CN110876752A - Application of long-chain non-coding RNA NRON functional motif in preparation of medicines for inhibiting bone resorption and preventing and treating osteoporosis - Google Patents

Abstract

The invention belongs to the field of biomedicine, and particularly relates to application of a long-chain non-coding RNA NRON functional motif in preparation of a medicine for inhibiting bone resorption and preventing and treating osteoporosis, wherein a human lncRNA NRON functional motif or a mouse lncRNA NRON functional motif is prepared into a plasmid or a transformant, and the purpose of preventing and treating osteoporosis is achieved by up-regulating the expression of an estrogen receptor α (ER α), promoting the up-regulation of genes at the downstream of ER α such as FasL and the like, and promoting osteoclast death.

Description

Application of long-chain non-coding RNA NRON functional motif in preparation of medicines for inhibiting bone resorption and preventing and treating osteoporosis

Technical Field

The invention belongs to the field of biomedicine, and particularly relates to application of a functional motif of long-chain non-coding RNA NRON in preparation of a medicine for inhibiting bone resorption and preventing and treating osteoporosis.

Background

Osteoporosis is a systemic bone disease characterized mainly by decreased bone mass and collapse of bone structure, which in turn leads to increased bone fragility, decreased bone strength, and increased risk of fracture. With the increasing aging of the population, the incidence of osteoporosis is rising year by year, and now becomes a global public health problem. At present, the population of over 60 years old in China exceeds 2.1 hundred million, which accounts for about 15.5 percent of the total population, and is the country with the largest absolute number of the aged population in the world. Recent epidemiological reports show that the population growth rate of osteoporosis of men and women in China is 15% and 20% respectively every decade, about 1.4 hundred million osteoporosis patients exist in China at present, and the number of osteoporosis patients in China is more than 2 hundred million and is estimated to account for more than half of the osteoporosis patients in the world in 2020. Osteoporosis and fractures caused by osteoporosis are one of the main causes of disability and death of the old. Research shows that the risk of fracture of osteoporosis patients is 40% higher than that of normal people, and the incidence rate of fracture caused by osteoporosis after 50 years of age is 7.5% in men, 10% in women and more than 30% in people over 70 years of age according to statistics. Hip fractures are among the most severe osteoporotic fractures, with up to 70% -90% of hip fractures resulting from osteoporosis, and studies have shown that within 1 year after hip fracture occurs, 20% of patients die from various complications, about 50% of patients are disabling, and quality of life is significantly reduced. The survey shows that in 2010, 233 thousands of people in China have osteoporotic fracture, and the medical cost is 94.5 hundred million dollars. This figure is expected to double by 2035 years, and by 2050, osteoporotic fractures in our population will increase to 599 million people per year, costing medical costs as much as $ 254.3 million. The medical treatment and nursing of the hospitalized patients caused by osteoporosis and osteoporotic fracture need to invest a large amount of resources, which causes heavy burden to families and society. The world health organization has listed osteoporosis, diabetes and cardiovascular diseases as three major killers harming the health of the elderly. The 10-month and 20-day year is defined as the international osteoporosis day, and it is seen that osteoporosis is not only an aging problem facing our country, but also a major health problem for humans of common concern in the international society.

Osteoporosis can be classified into primary (including postmenopausal osteoporosis and senile osteoporosis caused by aging), secondary and idiopathic according to different pathogenesis, wherein the primary osteoporosis affects most people, and is a main focus of domestic and foreign research. Osteoporosis occurs mainly due to imbalance of bone formation and bone resorption processes caused by changes in hormone levels or aging, and thus, drugs for treating osteoporosis, which are currently used in clinical practice, mainly include drugs that promote bone formation: such as parathyroid hormone analogs; drugs that inhibit bone resorption: such as bisphosphonates, calcitonin, estrogens, selective estrogen receptor modulators, and the like; other mechanistic classes of drugs: such as active vitamin D and its analogues, and traditional Chinese medicines such as: rhizoma Drynariae total flavonoids preparation can also be used for treating osteoporosis. Among them, drugs inhibiting bone resorption such as zoledronic acid, alendronate sodium, dinotefuran, etc. are the first choice drugs for clinical treatment due to their broad anti-fracture spectrum, but the problems of potential safety hazards and limited curative effect of the existing drugs inhibiting bone resorption are not ignored. For example, bisphosphonates have the side effects of inducing the necrosis of the mandible, atypical femoral fracture, gastrointestinal adverse reactions, fever, muscle and joint pain, renal toxicity and the like. Long-term use of calcitonin and estrogen drugs may increase the risk of tumors. The FDA rejected the marketed application of Romosozumab, a monoclonal antibody drug targeting Sclerostin protein, in 2017 for the reason of increased risk of cardiovascular disease, and the RANKL-targeting monoclonal antibody drug, disosumab (Denosumab), which has been approved for marketing, also had the side effect of increased mandibular necrosis.

Osteoclasts, which are cells directly involved in bone resorption, play a crucial role in the development of osteoporosis. Studies have shown that both the number and activity of osteoclasts are significantly enhanced during the formation of osteoporosis. Therefore, based on the pathological characteristics of osteoporosis, the molecular biological mechanism of osteoclast differentiation and activity regulation and control in the occurrence and development process of osteoporosis is further deeply explored, a new drug target for treating osteoporosis is searched, and a safer and more effective anti-osteoporosis drug is screened, so that the method has important research value and application prospect. Long non-coding RNA (lncRNA) is a class of RNA molecules that are 200 bases or more in length and generally do not have a protein coding function. Only about 2% of RNA molecules in human cells can be translated into protein, and up to 98% of RNA belongs to non-coding RNA, wherein lncRNA accounts for more than 70% of all non-coding RNA. The existing research shows that the lncRNA can participate in development of individuals, normal physiological activities of life bodies and occurrence and development of a plurality of diseases such as tumors, diabetes, virus infection and the like at multiple levels such as gene transcription, protein translation and post-translational modification, epigenetics and the like. Recent studies show that lncRNA plays an important role in the growth and development of bones and the regulation of bone homeostasis, and part of lncRNA can be used as a biological marker of bone-related diseases. Meanwhile, no document reports that lncRNA regulates and controls the bone resorption process in vivo, and no document reports that lncRNA regulating and controlling bone resorption and functional motifs thereof are used for treating osteoporosis. Due to the diversity of regulation modes of long-chain non-coding RNA, multiple functional action modes of one lncRNA are determined, and one lncRNA can regulate the functions of multiple intracellular molecules, so that unpredictable off-target effects or toxic and side effects can be generated when the full-length lncRNA molecule is directly applied to the treatment of diseases. The latest research reports that the function of the lncRNA depends on the existence of special functional motifs in the nucleic acid sequence, so that the specific functional motifs of the lncRNA are searched for specific diseases, off-target effects or toxic and side effects caused by direct application of the full-length lncRNA are greatly reduced, and the clinical transformation of lncRNA medicines is promoted.

In summary, no applications related to osteoporosis are reported in the existing applications of lncRNA, and if a full-length RNA sequence of lncRNA is selected, the defects of high toxic and side effects, high off-target property and small action range of lncRNA are easily caused.

Disclosure of Invention

The lncrANRON functional motif provided by the invention promotes the up-regulation of genes at the downstream of ER α such as FasL and the like by up-regulating the expression of estrogen receptor α (ER α), promotes the death of osteoclasts and further realizes the purpose of inhibiting bone resorption.

In order to achieve the purpose, the invention adopts the technical scheme that:

an application of a long-chain non-coding RNA NRON functional motif in preparing a medicine for preventing and treating osteoporosis.

Preferably, the long-chain non-coding RNA NRON functional motif can up-regulate the expression of an osteoclast estrogen receptor α, promote the up-regulation of genes downstream of ER α such as FasL and the like, and further promote the death of osteoclasts.

Preferably, the long non-coding RNA NRON functional motif is a plasmid or a transformant.

Preferably, the transformant may be one of adenovirus, adeno-associated virus, and lentivirus.

Preferably, the long non-coding RNA NRON functional motif comprises the nucleotide sequence of human lncRNANRON as set forth in SEQ ID No.1, or the nucleotide sequence of mouse lncRNA NRON as set forth in SEQ ID No. 2.

AACTTTGAAACTTTCCTTTGTATATTACATTAATCCATATAAGAAAATCTCTTTTAATGAGGAGTGATGTAGTTACAAACTCTCCAGAGCCATAATTAGAGCAAACTAATTGAAGTTGTGTTTTGACACACTTTCCAAATTCACGGGTGCCGGATGACATATTCACAACACTGCTGCCGCACAACCATGGCGACGGCAAAATCATTAGGCTAATAACGCTTATTTGCATTCTTATCATGCCGGCAGCTCGCCCTTAAATACTGTTTCCACTACTGCTCCTTTACTGTAAGTTTCCACCGAAAGATATTAACAGTAATTATTAGTACTTTAGTGGAATTTTAATGTTAA(SEQ ID NO.1)；

AACTTTGAAACTTTCCTTTGTATATTACATTAATCCACATAAGAAAATCTCTTTTAATGAGGAGTGATGTAGTCACAAACTCTCCAGAGCCATAATTAGAGCAAACTAATTGAAGTTGTGTTTTGACACACTTTCCAAATTCACGGGTGCTGGATGACATATTCACAACACTGGTGCCGCACAACCATGGCGACGGCAGAATCATTAGGCTAATAACGCTTATTTGCATTCTTCTCATGCCGCCAGCTCTCCCTTAAATACTGTTTCTACCACTGCTCCTTTACTGTAACTTTCCACTCGACGGTATTAACAGTAATTATTAGTGCTTTAGTGGAATTTTAATGTTAAGAATCA(SEQ ID NO.2)。

Preferably, the primer for amplifying the nucleotide sequence of the Human lncRNA NRON is Human-NRON, and the primer for amplifying the nucleotide sequence of the Mouse lncRNA NRON is Mouse-NRON.

Preferably, the sequence of an upstream primer of the primer Human-NRON is shown as SEQ ID NO.3, and the sequence of a downstream primer of the primer Human-NRON is shown as SEQ ID NO. 4; the upstream primer sequence of the primer Mouse-NRON is shown as SEQ ID NO.5, and the downstream primer sequence of the primer Mouse-NRON is shown as SEQ ID NO. 6.

Human-NRON-F:CGGGATCCAACTTTGAAACTTTCC(SEQ ID NO.3)；

Human-NRON-R:CGGAATTCTTAACATTAAAATTCC(SEQ ID NO.4)；

Mouse-NRON-F:CGGGATCCAACTTTGAAACTTTCCTTTG(SEQ ID NO.5)；

Mouse-NRON-R:CGGAATTCTGATTCTTAACATTAAAATTCC(SEQ ID NO.6)。

The method comprises the steps of separating primary mouse bone marrow mononuclear cells, inducing osteoclast differentiation through stimulation of RANKL and M-CSF, inducing osteoclast differentiation through RANKL and M-CSF after transfecting mouse lncRNA NRON functional motifs into the primary mouse bone marrow mononuclear cells, and judging the influence of the lncRNA NRON functional motifs on osteoclast apoptosis through TUNEL staining and detection of osteoclast apoptosis indexes. The lncRNA NRON functional motif was found to significantly promote osteoclast apoptosis.

In order to investigate the possible molecular mechanism of lncRNA NRON functional motif for promoting osteoclast apoptosis, the invention discovers that the lncRNA NRON functional motif can inhibit the degradation of estrogen receptor α (ER α) through signal path analysis and experimental verification, and ER α is one of the most important signal paths known to regulate osteoclast apoptosis.

To evaluate the inhibitory effect of the functional motif of lncRNA NRON on bone resorption and the effect against osteoporosis in vivo. According to the invention, an Ovariectomy (OVX) mouse osteoporosis model is constructed, after the lncRNA NRON functional motif is delivered into an OVX mouse body by using a nucleic acid delivery system, the bone volume and the number and the thickness of bone trabeculae of an OVX mouse in an experimental group delivering the lncRNA NRON functional motif are increased compared with those of an OVX mouse in a control group through micro CT detection, and the treatment effect is equivalent to that of a positive control medicament, namely zoledronate. The functional gene sequence of lncRNA NRON has certain treatment effect on an OVX loose model.

Compared with the prior art, the application of the long-chain non-coding RNA NRON functional motif in preparing the medicine for preventing and treating osteoporosis has the following advantages:

(1) the experimental result is obtained by bioinformatics analysis and in-vivo and in-vitro experimental verification, the reliability is high, and the treatment effect is obvious;

(2) the long-chain non-coding RNA NRON functional motif obtained by the invention acts on an osteoporosis mouse and directly acts on a target site, and has no toxic or side effect and no off-target phenomenon;

(3) the invention discovers that a section of long-chain non-coding RNA NRON functional motif can be used for preparing the medicine for preventing and treating osteoporosis for the first time, and provides a new research direction for preventing and treating diseases related to abnormal activation of bone resorption.

Drawings

In fig. 1, a is the result of chromosome analysis of NRON and NRON functional motifs for osteoclast apoptosis, and B is the result of statistical quantitative analysis of a;

FIG. 2 shows the results of QPCR analysis of the expression of FasL gene downstream of ER α by NRON and NRON functional sequences;

FIG. 3 is a WB result of NRON and NRON functional motifs up-regulating the expression of FasL and apoptosis-related proteins PARP and Caspase3 at the protein level;

FIG. 4 shows the expression of ER α in WB assay after transfection of mouse and human NRON expression vectors, NRON functional motif expression vectors and empty vectors into human and mouse osteoclasts, respectively;

FIG. 5 is a graph showing detection of ubiquitination modification of ER α after transfection of mouse and human NRON expression vectors, NRON functional motif expression vectors and empty vectors into human and mouse osteoclasts, respectively.

In FIG. 6, A is a TRAP staining analysis chart of bone tissue of treated mice; b is a bone trabecula three-dimensional reconstruction image of mouse thighbone analyzed by the post-treatment micCT; and C is the quantitative analysis result of the B picture micCT.

Detailed Description

The present invention is further explained with reference to the following specific examples, but it should be noted that the following examples are only illustrative of the present invention and should not be construed as limiting the present invention, and all technical solutions similar or equivalent to the present invention are within the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are commercially available products.

Example 1 construction of lncRNA NRON functional motif eukaryotic expression vector

Human full-length NRON gene and Mouse full-length NRON gene are respectively used as templates, PCR amplification (Human source NRON functional motif amplification) is carried out by adopting primer Human-NRON, and PCR amplification (Mouse source NRON functional motif amplification) is carried out by adopting primer Mouse-NRON.

The NRON functional motif was amplified using high fidelity DNA polymerase from TRKARA (cat. No. R045Q). The PCR fragment was identified by agarose gel electrophoresis, and the target fragment was recovered using a common agarose gel DNA recovery kit (cat # DP209) from Tiangen Biotech. The target fragment and pcDNA3.1(+) vector were digested at 37 ℃ for 1h with BamHI and EcoRI restriction enzymes from TRKARA. Subsequently, agarose gel electrophoresis was performed to identify the target fragment and pcDNA3.1(+) vector, which were then digested and recovered using a common agarose gel DNA recovery kit (Cathagen Biotech, Inc. (Cat. DP 209)). The vector and the target fragment were expressed as 50 ng: a200 ng ratio was 16 degrees overnight with TAKARA T4 ligase (cat 2011A). The ligation products were transformed into DH5a competent bacteria (Tiangen organism, cat # CB101) by heat shock, ampicillin-resistant positive clones were selected, and PCR was performed. And (4) sending the PCR-identified positive clone to a biological organism for sequencing identification. The correct clone was identified by sequencing and the plasmid was extracted with endotoxin-free plasmid extraction kit (Tiangen, cat # DP117) for subsequent experiments.

Example 2 in vitro differentiation induced osteoclasts

Bone marrow of 2-month-old C57BL/6 mice was flushed with α -ME serum-free medium, resuspended in α -MEM containing 10% FBS, and resuspended in 5% CO₂And incubated at 37 ℃ for 24 hours in an incubator. Subsequently, the suspension cells were collected by centrifugation at 3X 10⁶Inoculating the culture plate with cell/mL cell density, adding 50ng/mL M-CSF to induce for 3 days, adding 50ng/mL M-CSF and 100ng/mL RANKL to induce cells after 3 days, changing the cell culture solution every other day, and performing subsequent molecular detection and TRAP staining after culturing the cells for 4 days.

Human THP-1 cells were cultured in 1640 culture medium containing 10% FBS for osteoclast differentiation induction, and the THP-1 cells were cultured at 5X 10⁵cells/mL were plated at density and stimulated with 100ng/mL PMA for 1 day, followed by a change to a differentiation inducing medium of 1640+ 10% FBS +50ng/mL M-CSF +100ng/mL RANKL, cells were changed every other day and cells were cultured for 14 days before subsequent molecular detection and TRAP staining.

Example 3 transfection of lncRNA NRON functional motif eukaryotic expression vector into osteoclasts

Mouse osteoclast differentiation day 2 or human osteoclast differentiation day 12, using Lipo2000 to transfect lncRNANRON functional motif expression vector to osteoclast, the transfection is performed according to the instruction, 2000ng plasmid is added into an EP tube containing 125 μ L Lopti-MEM culture medium and is blown and mixed evenly, 5 μ L Lipo2000 transfection reagent is added into an EP tube containing 125 μ L opti-MEM culture medium and is blown and mixed evenly, 2 EP tubes containing the reagent are kept for 5min at room temperature, and then 1: 1 mix the reagents in 2 EP tubes, let stand at room temperature for 20min, after which the transfection mixture is added to the plate. Analysis of gene and protein expression levels was performed 2 days after transfection.

Example 4 analysis of osteoclast TUNEL staining

Osteoclasts were cultured and transfected with NRON expression vectors or NRON functional motif expression vectors, 2 days after transfection, the estrogen-treated group was treated with 10nM estradiol (pecan bio, ST1101) for 8 hours, after which the cells were collected and analyzed for apoptosis by TUNEL staining according to the kit instructions (pecan bio, C1086). (1) Cells were washed once with PBS. (2) Cells were fixed in 4% paraformaldehyde for 30 min. (3) Cells were washed once with PBS. (4) 0.3% Triton X-100 in PBS and incubated for 5 minutes at room temperature. (5) Cells were washed once with PBS. (6) Preparing a reaction solution: add TdT enzyme 5. mu.L into fluorescence labeling liquid 45. mu.L and mix well. (7) The fluorescent labeling solution was added in an amount of 50. mu.L per sample, and incubated at 37 ℃ for 1 hour in the absence of light. (8) Cells were washed once with PBS. (9) DAPI (Biyunnan organism, C1005) and phalloidin (Shanghai assist in san Yang Sheng organism, 40734ES75) staining solutions were added and incubated for 30 minutes at room temperature in the absence of light. (10) Cells were washed once with PBS, photographs were taken with a laser confocal microscope, and the proportion of TUNEL + apoptotic osteoclasts was analyzed. The results are shown in fig. 1, wherein the functional motifs of NRON and NRON significantly promote osteoclast apoptosis in panel a, and the proportion of TUNEL + apoptotic osteoclasts in panel B is up to 90% or more.

Example 5 osteoclast RNA extraction and Gene expression level analysis

Adding 1mL of Trizol into each hole of a 6-hole plate, repeatedly blowing and beating the cells by using a gun head, acting for 5 minutes at room temperature, transferring lysate into a 1.5mL centrifuge tube, adding 200 mu L of chloroform, covering a tube cover tightly, uniformly mixing by vortex, standing for 3 minutes at room temperature, centrifuging for 15 minutes at 4 ℃ and 12000g/min, transferring upper-layer aqueous phase liquid into a new 1.5mL centrifuge tube, adding 500 mu L of isopropanol, uniformly mixing by vortex, standing for 10 minutes at room temperature, centrifuging for 10 minutes at 4 ℃ and 12000g/min, sucking the supernatant by using a pipette, discarding, keeping a white precipitate at the bottom, adding 1mL of 75% ethanol (DEPC water for preparation), slightly bouncing the white precipitate by hand, centrifuging for 5 minutes at 4 ℃ and 7500g/min, discarding the supernatant, drying for 10-15 minutes at room temperature, adding 30-40 mu L of DEPC water for redissolving, placing RNA into an ice box at-80 ℃ for storage or directly using a reverse transcription kit (TaRa, KaRR No. 047, FasRNA extracted by the operational flow of the kit, 1000ng is shown in a real-time PCR (reverse transcription gene expression of a PCR) and the sequence).

Example 6 analysis of osteoclast protein expression level

Extracting total cell protein by SDS lysate, regulating protein concentration to be consistent by BCA colorimetry, separating protein samples by SDS-PAGE electrophoresis, transferring to a PVDF membrane, sealing by 5% skimmed milk powder for 1h, washing the membrane, incubating primary antibody (ER α), incubating overnight at 4 ℃ in a refrigerator, washing the membrane, incubating fluorescent secondary antibody for 1h at room temperature, washing the membrane, developing by ECL chemiluminescence to obtain a target band, scanning the band in gray scale by Bandscan software, and correcting by GAPDH internal reference, specific results are shown in figure 3, and the functional motifs of NRON and NRON can up-regulate the expression of FasL and apoptosis-related proteins PARP and Caspase3 at the protein level, thereby promoting osteoclast apoptosis.

Example 7 analysis of ER α expression levels and ubiquitination modification levels

After 2 days of cell transfection, the transfection effect was analyzed by the protein electrophoresis procedure shown in example 6, and the results are shown in FIG. 4. from FIG. 4, the mouse and human NRON expression vectors, NRON null motif expression vectors, and NRON functional motif expression vectors were transfected into human and mouse osteoclasts, respectively, and it was found that full-length NRON and NRON functional motifs up-regulate the expression of ER α.

To analyze the level of ubiquitination modification of ER α, the osteoclasts after plasmid transfection were treated with the ubiquitin proteasome inhibitor MG132(Selleck, cat # S2619) for 6 hours, then the cells were washed once with PBS, cell samples were lysed on ice with Western and IP cell lysates (pecan # P1003) for 10 minutes, then centrifuged at 14000 rpm to collect the supernatant, ER α -specific antibodies (Invitrogen, cat # MA5-13065) were added to the cell lysates, incubated on ice for 2 hours, then Protein a/G agarose beads (sta, cat # SC-2003) were added, incubated at 4 degrees overnight, at 1000 rpm, centrifuged for 5 minutes to collect the agarose beads, washed 5 times with PBS, after the last centrifugation, the supernatant was discarded completely, the agarose bead pellet was added with 40 μ L SDS-like buffer, centrifuged at 100 degrees 5 minutes, thereafter, the supernatant was collected at 14000 rpm, and the supernatant was taken according to the procedures of CST 6 and the modified Protein electrophoresis, analyzed for the degree of ubiquitination inhibition of ubiquitin Protein, NRON, the specific ubiquitin Protein inhibition by NRON, pcr 435, NRON, and NRON staining procedures for the ubiquitin motif.

Example 8 construction of mouse ovariectomy model

The same 12-week-old C57BL/6 female non-pregnant mouse is taken, and the ovary of the mouse is removed by injecting pentobarbital sodium/chloral hydrate deep anesthesia mouse. The mice were placed on their sides and their dorsal and ventral skin was disinfected with a 75% alcohol cotton swab. At the position slightly above the thigh root of the mouse and less than 1cm lateral to the spine, a skin incision which is parallel to the spine and is about 5mm long is cut by an ophthalmologic scissors, the lower psoas muscle is carefully cut, the fat tissue surrounding the ovary is carefully searched, and after the pink ovary is seen, the ovary is ligated at the two sides of the ovary, and the ovary is removed. The control group was a sham-operated control group which was operated without ovaries removal. And taking samples of hind limb bones and lumbar vertebrae of the model group and the control group mice 3 months after operation to perform micro-CT scanning and analyze bone parameters.

Example 9 drug treatment of ovariectomized mice

Mice were divided into 5 groups of 6 mice each, of which OVX model group 4, Sham control group 1. The Sham group and the OVX group were intravenously injected with 200 μ L of physiological saline every three days for 30 days. In the vector delivery treatment group, 1mg of the nucleic acid delivery system was dissolved in 1mL of physiological saline, sonicated for 10min, and then mixed with 1mg of the vector uniformly for use. OVX empty vector treatment group, OVX-NRON treatment group, and OVX-NRON functional motif treatment group 200. mu.L of a nucleic acid delivery system containing a vector was intravenously injected every three days for 30 days. OVX mice in the positive control drug zoledronate group were injected intraperitoneally with one drug at a dose of 80. mu.g/kg. 30 days after dosing, mice were fixed by cardiac perfusion with 4% paraformaldehyde. The femur, tibia, vertebrae of the mice were removed. 4% Paraformaldehyde was fixed for 1 week, bone samples were scanned by MicroCT (μ CT 50, Scanco Medical), and the volume ratio of trabecular bone (BV/TV), thickness of trabecular bone (Tb.Th) and number of trabecular bone (Tb.N) were analyzed and statistically analyzed. The specific results are shown in FIG. 6. Wherein, the A picture is a treatment mode picture, the B picture is a bone trabecula three-dimensional reconstruction picture of mouse thighbone analyzed by the post-treatment micro CT, and the NRON functional motif treatment can be seen to remarkably improve the bone mass of the mouse. And C is quantitative analysis of the B picture micCT, and the result shows that the NRON functional motif treatment can remarkably up-regulate the bone volume, the trabecular bone number and the trabecular bone thickness of the OVX mice, and the effect is equivalent to that of a positive control medicament, namely zoledronate (Zol). Graph A is bone tissue TRAP staining analysis of treated mice, graph C is quantification of bone tissue TRAP staining, and NRON functional motif treatment significantly inhibits bone resorption activity of mice, thereby demonstrating that NRON functional motif can inhibit bone resorption in vivo.

In addition, it should be noted that the above examples are only used to further illustrate the therapeutic effect of the present invention. The methods involved are technical means that can be grasped and utilized by those skilled in the art. The functional motif of lncRNA NRON can be a plasmid or a transformant of adenovirus, lentivirus, adeno-associated virus and the like, and the functional motif is within the protection scope of the invention as long as the functional motif comprises the nucleotide sequence segments shown in SEQ ID NO.1 and SEQ ID NO.2 or the nucleic acid sequence segment with the sequence similarity of more than 80%.

Sequence listing

<110> river-south university

Application of long-chain non-coding RNA NRON in preparation of medicines for inhibiting bone resorption and preventing and treating osteoporosis

<130>2019.11.6

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>348

<212>DNA

<213> human lncRNA NRON functional motif (Artificial Sequence)

<400>1

aactttgaaa ctttcctttg tatattacat taatccatat aagaaaatct cttttaatga 60

ggagtgatgt agttacaaac tctccagagc cataattaga gcaaactaat tgaagttgtg 120

ttttgacaca ctttccaaat tcacgggtgc cggatgacat attcacaaca ctgctgccgc 180

acaaccatgg cgacggcaaa atcattaggc taataacgct tatttgcatt cttatcatgc 240

cggcagctcg cccttaaata ctgtttccac tactgctcct ttactgtaag tttccaccga 300

aagatattaa cagtaattat tagtacttta gtggaatttt aatgttaa 348

<210>2

<211>354

<212>DNA

<213> mouse lncRNA NRON functional motif (Artificial Sequence)

<400>2

aactttgaaa ctttcctttg tatattacat taatccacat aagaaaatct cttttaatga 60

ggagtgatgt agtcacaaac tctccagagc cataattaga gcaaactaat tgaagttgtg 120

ttttgacaca ctttccaaat tcacgggtgc tggatgacat attcacaaca ctggtgccgc 180

acaaccatgg cgacggcaga atcattaggc taataacgct tatttgcatt cttctcatgc 240

cgccagctct cccttaaata ctgtttctac cactgctcct ttactgtaac tttccactcg 300

acggtattaa cagtaattat tagtgcttta gtggaatttt aatgttaaga atca 354

<210>3

<211>24

<212>DNA

<213>Human-NRON-F

<400>3

cgggatccaa ctttgaaact ttcc 24

<210>4

<211>24

<212>DNA

<213>Human-NRON-R

<400>4

cggaattctt aacattaaaa ttcc 24

<210>5

<211>28

<212>DNA

<213>Mouse-NRON-F

<400>5

cgggatccaa ctttgaaact ttcctttg 28

<210>6

<211>30

<212>DNA

<213>Mouse-NRON-R

<400>6

cggaattctg attcttaaca ttaaaattcc 30

Claims (7)

1. An application of a long-chain non-coding RNA NRON functional motif in preparing a medicine for preventing and treating osteoporosis.

2. The use of claim 1, wherein the long non-coding RNA NRON functional motif upregulates the expression of estrogen receptor ER α in patients with osteoporosis, promotes the upregulation of genes downstream of ER α such as FasL, and thereby promotes osteoclast death.

3. The use of claim 1, wherein the long non-coding RNA NRON functional motif is a plasmid or a transformant.

4. The use of claim 3, wherein the transformant is selected from the group consisting of adenovirus, adeno-associated virus, and lentivirus.

5. The use of claim 1, wherein the long non-coding RNA NRON functional motif comprises the nucleotide sequence of human incrna NRON as set forth in SEQ ID No.1 or the nucleotide sequence of mouse incrna NRON as set forth in SEQ ID No. 2.

6. The use of claim 5, wherein the primer that amplifies the nucleotide sequence of the Human lncrRNA NRON is Human-NRON and the primer that amplifies the nucleotide sequence of the Mouse lncrRNA NRON is Mouse-NRON.

7. The long non-coding RNA NRON sequence of claim 6, wherein the upstream primer sequence of the primer Human-NRON is shown as SEQ ID No.3, and the downstream primer sequence of the primer Human-NRON is shown as SEQ ID No. 4; the upstream primer sequence of the primer Mouse-NRON is shown as SEQ ID NO.5, and the downstream primer sequence of the primer Mouse-NRON is shown as SEQ ID NO. 6.

Images