CN109957620B

CN109957620B - GPR1 target and application of antagonist and anti-tumor related thereof

Info

Publication number: CN109957620B
Application number: CN201711336735.1A
Authority: CN
Inventors: 张键; 杨雅莉; 黄斌斌; 代小勇; 陈杰; 肖天霞
Original assignee: Shenzhen Institute of Advanced Technology of CAS
Current assignee: Shenzhen Institute of Advanced Technology of CAS
Priority date: 2017-12-14
Filing date: 2017-12-14
Publication date: 2023-10-03
Anticipated expiration: 2037-12-14
Also published as: CN109957620A

Abstract

The invention provides GPR1 targets and application of antagonists and anti-tumor related applications thereof. The invention discloses an application of GPR1 gene or an antagonist of GPR1 protein in preparing a medicament for preventing or treating tumor or proliferation and migration thereof. Also disclosed is the use of the GPR1 gene or GPR1 protein as a therapeutic target for the prevention and/or treatment of tumors, or as a diagnostic target for tumors, or as a drug target for the treatment or prevention of tumors.

Description

GPR1 target and application of antagonist and anti-tumor related thereof

Technical Field

The invention belongs to the field of biological medicine, and particularly relates to application of GPR1 and an antagonist thereof in anti-tumor aspect.

Background

Chemerin on the one hand acts as a chemokine, chemotactic dendritic cells and macrophages, bridging between immunity and adaptive immunity; on the other hand, the novel fat factor is secreted by adipose tissues, regulates the differentiation and lipolysis of fat cells, and can promote the biological effects of insulin signal transduction pathways in fat cells and the like. More and more studies have shown a close correlation between abnormal signals of Chemerin and its receptors and the occurrence and progression of cancer, with low, and even undetectable levels of Chemerin expression within most tumors, but higher levels of Chemerin expression in paracancerous tissues, as well as in distant normal tissues.

GPR1, one of three receptors of Chemerin, belongs to a member of the superfamily of G Protein Coupled Receptors (GPCRs), has 7 transmembrane helix (7 TM) structures and is expressed in both adipose and gonadal tissues. GPCRs play an important role in the intracellular transduction of extracellular signals, regulating cell motility, growth and gene transcription, three factors critical in cancer biology. In the last decade, mediated signaling pathways have been demonstrated to be key regulators of proto-oncogene signaling and to be good drug targets, and 60% of drugs currently on the market are designed for this receptor. However, at present, no drug is yet available to treat clinical cancer directly against GPR 1. Therefore, the GPR1 is used as a target, and the screening of the novel anti-cancer polypeptide medicaments and the humanized antibodies has important social significance and wide economic market.

Choriocarcinoma (chord)

Choriocarcinoma is a highly malignant tumor of chorionic epithelial cells (i.e., trophoblast cells) that occur in the outer layers of the placenta. Subsequent to grape embryo, abortion or term delivery. The incidence rate is 0.0001% -0.36%, and a small number can occur after ectopic pregnancy. Choriocarcinoma damages normal functions of ovaries and seriously damages reproductive health of women of childbearing age. There are various infection routes of choriocarcinoma, which can be affected by diseases of adjacent organs, such as appendix. Can also be spread through lymphatic channels and blood, and the like, and can cause velvet symptoms without attention to sanitation, if not treated in time, the velvet can develop into chronic choriocarcinoma, block fallopian tubes, and cause ectopic pregnancy or infertility.

The treatment of choriocarcinoma is mainly chemotherapy, and the operation is auxiliary. Chemical drug therapy is most often used, and in general early cases, one drug can be used alone, with 5-Fu being the first choice. If the illness is urgent or has reached late, two or more drugs should be used together. A common use is 5-fluorouracil (5-Fu) plus dactinomycin (ksm). The 5-Fu and ksm have the advantages of good curative effect, small side effect and effective on the transfer of lung, alimentary canal, urinary tract and genital tract. Can be used for intravenous administration, arterial infusion, intracavity or intratumoral injection, or oral administration.

In the case of large focus, it is estimated that chemotherapy cannot be completely treated or HCG drops slowly in the treatment process, and the bleeding of the intrahepatic transfer focus in the uterine perforation is also an important method for treating choriocarcinoma in order to save the life of patients. General minor extensive hysterectomy and bilateral adnexal large omentum, parauterine venous plexus and ovarian venous plexus resections.

Breast Cancer (Breast Cancer)

Breast cancer is the deadly cancer of the second highest mortality rate worldwide next to lung cancer, the age-standardized incidence rate of breast cancer of China females is 21.6/10 ten thousand, and the 1 st place of female cancer incidence rate is occupied; mortality was 5.7/10 ten thousand, at 6 th cancer death in women. 4% -6% of breast cancers are metastatic breast cancers when diagnosed, and 30% -40% of early patients receiving adjuvant therapy can develop metastatic breast cancers, and the survival rate of patients in 5 years is about 20%.

The study of the association of obesity with breast cancer was first seen in the 60 s of the 20 th century, and the case control study by Dewaard et al was first to suggest that the onset of breast cancer is prone to postmenopausal women with obesity and hypertension. It was also found in animal experimental studies that obese mice had significantly increased tumor growth rate compared to the control group. Meta analysis shows that the risk of suffering from breast cancer increases with increasing BMI, and patients with BMI > 30kg/m2 have 1.3-2 times the risk of suffering from breast cancer than normal individuals, and obesity can significantly increase the risk of female suffering from breast cancer.

Disclosure of Invention

The main purpose of the invention is to find a new anti-tumor target so as to better prevent and/or treat tumors and control proliferation and migration of the tumors. The inventors found in the study that gene expression of GPR1 was interfered with by gene knockout techniques or shRNA approaches, or alternatively, specific antibodies were used. Interfering the action of GPR1 receptor, can effectively inhibit proliferation and migration of human choriocarcinoma cells and breast cancer cells in vitro and in vivo.

In one aspect, the invention provides the use of a GPR1 gene or GPR1 protein for screening for a drug target for the treatment or prophylaxis of a tumor.

In another aspect, the invention provides the use of a GPR1 gene or GPR1 protein as a therapeutic target for the prevention and/or treatment of tumors, or as a diagnostic target for tumors.

In another aspect, the invention provides the use of an antagonist of the GPR1 gene or GPR1 protein in the manufacture of a medicament for the prevention or treatment of a tumor.

In a specific embodiment of the invention, the use of an antagonist of the GPR1 gene or GPR1 protein for the preparation of a medicament for the prevention or treatment of tumor proliferation and migration is disclosed.

In another aspect, the invention provides a use of an antagonist of the GPR1 gene or GPR1 protein for the prevention or treatment of a tumor.

Antagonists of the GPR1 gene or protein are selected from GPR1 antibodies, GPR1 receptor antibodies, modified GPR1, partial peptides of GPR1, siRNAs, shRNAs targeting the GPR1 gene sequence, antisense molecules and dnase, or expression vectors comprising siRNAs, shRNAs, antisense molecules; for example, the shRNA is shown as SEQ ID No. 1.

In another specific experiment of the invention, a shRNA sequence which specifically interferes with GPR1 gene expression is utilized to establish a human choriocarcinoma cell JEG-3 which knocks down the GPR1 gene by shRNA interference, and in vitro cell population proliferation experiments show that compared with a control group, proliferation of the human choriocarcinoma cell which knockdown the GPR1 gene is obviously inhibited. Further, it was found through scratch experiments that the migration ability of human choriocarcinoma cells knocked out of the GPR1 gene was significantly inhibited compared to the control group.

In a further aspect the invention provides an antagonist of the GPR1 gene or GPR1 protein, which is an expression vector comprising a promoter and a nucleic acid insert operably linked to the promoter, said nucleic acid insert being a shRNA, e.g. as set forth in SEQ ID No. 1.

In a specific experiment of the invention, a shRNA sequence which specifically interferes with GPR1 gene expression is utilized to establish human breast cancer cells HCC1937 and MDA-MAB-231 which knock down the GPR1 gene by shRNA interference, and in vitro cell population proliferation experiments show that proliferation of the human breast cancer cells which knock down the GPR1 gene is obviously inhibited compared with a control group. Further, it was found through scratch experiments that the migration ability of human breast cancer cells knocked out of the GPR1 gene was significantly inhibited compared to the control group.

Accordingly, the present invention provides a method of preventing and/or treating a tumour, the method comprising: targeting GPR1, reducing the level of expression of GPR1 and/or antagonizing the effects of GPR1 to prevent and/or treat tumors. Specifically, it is possible to reduce the expression level of GPR1 (knock-out GPR1 gene or knock-down GPR1 gene expression level) and/or antagonize the effect of GPR1 using an antagonist against GPR 1.

In the present invention, the GPR1 (G Protein-Coupled Receptor 1, G Protein-Coupled Receptor-1) is one of the receptors of chemokine/adipokine chemerin, belonging to the G Protein-Coupled Receptor family.

The GPR1 gene according to the invention is a gene known from the prior art and is the only sequence, geneID at NCBI: NM-146250. The specific sequence is shown in SEQ ID No. 4:

atggaagtctcaaaggaaatgttatttgaggagttggacaactattcctatgccttagattattactcccaggagtctgacccggaggagaaggtgtacctgggactcgttcactggatctccctgttcttatatgccctagcatttgttctgggcatcccaggaaatgccatcgtcatttggctcatgggattcaagtggaagaagacagtcaccactctttggttcctcaatctggccatcgcagacttcatctttgttctcttcctgcccctgtacatttcctacgtggccttgagtttccactggccctttggcctgtggctctgcaaggttaattccttcattgcccaactgaacatgttttccagtgttttcttcttgacagtgatcagcctggaccgctacatccacttgctccatcctggcttgtctcatcggcaccggactctaaagagctcactggttgttgttatacttgtctggctgttggcttctctgcttggaggtcctaccttatacttccgggacaccatggaggtcaacaaccacatcatttgttataataatttccaggagcatgaactcaccttgatgagacaccatgttctgacctgggtgaagttcctctttggctacctcttccctttgctaaccatgagctcctgctacttgtgcctcatcttcaagatgaaaaagcggaacatcctgatatctagaaagcatctctggatgatcctgtctgtggtcattgccttcttggtttgctggaccccttatcacctgtttagcatctgggagctcagcattcatcacaacagctctttccagaatgtgctgcagggtggaatccccctctcaactggcttagccttcctcaatagctgcttgaatcccatcctttacgtcctaataagcaagacgttccaagcccgcttcagggcctctgttgctgaggtactaaagcgttcgctgtgggaagccagctgctctggtacagtcagtgaacaactcaggagtgctgaaaccaagagcctgtctctcctagaaactgcccagtga SEQ ID No.4。

in the present invention, the terms "tumor" and "cancer" are used in the same sense, which are abnormal division propagation of cells in a tissue. Tumors generally exhibit a partial or complete lack of structural organization and functional coordination with normal tissue, and often form distinct tissue masses, which may be benign or malignant. The term as used herein may be malignant or malignant, as well as benign. Often, unless adequate treatment is given, these malignant tumors can invade around tissues, can metastasize to different locations, and may recur and cause death of the patient after attempted removal.

In the present invention, the tumor is preferably choriocarcinoma, placenta villus cancer, ovarian cancer, breast cancer, uterine cancer, cervical cancer, endometrial cancer, prostate cancer, liver cancer, pancreatic cancer, skin cancer, malignant melanoma, head and neck cancer, sarcoma, bile duct cancer, bladder cancer, kidney cancer, colon cancer, testicular cancer, lung cancer, stomach cancer.

In the present invention, the treatment and prevention of tumor means prevention or treatment of proliferation and migration of tumor.

In the present invention, the terms "antagonist" and "inhibitor" are used in the same sense and refer to any agent that reduces the level of expression of GPR1, antagonizes the effects of GPR1, and inhibits the binding of GPR1 to a ligand as described for GPR 1. Such antagonists accomplish this by a variety of means. One class of antagonists will bind GPR1 protein with sufficient affinity and specificity to neutralize the biological effects of GPR1 protein. Such molecules include antibodies and antibody fragments. Another class of antagonists comprises fragments of proteins, muteins or small organic molecules, i.e. mimetic peptides, which will bind to GPR1 or GPR1 binding partners, e.g. compounds or small molecule polypeptides having a blocking effect on the binding of chemokines to GPR1, thereby inhibiting the biological activity of GPR 1. The GPR1 antagonist may be of any of these classes, as long as it is a substance that inhibits the biological activity of GPR 1. GPR1 antagonists include GPR1 antibodies, GPR1 receptor antibodies, modified GPR1 and partial peptides of GPR 1. Another class of GPR1 antagonists includes siRNAs, shRNAs, antisense molecules and DNases disclosed herein that target GPR1 gene sequences as known in the art. Such agents are available to those skilled in the art in accordance with the prior art and may be any antagonist known in the art that reduces the level of expression of GPR1 and/or antagonizes the effects of GPR1, as such, or may be agents modified based on this formula that still have the function of reducing the level of expression of GPR1 and/or antagonizing the effects of GPR 1.

In a preferred embodiment of the invention, the antagonist against GPR1 is a small molecule antagonist, such as shRNA or the like. More preferably, the shRNA has a sequence as shown in SEQ ID No. 1.

Advantageous effects

The invention proves the connection between GPR1 gene and various tumors, can be used as a target point for preventing and treating choriocarcinoma and breast cancer, and can effectively inhibit proliferation and migration of choriocarcinoma and breast cancer cells by utilizing any technology to interfere GPR1 gene expression or interfere GPR1 action; provides basis for preventing, diagnosing and treating diseases.

Drawings

Fig. 1: shRNA GPR1 inhibited the proliferation ability of JEG3 choriocarcinoma cells upon knockdown of GPR1 protein expression levels.

Fig. 2: shRNA GPR1 inhibited JEG3 choriocarcinoma cell migration ability upon knockdown of GPR1 protein expression levels.

Fig. 3: shRNA GPR1 knockdown GPR1 protein expression levels inhibits breast cancer cell proliferation capacity.

Fig. 4: shRNA GPR1 knockdown GPR1 protein expression levels inhibits breast cancer cell migration ability.

Detailed Description

For a clearer understanding of the present invention, the present invention will now be further described with reference to the following examples and drawings. The examples are for illustration only and are not intended to limit the invention in any way. In the examples, each of the starting reagent materials is commercially available, and the experimental methods without specifying the specific conditions are conventional methods and conventional conditions well known in the art, or according to the conditions recommended by the instrument manufacturer.

Example 1: interfering with GPR1 gene expression, or antagonizing GPR1 effect, can inhibit proliferation and migration of human choriocarcinoma cells effectively.

This example demonstrates that interfering with GPR1 gene expression, or antagonizing GPR1, is effective in inhibiting proliferation and migration of human choriocarcinoma cells. Wherein, a shRNA sequence which specifically interferes with GPR1 gene expression is designed, and the shRNA is utilized to interfere with a human choriocarcinoma cell line which knocks down GPR1 gene.

In vitro cell population proliferation experiments show that proliferation of human choriocarcinoma cells knocked down by GPR1 gene is significantly inhibited compared with a control group. Further, it was found through scratch experiments that the migration ability of human choriocarcinoma cells knocked out of the GPR1 gene was significantly inhibited compared to the control group.

The method comprises the following steps:

1. a human choriocarcinoma cell line knocked out of the GPR1 gene was established.

The human GPR1 gene shRNA used in this experiment was pSM2c-Hu-shGPR1 (purchased from Open Biosystems), a small Hairpin sequence:

5'-TGCTGTTGACAGTGAGCGCACTCTCTGATTGTCATTATATTAGTGAAGCCACAGATGTAATATAATGACAATCAGAGAGTTTGCCTACTGCCTCGGA-3' (SEQ ID No. 1). The control group was pSM2c-Hu-scramble shRNA.

(1) Selecting growing choriocarcinoma cells: JEG3 at 5X 10 day before transfection ⁵ Inoculating the cells/hole into a 6-hole plate, and culturing until the cell fusion degree is 60% after the second day;

(2) the next day of transfection, 3. Mu.g of plasmid was diluted with 200. Mu.L of opti-MEM medium per one culture well of the 6-well plate, and 6. Mu.L of liposome Lipofectamine 2000 was diluted with 200. Mu.L of opti-MEM medium, and the mixture was gently mixed, followed by standing at room temperature for 5 minutes;

(3) gently mixing the two diluted solutions, and standing at room temperature for 20 minutes;

(4) gently rinsing cells to be transfected once by PBS, adding 600 mu L of opti-MEM culture medium, then gently adding the mixed diluent into a culture hole, and placing the culture hole in a carbon dioxide incubator for culture;

(5) after 4-6 hours of culture, the culture medium used for transfection is discarded, and 3mL of complete culture medium is added into the hole;

(6) selecting culture medium containing 1 μg/mL puromycin (puromycin) for screening after 48 hours; and obtaining the choriocarcinoma cell line for stably expressing the GPR1shRNA after the cell does not die any more.

(7) Total RNA was extracted with TRIzol, 2. Mu.g RNA was quantified for reverse transcription (reverse transcription kit, available from Promega) and qPCR was performed with specific primer sequences.

The specific primer sequence used was the Hu-GPR1 primer sequence:

Fw 5’-AATGCCATCGTCATTTGGTT-3’(SEQ ID No.2)

Rv 5’-CAACTGGGCAGTGAAGGAAT-3’(SEQ ID No.3)

(8) compared with the choriocarcinoma cells transfected with pSM2c-Hu-scramble shRNA (i.e., the choriocarcinoma cell line transfected with empty vector, JEG 3), the GPR1 gene expression level was only 38% + -2.57%, which was used as a human choriocarcinoma cell line knocked out of the GPR1 gene and was named: JEG3-shGPR1/LRH; the subsequent experiments can be used.

2. In vitro proliferation and migration experiments of human choriocarcinoma cell lines knocked out of GPR1 gene.

(1) MTT proliferation assay:

1) Inoculating choriocarcinoma cells JEG3-shGPR1/LRH into 96-well cell culture plates at 10000 per well density, wherein the volume of each well of culture medium is 200 mu L, and culturing for 0 hr, 12 hr, 24 hr, 48 hr and 72 hr respectively; negative controls were also established with the choriocarcinoma cell line transfected with empty vector.

2) 20 mu L of MTT solution (5 mg/mL) are respectively placed into a carbon dioxide incubator at different detection time points to be cultured for 4 hours;

3) The supernatant was discarded, 150. Mu.L of DMSO (dimethyl sulfoxide) was added, the mixture was shaken for 10 minutes, and the detection was performed by selecting a wavelength of 490nm on an ELISA reader, thereby calculating the cell proliferation rate. The OD measured on the microplate reader at different times of cultivation was different, and the ratio of the OD at different time points to the OD at 0 hour was the cell proliferation rate.

The test results referring to fig. 1, the test results show that compared with the choriocarcinoma cell line transfected with the empty vector, the human choriocarcinoma cell line JEG3-shGPR1/LRH with the GPR1 gene knocked down has significantly reduced cell proliferation rate, the cell proliferation rates at 24 hours, 48 hours and 72 hours are significantly different, and the difference between the two gradually increases with the increase of time: at 24 hours, the control proliferated 1.69-fold and the GPR1 knockdown proliferated 1.4-fold; at 48 hours, the control proliferated 3.3-fold and the GPR1 knockdown proliferated 2.98-fold; at 72 hours, the control proliferated 5.6-fold and the GPR1 knockdown proliferated 4.57-fold. The test results show that when the GPR1 gene is inhibited, the proliferation rate of the corresponding choriocarcinoma cells is also reduced, namely, the proliferation of the choriocarcinoma cells can be effectively inhibited by inhibiting the GPR1 gene or the expression thereof.

(2) Scratch test

1) Firstly, uniformly scribing transverse lines on the back of a 6-hole plate by using a marker pen, and traversing the through holes approximately every 0.5-1 cm. At least 5 lines per hole;

2) About 2X 10 of each of the above-mentioned substances was added to the wells ⁶ Individual JEG3 cells: JEG3-shGPR1/LRH and untreated choriocarcinoma cells were confluent overnight;

3) The next day, the gun head is used for scribing the cross line perpendicular to the back;

4) Washing cells with PBS for 3 times, removing the scraped cells, and adding a serum-free or low-serum culture medium;

5) Culturing in a 37 ℃ incubator for 0 hour, 12 hours, sampling and photographing after 24 hours.

The test results are shown in figure 2. Wherein pSM2C shGPR1 is JEG3-shGPR1/LRH group, pSM2C empty vector is choriocarcinoma cell line transfected with empty vector. Normalized statistics of migration distances at 12 hours and 24 hours revealed that GPR1 inhibited choriocarcinoma cells migrate distances significantly lower than choriocarcinoma cell lines transfected with empty vector (right panel), and that there was a significant difference at 12 hours and 24 hours: at 12 hours, the control group was 1 and the gpr1 knockout group was 0.709; at 24 hours, the control group was 1 and the gpr1 knockout group was 0.762. The test results show that GRP1 inhibiting choriocarcinoma cells can effectively inhibit migration of cells.

Example 2, interfering with GPR1 gene expression, or antagonizing GPR1 effects, is effective in inhibiting proliferation and migration of human breast cancer cells.

This example demonstrates that interfering with GPR1 gene expression, or antagonizing GPR1, is effective in inhibiting proliferation and migration of human breast cancer cells. Wherein, a shRNA sequence which specifically interferes with GPR1 gene expression is designed, and the shRNA is utilized to interfere with a human breast cancer cell line which knocks down the GPR1 gene.

In vitro cell population proliferation experiments show that compared with a control group, proliferation of human breast cancer cells knocked out of the GPR1 gene is significantly inhibited, and as shown in FIG. 4, HCC1937 cells proliferate 2.08 times in the control group and 1.3 times in the knocked out GPR1 genome at 24 hours; at 48 hours, the control proliferated 2.85-fold, and the knocked down GPR1 genome proliferated 1.98-fold; at 72 hours, the control proliferated 4.78-fold and the knockdown GPR1 genome proliferated 3.51-fold. MDA-MB-231 cells proliferated 3.01 times in the control group and 1.97 times in the knocked-down GPR1 genome at 24 hours; at 48 hours, the control proliferated 4.2-fold, and the knocked down GPR1 genome proliferated 2.94-fold; at 72 hours, the control proliferated 6.77-fold, and the knockdown GPR1 genome proliferated 5.23-fold. Further, it was found through scratch experiments that the migration ability of human breast cancer cells knocked out of GPR1 gene was significantly inhibited compared to the control group: HCC1937 cells 24 hours, control group had a migration distance of 0.26cm, knocked down GPR1 genome had a migration distance of 0.08cm; at 48 hours, the control group had a migration distance of 0.46cm and the knockdown GPR1 genome had a migration distance of 0.21cm. The migration distance of the control group was 0.36cm and the migration distance of the knocked down GPR1 genome was 0.29cm at 24 hours for MDA-MB-231 cells; at 48 hours, the control migration distance increased by 0.33cm, while the knockdown GPR1 genome migration distance increased by only 0.16cm.

The specific test method is as follows:

1. a GPR1 gene knockdown human breast cancer cell line was established.

The human GPR1 gene shRNA used in this experiment was pSM2c-Hu-shGPR1 (purchased from Open Biosystems), a Hairpin sequence: 5'-TGCTGTTGACAGTGAGCGCACTCTCTGATTGTCATTATATTAGTGAAGCCACAGATGTAATATAATGACAATCAGAGAGTTTGCCTACTGCCTCGGA-3' (SEQ ID No. 1). The control group was untreated wild-type cells.

(1) Selecting breast cancer cells with vigorous growth: HCC1937 and MDA-MAB-231 at 5X 10 a day prior to transfection ⁵ Inoculating the cells/hole into a 6-hole plate, and culturing until the cell fusion degree is 60% after the second day;

(4) gently rinsing the cells to be transfected once by PBS, adding 600 mu Lopti-MEM culture medium, then gently adding the mixed diluent into a culture hole, and placing the culture hole in a carbon dioxide incubator for culture;

The specific primer sequence used was the Hu-GPR1 primer sequence:

Fw 5’-AATGCCATCGTCATTTGGTT-3’(SEQ ID No.2)

Rv 5’-CAACTGGGCAGTGAAGGAAT-3’(SEQ ID No.3)

(8) compared to the pSM2c-Hu-scramble shRNA transfected, GPR1 gene expression level was only 37% + -2.97% of that (wild group HCC 1937), as a human breast cancer cell line knocked out of GPR1 gene, and was named: HCC1937-shGPR1/LRH and MDA-MAB-231-shGPR1/LRH; the subsequent experiments can be used.

2. In vitro proliferation and migration experiments of human breast cancer cell lines knocked out of the GPR1 gene.

(1) MTT proliferation assay:

1) Breast cancer cells are inoculated into a 96-well cell culture plate at a density of 2000 cells/well, and the volume of each well of culture medium is 200 mu L, and the breast cancer cells are respectively cultured for 12 hours, 24 hours, 48 hours and 72 hours; negative controls were also established.

3) The supernatant was discarded, 150. Mu.L of DMSO (dimethyl sulfoxide) was added, the mixture was shaken for 10 minutes, and the detection was performed by selecting a wavelength of 490nm on an ELISA reader, thereby calculating the cell proliferation rate. The test results are shown in FIG. 3. From fig. 3, it can be seen that the proliferation rate of cells was significantly reduced relative to the control group by the interference of shRNA for both breast cancer cells. And this decrease in the rate of increase can continue.

(2) Scratch test

2) About 5X 10 of each of the above-mentioned substances was added to the wells ⁵ Breast cancer cells: spreading overnight;

5) Culturing in a 37 ℃ incubator, sampling and photographing after 24 hours and 48 hours.

The test results are shown in figure 4. Wherein in the statistics of migration distances of 24 hours and 24-48 hours for both HCC1937 and MDA-MB-231, it can be seen that GPR1 inhibited breast cancer cells migrate significantly less than untreated breast cancer cells, and differ significantly at both 24 hours and 48 hours. The migration distance between 24 and 48 hours was less than that of 24 hours, indicating that the migration ability of the cells was decreased with the increase of time. The test results show that GRP1 inhibiting breast cancer cells can effectively inhibit migration of cells, and the effect is more and more obvious with time.

While the invention has been illustrated and described with reference to certain specific embodiments, it is not intended to be limited to the details shown. Rather, the invention relates to GPR1 antagonist polypeptides, polynucleotides, antibodies, apparatus and kits disclosed herein and uses thereof, as well as to control GPR1 levels, and various modifications may be made in the details within the scope and range of equivalents of the claims and without departing from the spirit of the invention.

SEQUENCE LISTING

<110> Shenzhen advanced technology research institute

<120> GPR1 target and application of antagonist and anti-tumor related thereof

<130> CP11701175C

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 97

<212> DNA

<213> artificial sequence

<400> 1

tgctgttgac agtgagcgca ctctctgatt gtcattatat tagtgaagcc acagatgtaa 60

tataatgaca atcagagagt ttgcctactg cctcgga 97

<210> 2

<211> 20

<212> DNA

<213> artificial sequence

<400> 2

aatgccatcg tcatttggtt 20

<210> 3

<211> 20

<212> DNA

<213> artificial sequence

<400> 3

caactgggca gtgaaggaat 20

<210> 4

<211> 1062

<212> DNA

<213> artificial sequence

<400> 4

atggaagtct caaaggaaat gttatttgag gagttggaca actattccta tgccttagat 60

tattactccc aggagtctga cccggaggag aaggtgtacc tgggactcgt tcactggatc 120

tccctgttct tatatgccct agcatttgtt ctgggcatcc caggaaatgc catcgtcatt 180

tggctcatgg gattcaagtg gaagaagaca gtcaccactc tttggttcct caatctggcc 240

atcgcagact tcatctttgt tctcttcctg cccctgtaca tttcctacgt ggccttgagt 300

ttccactggc cctttggcct gtggctctgc aaggttaatt ccttcattgc ccaactgaac 360

atgttttcca gtgttttctt cttgacagtg atcagcctgg accgctacat ccacttgctc 420

catcctggct tgtctcatcg gcaccggact ctaaagagct cactggttgt tgttatactt 480

gtctggctgt tggcttctct gcttggaggt cctaccttat acttccggga caccatggag 540

gtcaacaacc acatcatttg ttataataat ttccaggagc atgaactcac cttgatgaga 600

caccatgttc tgacctgggt gaagttcctc tttggctacc tcttcccttt gctaaccatg 660

agctcctgct acttgtgcct catcttcaag atgaaaaagc ggaacatcct gatatctaga 720

aagcatctct ggatgatcct gtctgtggtc attgccttct tggtttgctg gaccccttat 780

cacctgttta gcatctggga gctcagcatt catcacaaca gctctttcca gaatgtgctg 840

cagggtggaa tccccctctc aactggctta gccttcctca atagctgctt gaatcccatc 900

ctttacgtcc taataagcaa gacgttccaa gcccgcttca gggcctctgt tgctgaggta 960

ctaaagcgtt cgctgtggga agccagctgc tctggtacag tcagtgaaca actcaggagt 1020

gctgaaacca agagcctgtc tctcctagaa actgcccagt ga 1062

Claims

1. Use of an antagonist of the GPR1 gene or an antagonist of the GPR1 protein for the preparation of a medicament for the treatment of a tumor;

the tumor is choriocarcinoma or breast cancer,

antagonists of the GPR1 gene or antagonists of the GPR1 protein are shRNAs; or alternatively

The antagonist of the GPR1 gene or the antagonist of the GPR1 protein is an expression vector comprising a promoter and a nucleic acid insert operably linked to the promoter, the nucleic acid insert being a shRNA;

wherein, the shRNA is pSM2c-Hu-shGPR1, and the sequence is: 5'-TGCTGTTGACAGTGAGCGCACTCTCTGATTGTCATTATATTAGTGAAGCCACAGATGTAATATAATGACAATCAGAGAGTTTGCCTACTGCCTCGGA-3'.