CN107365768A - Gene primer combines and unicellular gene order extraction liquid kit - Google Patents

Gene primer combines and unicellular gene order extraction liquid kit Download PDF

Info

Publication number
CN107365768A
CN107365768A CN201710607549.0A CN201710607549A CN107365768A CN 107365768 A CN107365768 A CN 107365768A CN 201710607549 A CN201710607549 A CN 201710607549A CN 107365768 A CN107365768 A CN 107365768A
Authority
CN
China
Prior art keywords
primer
gene
sequence
extraction
unicellular
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710607549.0A
Other languages
Chinese (zh)
Inventor
曾钊宇
王秋丰
麦梅珍
李新民
胡松
李政江
冯进旺
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201710607549.0A priority Critical patent/CN107365768A/en
Publication of CN107365768A publication Critical patent/CN107365768A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor

Landscapes

  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Kit the present invention relates to a kind of combination of gene primer and comprising the combination.More precisely, it is a kind of gene primer combination and unicellular gene order extraction liquid kit.Belong to medical detection field.Including six gene primers, the sequence of first primer is：CAGCGATGATTACAGTCCAGC；The sequence of second primer is：ACAGGCCATGCACAGAGAGA；The present invention will not form the primer of dimer, and gene order extraction easy to operate is no more than 4 hours.Single tube is replaced, reproducible.

Description

Gene primer combines and unicellular gene order extraction liquid kit
Technical field
Kit the present invention relates to a kind of combination of gene primer and comprising the combination.More precisely, it is a kind of Gene primer combines and unicellular gene order extraction liquid kit.Belong to medical detection field.
Background technology
Extraction and analysis individual cells are wanted technical problem to be present in the prior art.One cell nearly weighs 6 piks, in cell DNA or RNA is simply placed in the level of pik (picograms) level, does not reach the minimum loading demand of existing sequenator much, must First unicellular interior trace dna molecule must be expanded and it is necessary to there is technical error as few as possible in guarantee, so as to Carry out follow-up sequencing and other researchs.
For traditional PCR method, quantitative fluorescent PCR, real-time fluorescence quantitative PCR, repeatedly annealing ring-type cyclic amplification technology, When the methods of DOP-PCR, LM-PCR, PEP-PCR, MDA, PWGA is individually used for detecting unicellular, these amplification techniques are due to list Individual cell can only provide two template DNAs, its limitation be present, can not extract to entirely accurate single celled DNA.
For this reason, it may be necessary to combination and the unicellular gene order extraction liquid kit of a kind of gene primer are designed, by gene Multidigit dot cycle displacement, which is incubated amplification technique (GMCT) method, can effectively extract objective gene sequence, and abundance is provided for downstream analysis Experiment material.
The content of the invention
The invention aims to the combination for solving to lack efficient gene primer in the prior art and unicellular gene Sequential extraction procedures liquid kit.In the present invention, two template DNA features can only be provided for gene sequencing individual cells, design is more Individual target gene realizes effective detection, and designs unicellular gene order extraction liquid kit, effectively extracts individual cells DNA；Adopt Replaced with the dot cycle of gene multidigit and be incubated amplification technique principle, design multiple target genes, gene multidigit is carried out using archaeal dna polymerase Preincubate is replaced in dot cycle, then enters performing PCR amplification extraction objective gene sequence, and the experiment material of abundance is provided for downstream analysis. The present invention reaches by following technical solution：
A kind of combination of gene primer, it is characterised in that：Including six gene primers,
The sequence of first primer is：CAGCGATGATTACAGTCCAGC；
The sequence of second primer is：ACAGGCCATGCACAGAGAGA；
The sequence of the three-primer is：CGGGTAAGGGTACTGGCCTT；
The sequence of 4th primer is：GCTGATCTCTGAGTTTCGCATT；
The sequence of 5th primer is：CGTTGATGGGCGGTAAGTG；
The sequence of 6th primer is：ACAAACAACTCCCCTCCTCTTG.
A kind of unicellular gene order extraction liquid kit, including primer, Taq enzyme system, it is characterised in that：
The primer combines for said gene primer, and primer is sub-packed in A1, A2, B3 extraction with Taq enzyme system and mixed in liquid pipe；
Wherein A1 extraction mixed liquors are made up of following component：2.5 μ l 10pmol/ μ l primers, primer final concentration of 30~ 900nM, 25 μ l archaeal dna polymerase dNTP buffer solution mixtures final concentration 1 ×, 20.5 μ l aseptic deionized water；
A2 extraction mixed liquors are made up of following component：2.5 μ l 15pmol/ μ l primers, primer final concentration of 30~ 900nM, 25 μ l phi29DNA polymerase dNTP buffer solution mixtures final concentration 1 ×, 20.5 μ l aseptic deionized water；
B3 extraction mixed liquors are made up of following component：2.5 μ l 25pmol/ μ l primers, primer final concentration of 30~ 900nM, 25 μ l Taq enzyme system dNTP buffer solution mixtures final concentration 1 ×, 20.5 μ l aseptic deionized waters.
Beneficial effect of the present invention
The gene primer combination of the present invention, extraction caused by two template DNAs can only be provided for unicellular content less Difficult problem, combined by using gene primer, greatly improve it and the sensitivity of liquid kit is extracted to unicellular gene order, It is final to realize the effect for accurately extracting unicellular DNA.The present invention will not form the primer of dimer, gene sequence easy to operate Row extraction is no more than 4 hours.Single tube is replaced, reproducible.
The present invention can provide the experiment material of abundance for downstream analysis, and the cell quantity for being especially taken from body early embryo is dilute Precious less, some that can not be conducted a research with conventional art are difficult to clinical cytology sample obtain, precious.Now by slender Born of the same parents' gene order extraction liquid kit is simultaneously incubated amplification technique (GMCT) method using gene multidigit dot cycle displacement, from unicellular Big data is obtained in genomics research.Pass through the Gene sequence comparison point to specific cells in pathological tissues and health tissues Analysis, finds difference therein, understands the expression of specific gene change situation related to disease, meets gene sequencing, real-time glimmering Fluorescent Quantitative PCR detection etc. requires have extensive potential applicability in clinical practice, have significant Social benefit and economic benefit.
Brief description of the drawings
Fig. 1 is that the dot cycle of gene multidigit is incubated schematic diagram；
Fig. 2 is that gene multidigit dot cycle displacement is incubated schematic diagram；
Fig. 3 is that gene multidigit dot cycle displacement is incubated amplification schematic diagram；
Fig. 4 is the first primer pair and probe PCR amplified fluorescence schematic diagram of chromosomal nucleic acid detection kit；
Fig. 5 is the negative figure of nucleic acid amplification fluorescent Analysis of test results；
Fig. 6 is nucleic acid amplification fluorescent Analysis of test results positive map.
Specific embodiment
Following the present embodiment combination accompanying drawing is specifically described the present invention：
A kind of gene primer combination, it is characterised in that：Including six gene primers,
The sequence of first primer is：CAGCGATGATTACAGTCCAGC；
The sequence of second primer is：ACAGGCCATGCACAGAGAGA；
The sequence of the three-primer is：CGGGTAAGGGTACTGGCCTT；
The sequence of 4th primer is：GCTGATCTCTGAGTTTCGCATT；
The sequence of 5th primer is：CGTTGATGGGCGGTAAGTG；
The sequence of 6th primer is：ACAAACAACTCCCCTCCTCTTG.
A kind of unicellular gene order extraction liquid kit, including primer, Taq enzyme system, it is characterised in that：The primer is Said gene primer combines, and primer is sub-packed in A1, A2, B3 extraction with Taq enzyme system and mixed in liquid pipe；
Wherein A1 extraction mixed liquors are made up of following component：2.5 μ l 10pmol/ μ l primers, primer final concentration of 30~ 900nM, 25 μ l archaeal dna polymerase dNTP buffer solution mixtures final concentration 1 ×, 20.5 μ l aseptic deionized water；
A2 extraction mixed liquors are made up of following component：2.5 μ l 15pmol/ μ l primers, primer final concentration of 30~ 900nM, 25 μ l phi29DNA polymerase dNTP buffer solution mixtures final concentration 1 ×, 20.5 μ l aseptic deionized water；
B3 extraction mixed liquors are made up of following component：2.5 μ l 25pmol/ μ l primers, primer final concentration of 30~ 900nM, 25 μ l Taq enzyme system dNTP buffer solution mixtures final concentration 1 ×, 20.5 μ l aseptic deionized waters.
Unicellular gene order extracts liquid kit
This kit is applied to from single embryonic blastomere, polar body, unicellular, sperm, serum, blood plasma, body fluid or tissue Extract gene order in liquid, the gene order of extraction can be directly used for various downstream processes, including gene sequencing, real-time fluorescence are fixed Measure PCR detections etc..
Inspection principle
This kit is incubated amplification technique (GMCT) using gene multidigit dot cycle displacement, designs more (N) individual target genes, profit Gene multidigit dot cycle displacement preincubate is carried out with archaeal dna polymerase, then enters performing PCR amplification extraction gene order.
Sample is handled the extracts reagent provided using this product and nucleic acid extraction, is matched somebody with somebody with the extract solution provided in this product Reaction tube is made, the nucleic acid of extraction is added into reaction tube, is incubated using quantitative real time PCR Instrument,
Main composition
Condition of storage and the term of validity
Kit after packaged is (anti-comprising nucleic acid extracting reagent, A1 reaction mixtures pipe, A2 reaction mixtures pipe, B3 Liquid pipe should be mixed) it is stored under -20 ± 5 DEG C of environment, the term of validity 6 months.Avoid multigelation.Number of freezing and thawing is no more than 4 times. After reagent, at ambient temperature standing time be not to be exceeded 8 hours.Transport keeps low temperature using dry ice (or ice bag), Haulage time is not to be exceeded 4 days.
It is applicable instrument ABI Prism 7300ABI Prism 7500, LightCycler480, DA7600
Sample requirement
1 is applicable specimen types：Single embryonic blastomere, polar body, unicellular, sperm, serum, blood plasma, body fluid or tissue
2 collections of specimens：
2.1 serum：2 milliliters of person under inspection's venous blood is extracted with disposable sterilized injector, injects sterile drying test tube, room Temperature PlaceMinute, blood specimen can natural aggegation disengage serum, or directly use level centrifuge, 1500 leave the heart 5 minutes, draw upper serum, are transferred to 1.5ml sterile centrifugation tubes.
2.2 blood plasma：2 milliliters of person under inspection's venous blood is extracted with disposable sterilized injector, injection contains ethylenediamine tetra-acetic acid two Potassium (EDTA-2K) or noninvasive gene pipe, test tube is gently overturned immediately and is mixed 10 times, is fully mixed,After minute, 1500 turns Centrifugation 5 minutes, upper plasma is drawn, is transferred to 1.5ml sterile centrifugation tubes.
2.3 obtain unicellular using this reagent by airflow classification, the mode such as buffer solution dilution and micromanipulation Box carries out extraction gene order.Although the result of living cells extraction is ideal, this kit by paraformaldehyde for consolidating The sample that fixed or laser microdissection is cut, it is equally applicable.
3 Saving specimens and transport：The sample gathered can be immediately available for testing, and can also be stored in -20 DEG C, and storage life is 6 months.Sample, which transports, uses 0 DEG C of curling stone, and the sample of noninvasive gene pipe collection can normal temperature transport.
Operating process
The first step：0.2 light-wall pipe, add 5 μ L DNA extract solutions (Na0H 100mmol/L, EDTA 1.5mmol/L, Tristonx-10050mmol/L, 1%NP-40, Tris-Hc1 (pH=8.0) 50mmol/L).
Second step：Add unicellular or micro template.
3rd step：8000 leave the heart 5 seconds.
4th step：100 DEG C 5 minutes.
5th step：A1 extraction mixed liquors 5 μ L are added in 0.2 light-wall pipe.
6th step：8000 leave the heart 5 seconds, upper machine.
A1 conditions are set：
7th step：A1 experiments terminate, and take out 0.2 light-wall pipe and 12000 leave the heart 5 minutes at a high speed.
8th step：A2 extraction mixed liquors 30 μ L are added in 0.2 light-wall pipe.
9th step：8000 leave the heart 5 seconds, upper machine.
A2 conditions are set：
10th step：A2 experiments terminate, and take out 0.2 light-wall pipe, 12000 centrifugation 5 minutes at a high speed.
11st step：B3 extraction mixed liquors 35 μ L are added in 0.2 light-wall pipe.
12nd step：8000 leave the heart 5 seconds, upper machine.
B3 conditions are set：
13rd step：B3 experiments terminate, and take out 0.2 light-wall pipe, 12000 centrifugation 5 minutes at a high speed, the DNA fragmentation of extraction can be direct For various downstream processes, including gene sequencing, real-time fluorescence quantitative PCR detection etc..
Before PCR, come in, and row 8000 leaves the heart 5 seconds, is well mixed with the liquid ensured in reaction system.Complete sample nucleic acid After extraction, it is proposed that carry out next step experiment at once, otherwise please be stored in -20 DEG C stand-by (in 24 hours).
DNA cloning product and pre- amplifing reagent are separately stored；All downstream analysis processing, before DNA purifying, sequencing Preparation, please carried out in another laboratory.If cross pollution is not controlled in sample disposal, in fact it could happen that false It is positive.
Experiment is finished with 10% hypochlorous acid or 75% ethanol postincubation workbench and pipettor, then irradiates 30 with ultraviolet lamp Minute.
Using the unicellular gene order extraction liquid kit, experiment proves：Tried using unicellular gene order extract solution Agent box is from 56 unicellular middle extraction gene orders, sample number R160501-R160556, with chromosomal nucleic acid detection kit To identify extraction effect, as a result 56 unicellular chromogenes are in sun, average out to (165000.00 ± 80.00) copy/milli Rise；Unicellular 29, sample number R160557-R160586 of other extract solutions processing, with chromosomal nucleic acid detection kit come Extraction effect is identified, as a result 29 unicellular chromogenes are in the moon；The conclusion unicellular gene order extraction liquid kit energy Effectively extract unicellular gene order.
Sample data shows as follows：
It is chromosomal nucleic acid detection kit component list below：
The sequence of the probe is：ACGCGGCTGGTGGATCAGTGCT；
The sequence of forward primer in first primer pair is TTATGAGCGCGAAGCAAACG；
The sequence of reverse primer in first primer pair is：CCGTGGGTGGTCTTTACCG.
The inspection principle of chromosomal nucleic acid detection kit
This kit utilizes Fluorescence PCR assay, and using relative conserved region in Chromosome genomes, as target region, design is special Specific primer and fluorescence probe, after sample nucleic acid purifying, Chromosome DNA are used for quickly detecting by PCR.Make Clinical sample is handled the nucleic acid extracting reagent provided with this kit and nucleic acid extraction, with the PCR provided in kit Detection reagent is configured to PCR reaction tubes, and the nucleic acid of extraction is added into PCR reaction tubes, enters performing PCR using quantitative real time PCR Instrument and expands Increase, and detect fluorescence signal, instrument software draws out real-time amplification curve automatically, is realized according to threshold cycle values (CT values) to unknown The qualitative detection of sample.
【PCR amplifications are applicable instrument】ABI Prism 7300ABI Prism 7500,LightCycler480,DA7600
【Sample requirement】
1 is applicable specimen types：Serum, blood plasma, body fluid or tissue.
2 collections of specimens：
2.1 serum one extract 2 milliliters of person under inspection's venous blood with disposable sterilized injector, inject sterile drying test tube, Room temperature PlaceBlood specimen can the complete aggegation of spontaneous peace separate out serum, or directly use level from Scheming, 1500 leave heart 5min：Upper serum is drawn, is transferred to 1.5ml sterile centrifugation tubes.
2.2 blood plasma extract 2 milliliters of person under inspection's venous blood with disposable sterilized injector, and injection contains ethylenediamine tetra-acetic acid two Potassium
(EDTA-2K) test tube gently or noninvasive gene pipe, is overturned immediately to mix 10 times, is fully mixed,After be Blood plasma is may separate out, is transferred to 1.5ml sterile centrifugation tubes.
3 Saving specimens and transport：The sample gathered can be immediately available for testing, and can also be stored in -20 DEG C, can the phase of depositing be 6 months.Sample, which transports, uses 0 DEG C of curling stone, and the sample normal temperature of noninvasive gene pipe transports.
【The method of inspection】
1DNA is extracted --- sample preparation area
Sample to be tested, positive qualitative reference product, negative quality-control product, the critical positive quality control product of Chromosome strong positives are entered Row synchronization process.
The method separated plasma of 1.1 2 centrifugations：4 DEG C, 1,600, which leave heart 10min separated plasmas, does not touch tunica albuginea layer；4 DEG C, 16,000, which leave heart 10min, carefully draws the samples of 50 μ of supernatant 1, adds 100 μ 1DNA extract solution I, is acutely vibrated with oscillator Mix 10 seconds, 8000 leave the calculation second.100 DEG C of constant temperature handle 10 ± 1min；
1.2 12,000 leaves heart 5min, standby.
2PCR reagents prepare --- reagent area in preparation
Directly use Chromosome reaction mixture pipes.
3 sample-adding --- sample preparation areas
Into above-mentioned Chromosome reaction tubes with filter core suction nozzle be separately added into extraction after sample to be tested nucleic acid, Chromosome feminine genders quality-control product, Chromosome strong positives quality-control product, the critical positive quality control products of Chromosome and the positive are determined Measure each 5 μ l of supernatant of reference material.Cover tightly lid, 8,000 leave the calculation second after be transferred to augmentation detection area.
4PCR is expanded --- amplification and product analysis area
The instruments of 4.1ABI Prism 7500 are set --- and 7300 with reference to this operation
4.1.1 " Setup " window is opened, negative Quality Control (NTC), positive quality control and unknown are sequentially set by sample is corresponding Sample (Unknow), positive qualitative reference product (Standard), and " Sample Name " one set sample names in column；Visit Pin detection pattern is arranged to：Reporter Dyel：FAM, Quencher Dyel：none；Reporter Dye2：VIC, Quencher Dye2：none；Passive Reference：Rox.
4.1.2 instrument windows are opened, set cycling condition as follows：94 DEG C of 2min, 93 DEG C 45 seconds → 55 DEG C 60 seconds → 10 circulations, 93 DEG C 40 seconds → 55 DEG C 55 seconds → 30 circulations, preserve shelves, operation.
4.2LightCycler480 instruments are set
4.2.1 after opening software, " New Experiment ", setting detection pattern are " Multi Color for selection Hydrolysis Probe ", it is FAM, VIC to detect logical head.
4.2.2, cycling condition is set：
4.2.3 selection " Sample Editor ", sets title, the type of sample, in " Standard Positive qualitative reference product concentration is inputted in Concentration " frames, after being provided with, preserves file, operation program.
4.3DA7600 instruments are set
4.3.1 after opening software, in program parameter interface is set, set amplification program and temperature setting, condition as follows：
4.3.2 sample parameter interface is clicked on, negative Quality Control (NTC), positive quality control and are not set sequentially by sample is corresponding Know sample (UNK), and sample names are set in " sample names " one column：Positive qualitative reference product select in " sample type " " standard ", input concentration in " normal concentration ".Probe dye type selecting：FAM and HEX.
4.3.3 after being provided with, file, operation program are preserved.
5 interpretations of result
Reaction automatically saves result after terminating, according to image adjustment Baseline Start values after analysis, End values and (user can voluntarily adjust Threshold values according to actual conditions, and Start values can beEnd values may be provided in Threshold Value values are set in Log collection of illustrative plates window, baseline is located at amplification curve exponential phase, negative quality-control product is set Amplification curve is straight or less than threshold line), click on Analysis automatically obtain analysis result, watch result in Report interfaces, Record unknown sample numerical value (C).
6 quality controls
Negative quality-control product：Total negative
Positive quality control product：Total positives, weakly positive quality-control product detected value allowed band 1 × 102~5.0 × 102copy/ml；
Positive qualitative reference product：It is the positive, and 0.97≤| r |≤1 (Correlation numerical value is r)
Requirements above need to meet that otherwise, this experiment is invalid, and all experimentss should re-start simultaneously in same experiment.
7 results judge
If 7.1 are equal to 30 in FAM detection channel amplification curves without obvious increased logarithmic phase or Ct values, detect and believe in VIC Road amplification curve has increased logarithmic phase, then the Chromosome DNA concentrations for sentencing sample are less than detection sensitivity.
If 7.2 have increased logarithmic phase and Ct values ＜ 30 in FAM detection channel amplification curves, judge by the following method：
If the C ＜ 100 of sample, the Chromosome DNA concentration ＜ 100copy/ml of the sample；
If 100≤C≤1.00 × 10 of sample8, then Chromosome DNA concentrations=C copy/ml of the sample；
If the C ＞ 1.00 × 10 of sample8, then the Chromosome DNA concentrations ＞ 5 × 10 of the sample6copy/ml.If Accurate quantification result is needed, Sample Negative quality-control product can be diluted to after the range of linearity and detected again.The then sample Chromosome DNA concentrations=(C × extension rate) copy/ml.
The explanation of 8 assays
1 each experiment is both needed to detect negative quality-control product, Chromosome strong positive quality-control products, the critical positives of Chromosome Quality-control product, quality-control product result meet the judgement that testing result can be carried out during quality control requirement.
2 positive findings criterion：There are increased logarithmic phase and Ct values ＜ 30 in FAM detection channel amplification curves.
3 negative findings criterion：Detected in FAM and lead to first amplification curve without obvious increased logarithmic phase or Ct values equal to 30, There is increased logarithmic phase in VIC detection channel amplification curves.
9 properties of product
Shown according to clinical test results, the sensitivity of this kit is 1 × 102Copy/ml, the range of linearity are This kit and total coincidence rate of contrast agents are 100%；To serum and blood Starch two types pattern detection result indifference.
For sample after the extraction liquid kit extraction of unicellular gene order, preferred embodiment is to be detected by chromosomal nucleic acid Kit carries out amplification identification, other method can also be taken to identify.
Above content only preferably under embodiment scheme, the protection domain not thereby limited the invention, every utilization The equivalent structure transformation that present specification is made, or directly or indirectly with the technology neck for being attached to other Related products Domain, it is included within the scope of the present invention.
SEQUENCE LISTING
<110>Hu Song
<120>Gene primer combines and unicellular gene order extraction liquid kit
<130>
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 21
<212> DNA
<213>Artificial sequence
<400> 1
cagcgatgat tacagtccag c 21
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence
<400> 2
acaggccatg cacagagaga 20
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence
<400> 3
cgggtaaggg tactggcctt 20
<210> 4
<211> 22
<212> DNA
<213>Artificial sequence
<400> 4
gctgatctct gagtttcgca tt 22
<210> 5
<211> 19
<212> DNA
<213>Artificial sequence
<400> 5
cgttgatggg cggtaagtg 19
<210> 6
<211> 22
<212> DNA
<213>Artificial sequence
<400> 6
acaaacaact cccctcctct tg 22

Claims (2)

  1. A kind of 1. combination of gene primer, it is characterised in that：Including six gene primers,
    The sequence of first primer is：CAGCGATGATTACAGTCCAGC；
    The sequence of second primer is：ACAGGCCATGCACAGAGAGA；
    The sequence of the three-primer is：CGGGTAAGGGTACTGGCCTT；
    The sequence of 4th primer is：GCTGATCTCTGAGTTTCGCATT；
    The sequence of 5th primer is：CGTTGATGGGCGGTAAGTG；
    The sequence of 6th primer is：ACAAACAACTCCCCTCCTCTTG.
  2. 2. a kind of unicellular gene order extraction liquid kit, including primer, Taq enzyme system, it is characterised in that：
    The primer combines for said gene primer, and primer is sub-packed in A1, A2, B3 extraction with Taq enzyme system and mixed in liquid pipe；
    Wherein A1 extraction mixed liquors are made up of following component：2.5 μ l 10pmol/ μ l primers, primer final concentration of 30~ 900nM, 25 μ l archaeal dna polymerase dNTP buffer solution mixtures final concentration 1 ×, 20.5 μ l aseptic deionized water；
    A2 extraction mixed liquors are made up of following component：2.5 μ l 15pmol/ μ l primers, the final concentration of 30~900nM of primer, 25 μ L phi29DNA polymerase dNTP buffer solution mixtures final concentration 1 ×, 20.5 μ l aseptic deionized water；
    B3 extraction mixed liquors are made up of following component：2.5 μ l 25pmol/ μ l primers, primer final concentration of 30~900nM, 25 μ L Taq enzyme system dNTP buffer solution mixtures final concentration 1 ×, 20.5 μ l aseptic deionized waters.
CN201710607549.0A 2017-07-24 2017-07-24 Gene primer combines and unicellular gene order extraction liquid kit Pending CN107365768A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710607549.0A CN107365768A (en) 2017-07-24 2017-07-24 Gene primer combines and unicellular gene order extraction liquid kit

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710607549.0A CN107365768A (en) 2017-07-24 2017-07-24 Gene primer combines and unicellular gene order extraction liquid kit

Publications (1)

Publication Number Publication Date
CN107365768A true CN107365768A (en) 2017-11-21

Family

ID=60308484

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710607549.0A Pending CN107365768A (en) 2017-07-24 2017-07-24 Gene primer combines and unicellular gene order extraction liquid kit

Country Status (1)

Country Link
CN (1) CN107365768A (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104630214A (en) * 2015-01-20 2015-05-20 胡松 Combination of SRY gene primer pair and probe and SRY multi-site detection kit
CN105176977A (en) * 2015-08-20 2015-12-23 四川新生命干细胞科技股份有限公司 Primer, kit and method for identifying sex of human individuals and human cell strains

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104630214A (en) * 2015-01-20 2015-05-20 胡松 Combination of SRY gene primer pair and probe and SRY multi-site detection kit
CN105176977A (en) * 2015-08-20 2015-12-23 四川新生命干细胞科技股份有限公司 Primer, kit and method for identifying sex of human individuals and human cell strains

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
佚名: "Accession NO. NM_003140", 《GENBANK》 *
刘维瑜等: "多重置换扩增——一种新的全基因组扩增技术", 《国际遗传学杂志》 *

Similar Documents

Publication Publication Date Title
CN102925562B (en) Kit and method for detecting aminoglycoside drug-induced deafness-sensitive gene
CN102154503A (en) Method for detecting DNA (deoxyribonucleic acid) content of CHO (cholesterol) cells by probe
CN106520984A (en) Pseudomonas aeruginosa nucleic acid fluorescent PCR (polymerase chain reaction) detection kit and detection method
CN102586473B (en) Hepatitis B virus genotyping PCR (polymerase chain reaction) test kit
CN103740832B (en) A kind of Cryptococcus neoformans detection kit
CN107523635A (en) A kind of TGFBI gene pleiomorphisms quick detection kit and its detection method
CN113718021A (en) Primer, probe and kit for quantitatively detecting BCR-ABL1 fusion gene
CN105112558B (en) The triple real time fluorescent quantitative RT PCR detection kits of the type of foot and mouth disease virus O, A and Asia I
CN104673926B (en) Pine beam thread insect PCR detection kit and its detection method
CN111304361A (en) Kit for detecting African swine fever virus and method for detecting African swine fever virus
CN102634572B (en) Reagent kit for detecting mRNA (messenger ribonucleic acid) expression of fused gene E2A-PBX1 via fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction)
CN107287320A (en) The LAMP detections of GAPDH genes are combined and kit with primer
CN108048589A (en) The Real-time PCR specific primers and probe and detection kit and detection method of ox two-pressure humidity generator
CN103074428B (en) A kind of mycobacterium tuberculosis TB detection kits
CN108070636A (en) A kind of processing method and kit of fluorescent PCR amplified sample
CN106755572A (en) I types DHV and duck plague virus double fluorescent quantitative PCR method
CN105779644B (en) The real-time fluorescence nucleic acid isothermal amplification detection kit of human cytomegalovirus
CN103074429B (en) UU (ureaplasma urealyticum) detection kit
CN104630214B (en) Combination of SRY gene primer pair and probe and SRY multi-site detection kit
CN112195278A (en) Six respiratory tract virus nucleic acid detection kit and use method thereof
CN103224998A (en) Rotavirus PCR detection kit and detection method thereof
CN102181567A (en) Real-time fluorescent quantitative PCR (polymerase chain reaction) kit for detecting candida glabrata
US20200216870A1 (en) Non-purified nucleic acid amplification method and device
CN107365768A (en) Gene primer combines and unicellular gene order extraction liquid kit
CN104894112B (en) A kind of Japanese B encephalitis virus real-time fluorescence isothermal amplification detection kit and its primer and probe

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20171121

RJ01 Rejection of invention patent application after publication