en) Application of rice OsMYB6 gene and encoding protein thereof in drought resistance and salt resistance
CN110904071B (en) Application of RAF49 protein and encoding gene thereof in regulation and control of plant drought resistance
CN109207484A (en) A kind of tobacco nicotine content controlling gene IAA27 and its cloning process and application
CN111118031A (en) Cloning and application of negative regulation gene NtARF6 for synthesizing tobacco alkaloid
CN110684779A (en) Cloning and application of tobacco nicotine synthesis regulatory gene NtERF91
CN110643616A (en) Cloning and application of tobacco nicotine synthesis regulation gene NtERF91
CN106868023B (en) Cucumber CsERF004 gene and coding protein and application thereof
CN110643618A (en) Jatropha curcas MYB transcription factor JcMYB16 gene and application thereof in improving drought resistance of plants
CN110669772A (en) Cloning and application of tobacco neonicotinoid synthesis regulatory gene NtERF91
CN108624596B (en) Gene for regulating growth of leguminous root noduleGmSPX5And uses thereof
CN106916827A (en) One grows tobacco low-temperature resistance stress-inducing early blossoming gene NtMYB15 and its cloning process and application
CN107365777A (en) One grows tobacco nicotine content controlling gene NtCLC b and its cloning process and application
CN114369147B (en) Application of BFNE gene in tomato plant type improvement and biological yield improvement
CN110592103A (en) Clone and application of Nicotiana tabacum anabasine synthesis regulation gene NtERF91
CN113388017B (en) Drought-resistant protein and application of coding gene thereof in cultivating drought-resistant plants
CN101516180A (en) Early-maturing transformed plant
CN107299103B (en) Thick boisiana IpASR gene and its coding albumen and application
CN104404043A (en) Promoter of gene Me094 related to bacterial-blight resistance of Oryza meyeriana
CN107488223A (en) One grows tobacco nicotine content controlling gene Ribosomal L4/L1 and its cloning process and application
CN103981187B (en) The deletion mutant of corn phosphatidylinositols synthase gene promoter P-ZmPIS and application thereof
CN113528538B (en) Cucumber CsSTK gene, protein, expression vector and application
CN102010864A (en) Maize pollen tissue specific promoter and expression vector thereof
CN113481210B (en) Application of cotton GhDof1.7 gene in promotion of salt tolerance of plants
CN109097373A (en) A kind of tobacco nicotine content controlling gene TIFY6B and its cloning process and application
CN109439668A (en) A kind of tobacco chloride ion absorbs gene NtSLAC2 and its cloning process and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant