CN107429249A - Female reproduction disease target spot CMKLR1 and its antagonist and related application - Google Patents

Abstract

The new target spot CMKLR1 of female reproduction disease is provided, and the application in being used to prevent and/or treat the medicine of female reproduction disease is being prepared for CMKLR1 antagonist.A kind of pharmaceutical composition prevented and/or treat female reproduction disease is additionally provided, it includes the antagonist for CMKLR1.A kind of method for additionally providing antagonist prevention using for CMKLR1 and/or treatment female reproduction disease.

Description

Female reproduction disease target spot CMKLR1 and its antagonist and related application Technical field

The present invention relates to novel target spots relevant to female reproduction disease, specifically, the present invention relates to female reproduction disease target spot CMKLR1 and its antagonist and related applications.

Background technique

State Statistics Bureau issues the 6th national census key data bulletin data and shows, 1,339,724,852 people of country's total population.Compared with the Fifth Population Census of China in 2000,10 years 73900000 people of increase increase by 5.84%, and average annual growth rate 0.57%, the annual average rate of increase 1.07% than nineteen ninety to 2000 declines 0.5 percentage point.Statistics indicate that China human mortality, which increases, is in the level of low birth rate stage.In October, 2015, the Central Committee the 5th time, the Chinese Communist Party the 18th plenary session bulletin is pointed out: promoting population balanced development, it sticks to the basic state policy for family planning, improve population development strategy, two child's policies can be given birth to by implementing in full a couple, actively develop reply aging of population action.

However in recent years, allegro Working and life styles, the pressure of high consumption, every aspect all challenge the women of the age of marriage and child-bearing.Therefore, the healthy reproduction of the health of women, especially women are to cannot be neglected social concern.

(1) Stein-Leventhal syndrome (polycystic ovary syndrome, PCOS)

Stein-Leventhal syndrome is the common endocrine disturbance disease of the women of child-bearing age, and disease incidence accounts for the 6~10% of Women of Childbearing Age, is mainly shown as oligomenorrhea or amenorrhoea, infertile, the more cystis degenerations of ovary, obesity, crinosity, hyperandrogenism etc..Treatment for PCOS patient, including operative treatment, drug therapy and Assisted Reproductive Technology ART.

The operative treatment of PCOS can reduce part granular cell in ovary, stroma of ovary generates androgen and reduces, to make the androgen levels in circulation reduce, and then GnRH is reduced, serum androgen concentration is caused to further decrease, this also illustrates that stroma of ovary is also regulated and controled by Pituitary-ovary Axis.The operative treatment of PCOS mainly includes bilateran ovariam resection (BOWR), (Laparoscopic ovariandrilling is treated in Laparoscopic Ovarian fulguration or laser boring,) and Via vagina water laparoscope (Transvaginalhydrolaparoscopy, THL) LOD.

The drug therapy of PCOS has replaced operative treatment as first-line treatment method at present, the purpose for the treatment of is mainly related to the fertility of patient requirement, such as using the drug therapy for reducing hyperandrogenism, promoting ovulation drug treatment, or insulin sensitizer (insulin-sensitizing drugs, ISD) treatment etc..

In addition, also have to PCOS patient using Assisted Reproductive Technology ART, especially for application 6 months or more standards There is ovulation after ovulation induction cycle therapy but still nogestational PCOS patient, or No-clay weak interbed and the suddenly patient to gestation are treated and assisted in the treatment of to a variety of drug ovulations, it can choose the Assisted Reproductive Technology ART of embryo transfer, including technology in vitro fertilization (In vitro fertilization,) and oocyte in vitro maturation technology (In vitro maturation, IVM) IVF.

However the above treatment method has advantage and disadvantage, it is important to which so far, the pathogenesis of PCOS is still unclear, so currently used treatment method is also only treated the symptoms.

A large number of studies show that 40~60% PCOS patient is overweight people, there is insulin resistance (insulin resistance, IR) and secondary blood insulin increases.It is well known that body fat mass in human body tissue is one of important target organ of insulin action, therefore certain pathology of adipose tissue, physiological change will also will affect generation, the development of PCOS IR.

(2) oophoroma (Ovarian Cancer, OAC)

In female reproduction cancer, some is related to endocrine.Such as, breast cancer (Breast Cancer), carcinoma of endometrium (Endometrial Cancer) and oophoroma (Ovarian Cancer, OAC) etc..Wherein, oophoroma is to betide a kind of malignant tumour of ovary, and 90%~95% is the cancer of ovarian primary, and in addition 5%~10% is the primary metastasis of cancer in other positions to ovary.Although the ovarian tumors rate in China is high not as good as American-European countries, the chemotherapy of radical operative treatment and cytotoxicity, lack the effectiveness that the death rate of oophoroma is effectively reduced.Not special having symptom since oophoroma early stage lacks symptom, the effect of screening is again limited, therefore early diagnosis is relatively difficult, and 60%~70% has been advanced stage when going to a doctor, and late case unsatisfactory curative effect.Therefore, although the disease incidence of oophoroma is only second to cervical carcinoma and carcinoma of endometrium, the third position of gynecologic malignant tumor is occupied, the death rate is more than the sum of cervical carcinoma and carcinoma of endometrium, is in gynecological cancer first place, is the maximum illness for seriously threatening WomanHealth.

Think in previous clinical research, oophoroma is being no apparent Symptoms in early days.But more also research shows that, oophoroma is being the symptom that can show some clinics in early days, such as it is abnormal abdominal distension, glutted, abdominal pain or back pain, lassitude etc., but these symptoms are often ignored by patient, have often shifted when diagnosis, thus oophoroma is often described as " noiseless killer ", and then also results in the prognosis mala of oophoroma.

Numerous studies are it has been shown that oophoroma often passes through direct spreading and basin, abdominal cavity send out the organ planted to distant place.The main path of ovary metastasis of cancer is intraperitoneal implantation metastasis, and according to clinical observation, the main portions of transfer are omentum majus, and 80% shifts with nethike embrane in the women with oophoroma.At this point, the cancer cell on omentum majus far faster than the speed at primary lesion to increase.Omentum majus is connection greater curvature to the peritonaeum of transverse colon, inside contains phagocyte, has important defense function, while being also the adipose tissue containing a large amount of fat drips, be an internal important endocrine organ, and participate in vivo environment stable state.Although the fact oophoroma is to big net film transfer it is obvious that its mechanism it is still unapparent always. Because omentum majus position is based on adipose tissue, adipose tissue is internal maximum endocrine organ, can secrete Adipocyte Factor, cell factor etc., the relationship and its mechanism between fat cell and ovarian cancer cell in adipose tissue, it is still necessary to which more evidences illustrate.

With deepening continuously to tumor research, more and more evidences show that obesity will increase the lethal risk of cancer patient.For example, the leptin (Leptin) of white adipose tissue secretion can promote the development of breast cancer: on the one hand, leptin can be by activating JAK/STAT3, MAPK-ERK1/2 or PI3K access, to promote the growth of breast cancer；In addition, the expression that leptin can also generate element by induction of vascular promotes the generation of tumor-associated vessels, and leptin also can induce the transcription of human epidermal growth factor receptor 2 (ErbB-2), and the reaction of insulin-like growth receptor 1 (IGF-1) in triple negative breast cancer cell is participated in, activation EGF-R ELISA (EGFR) is to promote the invasion and transfer of cell.Current research also shows, leptin can also have facilitation during the kinds cancers such as prostate cancer, thyroid cancer, its expression and tumour are positively correlated, but the leptin level in cancer of pancreas is then relatively low, and relationship between the two is not very clear.Also studies have found that adiponectin is inhibited to the occurrence and development of tumour.

It has been reported that fat also can increase the risk that women suffers from oophoroma.Adipose tissue will affect the state of an illness of the oophoroma of obese women, and researcher studies 216 women, wherein 35 are obese womens, 108 be normal type women, find in ovarian cancer patients, compared with the women of normal type, the survival rate of obese women is lower, and the time-to-live is shorter.Scientist's discovery in addition between them Cancer death rate and cancer return rate have any different outer, their tumour cell also shows difference, and it is rapid that the hormone or albumen for prompting adipose tissue to secrete may cause human epithelial ovarian carcinoma cells proliferation.There are also studies have shown that the IL-6 and IL-8 of the fat cell secretion of omentum majus can promote ovarian cancer cell to shift to it in abdominal cavity.

About adipose tissue, especially omentum majus fat, the relationship with oophoroma, the article that Ernst professor Lengyel delivers on " nature-medicine " (Nature Medicine) magazine on October 30th, 2011 provides full and accurate evidence.Chemerin is a kind of newly discovered Adipocyte Factor, also known as chemotactic element, in immune response, inflammatory reaction, Adipocyte Differentiation it is mature, in terms of play a role, it is related to fat and metabolic syndrome.Chemerin gene is also referred to as (the Tazarotene Induced Gene2 of Tazarotene-induced gene 2, TIG2), found by clone for the first time within 1997, then, 2003, Wittamer etc. passed through its isolated activated protein of reverse phase HPLC in the secondary ascites of oophoroma.

2012, the research of Reverchon etc. confirmed that chemerin and its receptor CMKLR1 (class chemokine receptors -1) has expression in main Human ovarian granulosa cell (hGCs) and people's ovarian granulosa sample tumour cell (KGN), Referring again to the relationship of chemerin and ovarian neoplasm.

In October, 2011, Ernst doctor Lengyel is published in the research discovery oophoroma of nature medicine into omentum majus transfer process, FABP4 plays the role of vital, and the chemotactic factor (CF) of omentum majus takes part in oophoroma and migrates to the process of omentum majus fat, and detect chemotactic factor (CF) adiponectin and cell factor IL-6, IL-8 in omentum majus fat cell etc..But in article it is not on the books detect equally be chemotactic factor (CF) chemerin.

Existing literature and technical report, there are no the specific target spots for both diseases of Stein-Leventhal syndrome and oophoroma found.

Summary of the invention

It is a primary object of the present invention to find the novel targets of female reproduction disease, preferably to prevent and/or treat female reproduction disease, alleviates Stein-Leventhal syndrome, inhibits oophoroma proliferation.

Present invention determine that chemerin/CMKLR1 system is the novel target spot for adjusting Stein-Leventhal syndrome and inhibiting oophoroma.

CMKLR1 (chemokine like receptor-1, class chemokine receptors -1), is chemotactic factor (CF)/Adipocyte Factor chemerin one of receptor, belongs to g protein coupled receptor family.

Inventor has found under study for action, the gene expression of CMKLR1 is interfered in the way of gene Knockout or shRNA, or, utilize the effect of specific antagonists interference CMKLR1 receptor, the symptom of Experimental Mice Stein-Leventhal syndrome can effectively be alleviated, also can effectively inhibit Proliferation of Human Ovarian Cell intracorporal proliferation in vitro.

In a specific experiment of the invention, the present invention interferes the shRNA sequence of CMKLR1 gene expression using specificity, establish people's epitheliated type oophoroma SKOV3 permanent cell line (Tomato-shCMKLR1 SKOV3) with fluorescein (Luciferase) and Tomoto fluorescent marker, that weak CMKLR1 gene is struck using shRNA interference, cell in vitro group proliferation experiment is shown, compared with the control group, the proliferation for striking the SKOV3 cell of weak CMKLR1 gene is significantly suppressed.Further, Tomato-shCMKLR1SKOV3 cell is subcutaneously injected, establishes nude mice lotus knurl model, detects weight and tumour growth situation weekly, compared with the control group, Tomato-shCMKLR1 SKOV3 cell grows significant slow in animal body.In addition, in nude mice lotus knurl model, intraperitoneal injection CMKLR1 specific small molecule antagonist can significantly inhibit the growth of tumour compared with the control group using the effect of CMKLR1 specific small molecule antagonist antagonism CMKLR1.

In another specific experiment of the invention, by interfering the gene expression of CMKLR1 or the effect of antagonism CMKLR1, it can be effectively relieved experimental small as caused by protona (DHT) or dehydrobenzene (DHEA) The symptom of mouse Stein-Leventhal syndrome.

To, on the one hand, the present invention provides the antagonists for CMKLR1 to prepare the application in the drug for preventing and/or treating female reproduction disease.

On the other hand, the present invention also provides a kind of prevention and/or the pharmaceutical composition for the treatment of female reproduction disease, which includes the antagonist for CMKLR1.

On the other hand, the present invention also provides a kind of prevention and/or the methods for the treatment of female reproduction disease, this method comprises: the effect of the expression and/or antagonism CMKLR1 of CMKLR1 is reduced, to prevent and/or treat female reproduction disease using CMKLR1 as target spot.Specifically, expression (knock out CMKLR1 gene or strike the expression of weak CMKLR1 gene) and/or the effect of antagonism CMKLR1 that CMKLR1 is reduced using the antagonist for CMKLR1 be can be.

Specific embodiment according to the present invention, in the present invention, the antagonist for CMKLR1 for the effect of any expression for reducing CMKLR1 and/or antagonism CMKLR1 reagent.Reagent with such function for example may include siRNA, shRNA, antisense RNA, antibody or combinations thereof.Such reagent can obtain to those skilled in the art according to the prior art, it can be any expression for reducing CMKLR1 and/or the antagonist of effect of antagonism CMKLR1 itself well known in the prior art, can also be the reagent that the expression and/or antagonism CMKLR1 effect that still have the function of reducing CMKLR1 after structure are modified, changed based on the molecular formula.In a preferred embodiment of the invention, the antagonist for CMKLR1 is small molecular antagonists, such as shRNA or α-NETA etc..It is highly preferred that the shRNA has the sequence as shown in SEQ ID No.1.

Specific embodiment according to the present invention, the present invention in, it is described prevention and/or treatment female reproduction disease include: alleviate Stein-Leventhal syndrome symptom, and/or inhibit human epithelial ovarian carcinoma cells proliferation.

Specific embodiment according to the present invention, prevention of the invention and/or treat female reproduction disease pharmaceutical composition in, except it is described for the antagonist of CMKLR1 in addition to, can also as needed include pharmaceutically acceptable carrier or excipient.

In terms of comprehensive, it is the novel targets for preventing and treating Stein-Leventhal syndrome and oophoroma that the present invention, which has proved CMKLR1, CMKLR1 gene expression is interfered using any technology or intervenes the effect of CMKLR1, can effectively be alleviated the symptom of Stein-Leventhal syndrome, be inhibited the proliferation of oophoroma.

Detailed description of the invention

Fig. 1: weak CMKLR1 gene is struck, can inhibit the expression of metastasis related gene in ovarian cancer cell line SKOV3.

Fig. 2: striking weak CMKLR1 gene, can inhibit the migration and proliferation of ovarian cancer cell line SKOV3.

Fig. 3: striking weak CMKLR1 gene, can inhibit Proliferation of Human Ovarian Cell in the proliferation of nude mice by subcutaneous.

Fig. 4: CMKLR1 specific antagonists can inhibit Proliferation of Human Ovarian Cell in the proliferation of nude mice by subcutaneous.

The influence that the missing of Fig. 5 A and Fig. 5 B:CMKLR1 gene changes the oestrous cycle caused by protona.Wherein, WT, wild type: wild-type mice.Cmklr1-/and-: CMKLR1 Gene-Deficient Mice.Control (Ctl): control placebo.DHT, protona: the heeling-in experimental group of protona.P:proestrous: proestrum.D:diestrous: dioestrus.E:estrous: oestrus.M:metestrous: heat later period.Days: number of days.Estrous Cycles: oestrous cycle.

The missing of Fig. 6: CMKLR1 gene, the influence to hormonal readiness in mice serum caused by protona.

The missing of Fig. 7: CMKLR1 gene, the influence to mouse ovarian structure caused by protona.

The missing of Fig. 8 A and Fig. 8 B:CMKLR1 gene, the influence to mouse follicle cell apoptosis caused by protona.

The missing of Fig. 9: CMKLR1 gene, the influence that hormone sensitive lipase gene relative enzyme gene in ovary tissue caused by protona is expressed.

Figure 10: CMKLR1 specific antagonists, α-NETA, the influence to gene expressions such as mouse ovarian structure caused by protona, hormone sensitive lipase gene enzymes.

Figure 11: CMKLR1 specific antagonists, α-NETA, the influence to mouse ovarian structure caused by DHEA.

Figure 12 A and Figure 12 B:CMKLR1 specific antagonists, α-NETA, the influence to mouse follicle cell apoptosis caused by DHEA.

Specific embodiment

For a clearer understanding of the present invention, the present invention is further described referring now to the following example and attached drawing.Embodiment is only used for explaining without limiting the invention in any way.In embodiment, each Starting reagents material is commercially available, and test method without specific conditions is conventional method and normal condition known to fields, or according to condition proposed by apparatus manufacturer.

Embodiment 1: interfering the gene expression of CMKLR1 or the effect of antagonism CMKLR1, and the proliferation for inhibiting Proliferation of Human Ovarian Cell can be effectively suppressed.

The present embodiment demonstrates the gene expression of interference CMKLR1 or the effect of antagonism CMKLR1, and the proliferation for inhibiting Proliferation of Human Ovarian Cell can be effectively suppressed.Wherein, the shRNA sequence of design specificity interference CMKLR1 gene expression Column, establish it is with fluorescein (Luciferase) and Tomoto fluorescent marker, the people's epitheliated type oophoroma SKOV3 permanent cell line (Tomato-shCMKLR1 SKOV3) for striking weak CMKLR1 gene is interfered using shRNA.

Cell in vitro group proliferation experiment shows that compared with the control group, the proliferation for striking the SKOV3 cell of weak CMKLR1 gene is significantly suppressed.Tomato-shCMKLR1 SKOV3 cell is subcutaneously injected, establishes nude mice lotus knurl model, detects weight and tumour growth situation weekly, compared with the control group, Tomato-shCMKLR1 SKOV3 cell grows significant slow in animal body.Using the effect of CMKLR1 specific small molecule antagonist antagonism CMKLR1, in nude mice lotus knurl model, intraperitoneal injection CMKLR1 specific small molecule antagonist can significantly inhibit the growth of tumour compared with the control group.

It is specific as follows:

1, the abortion syndrome with fluorescein (Luciferase, Fluc) and Tomato fluorescent marker: SKOV3-Luc-Tomato/LRH and SKOV3.ipl-Luc-Tomato/LRH is established.

In this experiment, selecting slow virus carrier of Proliferation of Human Ovarian Cell SKOV3, SKOV3.ipl (the being purchased from Wuhan doctor's moral company) preparation containing Tomato/Luciferase gene, (carrier is according to document Ren P.-G. (Ren Peigen), Lee S-W, Biswal S, Goodman SB.Systemic trafficking of macrophages induced by bone cement particles in nude mice.Biomaterials, 2008.29:4760-4765 are voluntarily prepared).Concrete operations are as follows:

1. eugonic Proliferation of Human Ovarian Cell SK-OV3, SK-OV3.ipl is chosen, in the day before transfection with 5 × 10⁵A/hole, is inoculated in 6 orifice plates, and after culture to second day, cell fusion degree is 60%；

2. second carries out cell infection 6 hours with the slow virus containing Tomato/Luciferase gene；

3. after 6 hour, cell to be transfected gently being rinsed once with PBS, 2mL complete medium is added into hole, is placed in carbon dioxide incubator and cultivates；

4. selecting the culture medium containing 1 μ g/mL G418 to be screened after 48 hours；Obtain stablizing the ovarian cancer cell line of expression Tomato/Luciferase gene after death no longer occurs in cell: SKOV3-Luc-Tomato/LRH and SKOV3.ipl-Luc-Tomato/LRH can be used to the external experiment in vivo of tumour cell.

2, the abortion syndrome to shine for having struck CMKLR1 gene weak: SKOV3-Luc-Tomato-shCMKLR1/LRH and SKOV3.ipl-Luc-Tomato-shCMKLR1/LRH is established.

Institute's employment CMKLR1 gene shRNA is pSM2c-Hu-shCMKLR1 (being purchased from Open Biosystems), Hairpin sequence: 5 '-TGCTGTTGACAGTGAGCGAGGTGATGAATACCCTG in this experiment ATTATTAGTGAAGCCACAGATGTAATAATCAGGGTATTCATCACCGTGCCTACTGCCTCGGA-3'(SEQ ID No.1).Control group is pSM2c-Hu-scramble shRNA.

1. the eugonic Proliferation of Human Ovarian Cell to shine: SKOV3-Luc-Tomato/LRH and SKOV3.ipl-Luc-Tomato/LRH is chosen, in the day before transfection with 5 × 10⁵A/hole, is inoculated in 6 orifice plates, and after culture to second day, cell fusion degree is 60%；

2. second day is transfected, as unit of a culture hole of 6 orifice plates, 3 μ g plasmids are diluted with the opti-MEM culture medium of 200 μ L, 6 μ L liposome Lipofectamine 2000 are separately diluted with the opti-MEM culture medium of 200 μ L, after mixing gently respectively, it is placed at room temperature for 5 minutes；

3. two pipe dilutions are gently mixed, it is stored at room temperature after twenty minutes, the opti-MEM culture medium of 600 μ L is gently added into mixed dilution；

4. cell to be transfected is gently rinsed once with PBS, then the dilution mixed is gently added in culture hole, is placed in carbon dioxide incubator and cultivates；

5. transfection used medium to the greatest extent is abandoned in culture after 4~6 hours, 3mL complete medium is added into hole；

6. selecting the culture medium containing 1 μ g/mL puromycin (puromycin) to be screened after 48 hours；Obtain stablizing the ovarian cancer cell line of expression CMKLR1 shRNA to shine after death no longer occurs in cell.Then it is screened using flow cytometer, sub-elects the cell of high expression red fluorescence,

7. extracting total serum IgE with TRIzol, quantitative 2 μ g RNA carry out reverse transcription (Reverse Transcriptase kit is purchased from Promega company), and carry out qPCR with specific primer sequences.

Specific primer sequences used are Hu-CMKLR1 primer sequence:

Fw 5’-GAGGCGTGACATAGAATGGA-3’(SEQ ID No.2)

Rv 5’-TGATATGGATTGGGAGGAAGAC-3’(SEQ ID No.3)

8. with comparing for pSM2c-Hu-scramble shRNA has been transfected, CMKLR1 gene expression dose be only its 40% ± 2.87%, it as the abortion syndrome to shine for having struck CMKLR1 gene weak, and names are as follows: SKOV3-Luc-Tomato-shCMKLR1/LRH；And SKOV3.ipl-Luc-Tomato-shCMKLR1/LRH；It can be used to the experiment of tumour cell in vitro and in vivo.

3, in-vitro multiplication, migration and the Matrigel for the abortion syndrome to shine for having struck CMKLR1 gene weak.

(1) MTT proliferation experiment:

1. it is thin to be inoculated in 96 holes respectively with 2000/hole by the ovarian cancer cell of shRNA and empty plasmid is transferred to In born of the same parents' culture plate, every hole culture volume is 200 μ L, while different culture plates being placed in carbon dioxide incubator, is cultivated 12 hours, 24 hours, 48 hours, 72 hours respectively；

2. MTT solution (5mg/mL) is added in culture plate, every 20 μ L of hole continues to be put into carbon dioxide incubator and cultivate 4 hours in different detection time points；

3. abandoning the supernatant in culture plate, 150 μ L DMSO (dimethyl sulfoxide) are added, shake 10 minutes, selects 490nm wavelength to be detected in microplate reader, draws the growth curve of cell.

(2) Soft Agar soft-agar cloning forms experiment:

1. preparing 1.2% and 0.7% agarose, high pressure sterilization is placed in 55 DEG C of water-baths, it is made to keep melting state；

2. with 2 × RPMI, 1640 culture medium containing 20%FBS, 2 × antibiotic, 37 DEG C of preheatings；

③Guan lower layer glue: 1.2% agarose gel is mixed with 2 × culture medium 1:1, is added in 6 orifice plates, every hole 3ml, is placed at room temperature for its solidification；

4. digesting SKOV3-Luc-Tomato-shCMKLR1/LRH during waiting lower layer's gelling solid, or SKOV3.ipl-Luc-Tomato-shCMKLR1/LRH, or pSM2c-Hu-scramble shRNA surely turns cell, it counts, it is 5 × 104/ml with serum free medium adjustment concentration, 100 μ l cells of every hole, if 3 parallel holes；

5. filling upper layer glue after lower layer's gelling is solid: 0.7% agarose gel mixes (about 40 DEG C of temperature or so) with 2 × culture medium 1:1, and 100 μ l cell suspensions are added, i.e. 5000 cells mix, and is added in orifice plate, every hole 3ml；

6. 37 DEG C of 5%CO2 cultures, Fluirescence observation clones size after about 2~3 weeks, counts and compares two groups of Clone formation situations.

(3) Transwell Matrigel:

Influence using the cell Transwell and the detection interference CMKLR1 gene expression of the cell Transwell of pre-coated Metrigel to Migration of Ovarian Cancer Cells and invasion.Concrete operations are as follows:

1. after the ovarian cancer cell starvation for being transferred to shRNA and empty plasmid is cultivated 24 hours, digestion centrifugation is discarded supernatant, it is resuspended and is counted with the culture medium of serum-free, cell density is adjusted to 5 × 10⁵A/mL；

2. (8.0 μm of Pore size of the cell Transwell, it is purchased from Corning company) and the cell BD BioCoat (Metrigel Invasion Chember, 8.0 μm of Pore size, be purchased from BD company) lower room in the culture medium that 600 μ L contain 10%FBS is added, be added after the cell suspension that 200 μ L are prepared for be put into carbon dioxide incubator cell in upper chamber and cultivate 6 hours；

3. gently rinsing the cell Transwell with PBS, and the cell in upper chamber is wiped with cotton swab, cell is sufficiently dried after fixing 30 minutes with methanol, dyeing 2 minutes is protected from light with the DAPI solution containing 1 μ g/mL, and it can be observed under fluorescence microscope after gently being rinsed with distilled water, it randomly selects 5 visuals field to take pictures, the quantity of migrating cell is counted and counted to nucleus.

Fig. 1, which is shown, strikes weak CMKLR1 gene, can inhibit the expression of metastasis related gene in ovarian cancer cell line SKOV3.

With RNA (shCMKLRA) technology of slow-virus transfection interference CMKLR1 gene in ovarian cancer cell line SKOV3, strike the expression (about striking the expression of weak 50%CMKLR1 gene) of endogenous CMKLR1 gene in weak cell, then after CMKLR1 gene has been struck in detection weak, influence to the expression of metastasis gene mucoprotein family -16 (MUC16) and MMP-2 (MMP2) in SKOV3, two gene expression doses of MUC16 and MMP2 significantly reduce as the result is shown.*P<0.05,**P<0.01,***P<0.001.

Fig. 2, which is shown, strikes weak CMKLR1 gene, can inhibit the migration and proliferation of ovarian cancer cell line SKOV3.

Detection migrates (migration) to ovarian cancer cell line SKOV3 after striking weak CMKLR1 and invades the influence of (invasion).SKOV3.shCMKLR1 is the cell line for having transfected shCMKLR1 RNA interfering；SKOV3.pSM2c is the SKOV3 cell line for only having transfected empty vectors.

In migration experiment (the picture A in Fig. 2), as control cell lines, SKOV3.pSM2c, after chemerin handles various concentration (from 0nM to 0.5nM), also gradually increase with the quantity that chemerin concentration increases the cell of migration, for chemerin concentration for the treatment of in 0.02nM, the quantity of migrating cell reaches most, when chemerin is 0.5nM, the cell quantity of migration starts to reduce.

After striking the expression of weak CMKLR1, after giving various concentration chemerin processing, SKOV3 cell is almost without migration.

In Matrigel (the picture B in Fig. 2), chemerin processing make control group SKOV3 cell line (SKOV3.pSM2c) invade quantity increase, but CMKLR1 strike it is weak after, the cell quantity of invasion substantially reduces.

Study group establishes the cell line of the Tomato fluorescent marker of SKOV3-pSM2c and SKOV3-shCMKLR1 cell line simultaneously.Soft agar cloning test can detect the proliferation (the picture C in Fig. 2) of cancer cell, as the result is shown, the SKOV3-shCMKLR1 cell line for having struck CMKLR1 gene weak, the number and size of clone are formed, significantly lower than the cellular control unit system (SKOV3-pSM2c) for not striking weak CMKLR1 gene.

4, internal proliferation, migration and the invasion for the abortion syndrome to shine for having struck CMKLR1 gene weak Experiment.

In this experiment, the experiment of nude mice by subcutaneous lotus knurl is carried out, to verify the internal proliferation for the abortion syndrome to shine for having struck CMKLR1 gene weak, the influence of migration and invasion.Concrete operations are as follows:

1. randomly choosing the nude mice of 6~8 week old, cell suspension is made in the Proliferation of Human Ovarian Cell for having struck CMKLR1 gene weak that can be shone, by 1 × 10^-70.2 milliliter of the cell suspension of a/milliliter concentration (is 2 × 10 containing about cell number^-6It is a) amount be injected into cell suspension inoculation nude mice skin of back, while the pSM2c-Hu-scramble shRNA for being vaccinated with same cell quantity surely turns cell as a control group；

2. observing the growing state of two groups of tumor models and the transfer case of in-vivo tumour using living animal imager dynamic tracing.

Fig. 3, which is shown, strikes weak CMKLR1 gene, can inhibit Proliferation of Human Ovarian Cell in the proliferation of nude mice by subcutaneous.

By SKOV3 cell infusion to nude mice by subcutaneous, lotus knurl tumor model in SKOV ovarian cancer cell body is established, the case where cell line that CMKLR1 gene has been struck in detection weak forms tumour in Mice Body.Tomato-SKOV3.shCMKLR1 is the luminescent cell system for having transfected shCMKLR1 RNA interfering；Tomato-SKOV3.sramble is the SKOV3 luminescent cell system for only having transfected nonspecific interference RNA (sramble RNA), as control.

SKOV3 ipl-sramble RNA-Tomato cell and SKOV3 ipl-shCMKLR1-Tomato cell are injected into the subcutaneous of mouse respectively, at the 7th day (D7), 14th day (D14), the intensity of detection Fluc bioluminescence in 28th day (D28) and the 35th day (D35), infers the degree of transplanting Subcutaneous Tumor Growth.Luminous signal is stronger, and luminous signal area is bigger, indicates that the tumour to be formed is bigger.As time went on, SKOV3 ipl-sramble RNA-Tomato cell increases obviously in Mice Body, and shCMKLR1 cell increases almost without significant.

Fig. 4 shows CMKLR1 specific antagonists, can inhibit Proliferation of Human Ovarian Cell in the proliferation of nude mice by subcutaneous.

The Tomato SKOV3-Fluc-Tomato cell line marked is injected into the subcutaneous of mouse, (a-NETA is CMKLR1 specific small molecule antagonist to the various dose drug a-NETA of mouse peritoneal injection simultaneously, it can voluntarily be prepared according to following documents: Graham KL, Zhang JV (Zhang Jian), Lew é n S, Burke TM, Dang T, Zoudilova M, Sobel RA, Butcher EC, Zabel BA.A Novel CMKLR1Small Molecule Antagonist Suppresses CNS Autoimmune Inflamm Atory Disease.PLOS ONE, 2014 Dec 1；9 (12): e112925.doi:10.1371/journal.pone.0112925.eCollection 2014), daily per kilogram of body weight injection 0.1mg (a-NETA 0.1mg/kg/d), daily per kilogram of body weight inject 1mg (a-NETA 1mg/kg/d).The 7th day (D7) after cells injection, the 14th day (D14), the 28th day (D28) and the 35th day (D35) When detect Fluc bioluminescence intensity, infer transplanting Subcutaneous Tumor Growth degree.Luminous signal is stronger, and luminous signal area is bigger, indicates that the tumour to be formed is bigger.

In D7, fluorescence intensity is without significant change for three processing groups (control, NETA-0.1mg/kg/d and 1mg/kg/d), and in D14, D28 and D35, control group tumor tissues rise appreciably, and fluorescence intensity gradually increases.And in α-NETA processing group, compared to the control group, α-NETA is handled so that the growth of SKOV cell tumour slows down, and especially in D28 and D35, fluorescence intensity obviously weakens.

Embodiment 2, the gene expression for interfering CMKLR1 or the effect of antagonism CMKLR1, can be effectively relieved the symptom of the Experimental Mice Stein-Leventhal syndrome as caused by DHT or DHEA.

In the present embodiment, the gene expression of interference CMKLR1 or the effect of antagonism CMKLR1 are demonstrated, the symptom of the Experimental Mice Stein-Leventhal syndrome as caused by DHT or DHEA can be effectively relieved.Wherein, Experimental Mice Model of Polycystic Ovarian Syndrome caused by excessive androgen DHT or DHEA is established.But, compared with wild-type mice, the symptom of CMKLR1 knock out mice Stein-Leventhal syndrome is obviously eased, it include: to maintain certain physiological period, by the progesterone of certain level in serum, still there is corpus luteum generation on ovary, the tune for reducing the stroma of ovary caused by DHT and ovarian follicle film property cell is died.Experimental Mice Model of Polycystic Ovarian Syndrome caused by DHT or DHEA, give CMKLR1 specific small molecule antagonist α-NETA in abdominal cavity, the symptom of Stein-Leventhal syndrome can be alleviated, comprising: maintain the progesterone for having certain level in serum, still have corpus luteum generation on ovary.

It is specific as follows:

(1) DHT Experimental Mice Model of Polycystic Ovarian Syndrome

The CMKLR1 knock out mice of C57BL/6J background is purchased from Deltagen Co., Ltd, is provided by Stanford University doctor ZABLE laboratory.C57BL/6J wild females mouse comes from Guangdong Medical Lab Animal Center.

Animal is supported under steady temperature and humidity, in 12 hours cycle light and dark receptacles.Feed and water can use free choice feeding.The program of all animals is carried out according to the program of animal welfare ethics committee approval.

Wild-type mice: female mice after birth the 19th day (D19) is randomly divided into: placebo, DHT group, CMKLR1 antagonist group, DHT+CMKLR1 antagonist group, every group of at least 10 mouse).

CMKLR1 Gene-Deficient Mice: female mice after birth the 19th day (D19) is randomly divided into: placebo, DHT group, every group of at least 10 mouse.

DHT group: it is subcutaneously implanted DHT sustained release particles (U.S., Sarasota, the innovation research institute of Florida State).7.5 milligrams of the DHT that these pellets include, continuous 90 days, daily releasing dosage was 83.3 micrograms).

Placebo: mouse is subcutaneously implanted placebo granulation 90 days.

CMKLR1 antagonist group: it is subcutaneously implanted 1mg CMKLR1 antagonist α-NETA slow-releasing pump.

DHT+CMKLR1 antagonist group: DHT sustained release particles are subcutaneously implanted, 7.5 milligrams of the DHT that pellet includes, continuous 90 days, daily releasing dosage was 83.3 micrograms.It is subcutaneously implanted 1mg CMKLR1 antagonist α-NETA slow-releasing pump.

It weighs in when starting and treatment end, execution mouse at the end for the treatment of phase 90 days.In addition, collecting blood sample and tissue at the end of 90-D treatment phase.Mouse is anaesthetized with isoflurane, is punctured after socket of the eye and collects blood sample.Ovary and uterus, sexual gland fat, weighing are separated, and is fixed overnight in 4% paraformaldehyde liquid stream body.In addition, in vitro tissue is rapidly frozen in liquid nitrogen, until being further processed.

Fig. 5 A and Fig. 5 B show the influence that the missing of CMKLR1 gene changes the oestrous cycle caused by protona.

As shown in Figure 5A, use the wild-type mice (WT-control) of placebo, 2-3 oestrous cycle is generally had in 12 days, and (each period is from proestrum (P), oestrus (E), the heat later period (M) arrives dioestrus (D))；And passing through the wild-type mice (WT-DHT) that protona (DHT) handles 90 days, physiological period is all in dioestrus (D), without the complete oestrous cycle.Protona has seriously affected the normal physiological period of mouse.

In Fig. 5 B, a is the comparison quantified between wild-type mice control group and two groups of processing group, and statistics has significant meaning (aP < 0.01).

The CMKLR1 Gene-Deficient Mice (cmklr1-/- control) for having used placebo, also has 2-3 oestrous cycle in 12 days.After inducing CMKLR1 Gene-Deficient Mice using protona (cmklr1-/- DHT), still there is more complete physiological period (P, E, M, D), there are 1 to 2 complete physiological periods.In Figure 1B, b is the comparison quantified between two groups of CMKLR1 gene delection, and statistics has significant meaning (bP < 0.05)；D is the comparison between the wild-type mice of protona processing and two groups of CMKLR1 Gene-Deficient Mice, and CMKLR1 gene delection significantly improves influence of the protona to mouse physiological period, and statistics has significant meaning (dP < 0.001).

WT, wild type: wild-type mice.Cmklr1-/and-: CMKLR1 Gene-Deficient Mice.Control (Ctl): control placebo.DHT, protona: the heeling-in experimental group of protona.P:proestrous: proestrum.D:diestrous: dioestrus.E:estrous: oestrus.M:metestrous: heat later period.Days: number of days.Estrous Cycles: oestrous cycle.

Fig. 6 shows the missing of CMKLR1 gene, to the shadow of hormonal readiness in mice serum caused by protona It rings.

Compare four groups of mouse processing group (WT-Control, WT-DHT, CMKLR1-/-- Control, CMKLR1-/-- DHT) content of double clear testosterones (DHT) in serum, wherein WT-Control and CMKLR1-/-- DHT content is all in 100pg/mL or so in Control group, and WT-DHT and CMKLR1-/-- DHT processing group, the content of DHT rises to 200pg/mL or so respectively in serum, it was demonstrated that protona processing group modeling success.

Then the level of estrogen in serum (estradiol) and progesterone (progesterone) is detected respectively: estrogen WT-Control and CMKLR1-/-- Control group maintains 5pg/mL or so, and DHT processing reduces the level of estrogen in WT mouse；In CMKLR1-/- mouse, the content for influencing estrogen in serum for handling not conspicuousness of DHT.Meanwhile the processing of DHT also reduces the content of progesterone in WT mice serum, and for CMKLR1-/- mouse, DHT does not influence the expression of progesterone normal level in serum.In Fig. 6, a is the comparison quantified between two groups of wild-type mice control group and DHT processing group；B is the comparison quantified between two groups of CMKLR1 gene delection control group and DHT processing group；D is the comparison between the wild-type mice of DHT protona processing and two groups of CMKLR1 Gene-Deficient Mice.P < 0.05, which represents in statistical difference, significant meaning.

Fig. 7 shows the missing of CMKLR1 gene, the influence to mouse ovarian structure caused by protona.

Compare four groups of mouse processing group (Wild type-placebo, wild type-DHT, CMKLR1-/-- placebo, CMKLR1-/-- DHT) ovary form, WT-Control and CMKLR1-/-- the ovary of Control mouse has the ovarian follicle and corpus luteum of each developmental stage.Most of ovarian follicle atrophy of the WT mouse (WT-DHT) of DHT processing, does not have corpus luteum in ovary.And the development of ovarian follicle is more normal in the CMKLR1- of DHT processing/- (CMKLR1-/-- DHT) mouse, can also be observed that complete corpus luteum.

Fig. 8 A and Fig. 8 B show the missing of CMKLR1 gene, the influence to mouse follicle cell apoptosis caused by protona.

The apoptotic signal (Tunnel dyeing-green) in four groups of mouse processing groups (WT-Control, WT-DHT, CMKLR1-/-- Control, CMKLR1-/-- DHT) ovary is compared, blue signal is the DAPI signal for contaminating core.Follicular cell (granulosa cell) in wild mouse (WT) and CMKLR1 Gene-Deficient Mice (CMKLR1-/-) control group ovary, thecacells (theca cell), and obvious apoptosis coloring (green) is not all found in ovarian follicle interstitial cell (interstitial cell), and in the ovary of protona (DHT) processing group in wild mouse (WT) and CMKLR1 Gene-Deficient Mice (CMKLR1-/-), follicular cell (granulosa cell), thecacells (theca cell), and there is apparent coloring (as schemed in ovarian follicle interstitial cell (interstitial cell) Shown in 8A).Wherein, four groups of mouse processing groups are calculated in Fig. 8 B respectively at follicular cell (granulosa cell), thecacells (theca cell), and in ovarian follicle interstitial cell (interstitial cell) apoptotic cell quantity, statistical analysis display, DHT processing increases the quantity of apoptotic cell in three kinds of tissues, wherein DHT handles the apoptotic cell being significantly increased in CMKLR1-/- mouse in granular cell (granulosa).DHT processing is so that in theca cell (theca) and interstitial cell (interstitial cell) apoptotic signal increase of wild mouse, correspondingly, DHT processing causes CMKLR1 Gene-Deficient Mice (CMKLR1-/-) theca cell and interstitial cell apoptotic signal obviously weaker than wild-type mice.In figure, a is the comparison quantified between two groups of wild-type mice control group and DHT processing group；B is the comparison quantified between two groups of CMKLR1 gene delection control group and DHT processing group；D is the comparison between the wild-type mice of DHT protona processing and two groups of CMKLR1 Gene-Deficient Mice.P < 0.05, which represents in statistical difference, significant meaning.

Fig. 9 shows the missing of CMKLR1 gene, the influence expressed hormone sensitive lipase gene relative enzyme gene in ovary tissue caused by protona.

In four groups of mouse processing group (WT-Control, WT-DHT, CMKLR1-/-- Control, CMKLR1-/-- DHT) in, have detected steroid hormone synthesis acute regulatory protein (the steroidogenic acute regulatoryprotein in ovary, StAR), cholesterol side-chain cleavage (cholesterol-side-chain cleavage enzyme, P450scc), 3 beta-hydroxysteroid dehydrogenases (3bHSD), the expression of bone morphogenetic protein 2 (BMP2) and bone morphogenetic protein 4 (BMP4) mRNA level in-site.

The expression of StAR, P450scc, 3bHSD do not have apparent difference in wild mouse (WT) and CMKLR1 Gene-Deficient Mice (CMKLR1-/-) control treatment group ovary.After protona (DHT) processing, the expression of three genes conspicuousness in WT mouse is reduced, and in CMKLR1-/- group, three genes increase compared to WT group expression quantity conspicuousness.

BMP2 and BMP4 is the signaling molecule in BMP signal path.Expression of the BMP2 in CMKLR1-/- mouse ovarian is significantly increased compared with the expression in wild mouse ovary.And the expression that DHT handles more BMP2 does not influence significantly.

And BMP4 expresses indifference in WT and CMKLR1-/- control group mice ovary, DHT processing increases expression of the BMP4 in wild mouse ovarian, but increases in CMKLR1-/- group without conspicuousness.

In Fig. 9, a is the comparison quantified between two groups of wild-type mice control group and DHT processing group；B is the comparison quantified between two groups of CMKLR1 gene delection control group and DHT processing group；D is the comparison between the wild-type mice of DHT protona processing and two groups of CMKLR1 Gene-Deficient Mice.P < 0.05, which represents in statistical difference, to be had significantly Meaning.

Figure 10 shows CMKLR1 specific antagonists, α-NETA, the influence to gene expressions such as mouse ovarian structure caused by protona, hormone sensitive lipase gene enzymes.

Observe the form of four groups of wild mouse (control, NETA, DHT, DHT+NETA) ovaries.Control (solvent control group), α-NETA (α-NETA individually processing group), DHT (protona individually processing group), DHT+NETA (α-NETA and protona cooperate with processing group).

The quantity of corpus luteum (corpus luteum, CL) does not have apparent difference in solvent control group and NETA processing group ovary；After DHT processing, corpus luteum is not observed in mouse ovarian, and is jointly processed by the ovary of mouse the appearance for still having corpus luteum with NETA and DHT.

DHT in this four groups of mice serums is detected respectively, the content of estrogen (Estradiol) and progesterone (progesterone), the content (proving DHT modeling success) that wherein DHT is individually handled and DHT cooperates with processing to increase DHT in mice serum with NETA, DHT individually handles the content for reducing serum progesterone, NETA cooperates with processing with DHT, the content of DHT in serum is not influenced, but increases progesterone level in serum caused by DHT is handled.The content of estrogen does not receive influence in serum.

Detect the expression of hormone key synzyme 3 beta-hydroxysteroid dehydrogenase (3bHSD) mRNA level in-site in ovary, as the result is shown, DHT processing reduces 3b-HSD mRNA level in-site, and the independent processing of NETA does not influence 3b-HSD mRNA level in-site, but after NETA and DHT are jointly processed by, 3b-HSD mRNA level in-site is increased.

Caspase -3 (Caspase-3) is horizontal to be increased, and can show that apoptotic signal increases in ovary.DHT individually handle can conspicuousness increase ovary apoptosis correlation enzyme Caspase3 expression, and cooperateed with NETA processing after, NETA can reduce the stimulation that DHT expresses Caspase3.*P<0.05,**P<0.01,***P<0.001.

(2) DHEA Experimental Mice Model of Polycystic Ovarian Syndrome

Wild-type mice: female mice after birth the 19th day (D19) is randomly divided into: control group, DHEA group, CMKLR1 antagonist group, DHEA+CMKLR1 antagonist group, every group of at least 10 mouse).

CMKLR1 Gene-Deficient Mice: female mice after birth the 19th day (D19) is randomly divided into: control group, DHEA group, every group of at least 10 mouse).

Control group: sesame oil is subcutaneously injected according to 6mg/100g, according to 1mg/kg intraperitoneal injection of saline.

DHEA group: being subcutaneously injected DHEA according to 6mg/100g, and injecting normal saline is injected intraperitoneally according to 1mg/kg.

CMKLR1 antagonist group: sesame oil is subcutaneously injected according to 6mg/100g, is injected intraperitoneally according to 1mg/kg CMKLR1 antagonist α-NETA.

DHEA+CMKLR1 antagonist group: being subcutaneously injected DHEA according to 6mg/100g, and CMKLR1 antagonist α-NETA is injected intraperitoneally according to 1mg/kg.

It weighs in when starting and treatment end, execution mouse at the end for the treatment of phase 21 days.In addition, collecting blood sample and tissue at the end of 21 days treatment phases.Mouse is anaesthetized with isoflurane, is punctured after socket of the eye and collects blood sample.Ovary and uterus, sexual gland fat, weighing are separated, and is fixed overnight in 4% paraformaldehyde liquid stream body.In addition, in vitro tissue is rapidly frozen in liquid nitrogen, until being further processed.

Figure 11 shows CMKLR1 specific antagonists α-NETA, the influence to mouse ovarian structure caused by DHEA.

Ovarian follicle form compares in ovary in four groups of mouse processing groups (cnotrol, α-NETA, DHEA, DHEA+ α-NETA).Control (solvent control group), α-NETA (α-NETA individually processing group), DHEA (dehydrobenzene individually processing group), DHEA+NETA (α-NETA and dehydrobenzene cooperate with processing group).In control and NETA processing group, it can be observed that the complete second level ovarian follicle of form, illustrates that the development of the more ovarian follicles of the processing of solvent control group and NETA does not influence significantly.The processing of DHEA does not find the second level ovarian follicle reached maturity and preovulatory follicle so that apparent change has occurred in the development of ovarian follicle in ovary.And in DHEA+NETA processing group, the development of second level ovarian follicle is obviously improved, and has the ovarian follicle reached maturity, and illustrates the protective effect of development of the NETA to ovarian follicle.

Figure 12 A and Figure 12 B show CMKLR1 specific antagonists α-NETA, the influence to mouse follicle cell apoptosis caused by DHEA.

In four groups of wild mouse (WT) processing groups (cnotrol, NETA, DHEA, DHEA+NETA) in ovary apoptotic signal comparison.Apoptotic signal (Tunnel dyeing-green), blue signal are the DAPI signal for contaminating core.Control (solvent control group), α-NETA (α-NETA individually processing group), DHEA (dehydrobenzene individually processing group), DHEA+NETA (α-NETA and dehydrobenzene cooperate with processing group).

Figure 12 A, in wild mouse dehydrobenzene processing group (WT-DHEA), granular cell (the granulosa cell of ovarian follicle, GC), theca cell (Theca cell, TC) and in interstitial cell (interstitial cell, IC) there is more apoptotic cell；And cooperateed with NETA after processing (WT-NETA-DHEA), apoptotic cell significantly reduces in theca cell (TC), and the apoptotic cell in interstitial cell (IC) also substantially reduces.Figure 12 B distinguishes the comparing calculation quantity of WT mouse apoptotic cell in GC, TC and IC in Ctrl, NETA, DHEA, DHEA+NETA processing group.*P<0.05,**P<0.01,***P<0.001.

Claims (15)

1. The application in the drug for preventing and/or treating female reproduction disease is being prepared for the antagonist of CMKLR1.
2. Application according to claim 1, wherein the antagonist for CMKLR1 is the reagent for reducing the effect of expression and/or antagonism CMKLR1 of CMKLR1, such as may include siRNA, shRNA, antisense RNA, antibody or combinations thereof.
3. Application according to claim 1, wherein the antagonist for CMKLR1 is shRNA, and/or α-NETA.
4. Application according to claim 3, wherein the shRNA has the sequence as shown in SEQ ID No.1.
5. Application according to claim 1, wherein the female reproduction disease includes Stein-Leventhal syndrome and/or oophoroma.
6. Application according to claim 1, wherein described to prevent and/or treat female reproduction disease to include: to alleviate Stein-Leventhal syndrome symptom, and/or inhibit human epithelial ovarian carcinoma cells proliferation.
7. A kind of pharmaceutical composition prevented and/or treat female reproduction disease, the pharmaceutical composition include the antagonist for CMKLR1.
8. Pharmaceutical composition according to claim 7, wherein the antagonist for CMKLR1 is to reduce expression and/or reagent, such as siRNA, shRNA, antisense RNA, antibody of effect of antagonism CMKLR1 of CMKLR1 or combinations thereof.
9. Pharmaceutical composition according to claim 7, wherein the antagonist for CMKLR1 is shRNA and/or α-NETA.
10. Pharmaceutical composition according to claim 9, wherein the shRNA has the sequence as shown in SEQ ID No.1.
11. A method of prevention and/or treatment female reproduction disease, this method comprises: the effect of the expression and/or antagonism CMKLR1 of CMKLR1 is reduced, to prevent and/or treat female reproduction disease using CMKLR1 as target spot.
12. According to the method for claim 11, wherein be the effect that the expression and/or antagonism CMKLR1 of CMKLR1 are reduced using the antagonist for CMKLR1, the antagonist for CMKLR1 includes SiRNA, shRNA, antisense RNA, antibody or combinations thereof.
13. According to the method for claim 11, wherein the antagonist for CMKLR1 is shRNA and/or α-NETA, and this method is the expression of weak CMKLR1 to be struck using shRNA, or utilize the effect of α-NETA antagonism CMKLR1.
14. According to the method for claim 13, wherein the shRNA has the sequence as shown in SEQ ID No.1.
15. According to the method for claim 11, this method is for alleviating Stein-Leventhal syndrome symptom, and/or inhibition human epithelial ovarian carcinoma cells proliferation.