CN107365764A - A kind of method of high-flux rice leaf DNA extraction - Google Patents
A kind of method of high-flux rice leaf DNA extraction Download PDFInfo
- Publication number
- CN107365764A CN107365764A CN201710539435.7A CN201710539435A CN107365764A CN 107365764 A CN107365764 A CN 107365764A CN 201710539435 A CN201710539435 A CN 201710539435A CN 107365764 A CN107365764 A CN 107365764A
- Authority
- CN
- China
- Prior art keywords
- dna
- orifice plates
- rice leaf
- method described
- result
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
- C12N15/1006—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Botany (AREA)
- Mycology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of method of high-flux rice leaf DNA extraction, including take appropriate rice leaf to be put into appropriate containers, be baked under the conditions of being placed in 55 65 DEG C dry；Grinding；Then DNA extract solutions are added, are extracted after mixing；Extract solution is centrifuged；Appropriate supernatant is taken, adds the ultra-pure water of 19 60 times of volumes, mixes, produces DNA.The inventive method advantage：It is safe and non-toxic without to any organic solvent；Without being handled with liquid nitrogen, the operating method of oven for drying blade is low to experiment condition dependency degree, easily realizes, and result is not influenceed；Matched liquor removing workstation, realize high throughput automated.
Description
Technical field
The present invention relates to a kind of method of high-flux rice leaf DNA extraction.
Background technology
The rice leaf DNA extracted using the methods of CTAB can meet the requirement of KASP genotypings, Array
Preferable result can be obtained on tape.But time-consuming for this method, and flux is low, and it is poisonous organic molten to use a large amount of chloroforms etc.
Liquid, sequencing or genetic chip etc. are only applicable to for the high experiment of DNA quality requirements, is carried for extensive high flux leaf DNA
Such as identified for genes, pure lines material is taken to mark parting etc. to be then not suitable for very much on a small quantity.Therefore exploitation is without using poisonous organic reagent
Rapid extraction rice leaf DNA method is very important.
By " boiling method for quickly preparing oryza sativa genomic dna pcr template " impressively, it is understood that utilizing TE buffer solutions
Rice leaf DNA can be extracted by carrying out boiling water bath, and the DNA can meet the requirement of regular-PCR experiment.It is desirable that find one kind
The method that high-flux rice leaf DNA extraction can be carried out, and the requirement of KASP genotypings can be met.
The content of the invention
It is an object of the present invention to provide a kind of method of high-flux rice leaf DNA extraction, to meet KASP genotypings
Requirement.
Technical solution of the present invention is as follows：
A kind of method of high-flux rice leaf DNA extraction, including：Take appropriate rice leaf to be put into appropriate containers, put
It is baked under the conditions of 55-65 DEG C dry (typically toasting 60-90min)；Grinding；Then DNA extract solutions are added, are carried after mixing
Take；Extract solution is centrifuged；Appropriate supernatant is taken, the ultra-pure water of 19-60 volumes times (preferably 29-59 volumes times) is added, mixes, i.e.,
Obtain DNA.
Usually can by the use of 96 orifice plates (such as NUNC96 hole depths orifice plate) or ELISA Plate as container, both can lid silica gel lid or
Aluminium foil paper membrane can be sealed up.
Usually, can be toasted in baking oven；For most of rice leafs, 60min or so can be toasted under the conditions of 65 DEG C.
The present invention can be ground using conventional method；Such as add appropriate steel ball (diameter 4mm) during grinding.Also can use
Genogrinder is ground, and can generally be ground 1-3 minutes in 1200-1400rpm (such as 1200rpm is ground 2 minutes).
Preferably, in terms of mg/uL, the mass volume ratio of rice leaf and DNA extract solutions is (15-40):(500-700),
Preferably 20:(500-600), more preferably 20:500.
Preferably, the Extracting temperature is 65-80 temperature, more preferably 75 DEG C.
Preferably, the extraction time is 30-45min, more preferably 30min.
Preferably, in the extraction process simultaneously or certain interval of time (such as per 15-20min) carries out mixing processing
(as used vortex oscillator).
Usually, can be extracted in baking oven.
Usually, can be in 3600-5300rpm, centrifugation 10-20min (such as 4000rpm, centrifugation 10min).
The DNA extract recipes are as follows：
| Reagent | Dosage | Final concentration |
| KCl | 74.55g | 1M |
| 1M Tris-HCl(pH 8.0) | 100mL | 0.1M |
| 0.5M EDTA(pH 8.0) | 20mL | 0.01M |
| H2O | 880mL |
Specifically, the method for above-mentioned high-flux rice leaf DNA extraction, comprises the following steps：
1. take about 20mg rice leafs that 96 orifice plates are placed in into 60- in 5065 DEG C of baking oven into the orifice plates of 2mL 96
90min；
2. taking out 96 orifice plates, 2 4mm steel balls are added per hole, pellosil is covered rapidly, is placed in genogrinder,
1200-1400rpm is ground 13 minutes；
3. tearing pellosil, add DNA extract solution 500-600uL per hole, cover pellosil, it is fully mixed in vortex oscillator
It is even；
4. 96 orifice plates are placed in into 30-45min in 65-80 DEG C of baking oven, 96 orifice plates are taken out in 15-20min and are placed in whirlpool
Fully mixed on oscillator；
5. 96 orifice plates are taken out, 3600-5300rpm centrifugations 10-20min；
6. appropriate supernatant (such as 20uL) is extracted to new appropriate containers (such as the orifice plates of 2mL 96)；
Every part 7. (or per hole) mixes plus the ultra-pure water (diluting 20-60 times) of 19-59 times of supernatant volume and produces DNA.
Present invention additionally comprises application of the above method on KASP genotypings.
The advantages of the inventive method：
1) do not have to arrive any organic solvent, it is safe and non-toxic；
2) without being handled with liquid nitrogen, the operating method of oven for drying blade is low to experiment condition dependency degree, easily real
It is existing, and result is not influenceed；
3) matched liquor removing workstation, realize high throughput automated.
Brief description of the drawings
Fig. 1-8 is experimental result picture in experiment 1；
Fig. 9-12 is experimental result picture in experiment 2；
Figure 13-17 is experimental result picture in experiment 3；
Figure 18 is that DNA extracts flow chart.
Embodiment
Following examples are used to illustrate the present invention, but are not limited to the scope of the present invention.It is unreceipted specific in embodiment
Technology or condition person, according to the technology or condition described by document in the art, such as Sambrook equimolecular cloning experimentation hands
Volume (Sambrook J＆Russell DW, Molecular Cloning:A Laboratory Manual, 2001), or according to
Product description is carried out.Agents useful for same or the unreceipted production firm person of instrument, it is that can be commercially available by regular distributor
Conventional products.
In testing below, rice leaf DNA extraction method (hereinafter referred to as one-step method) step is following, and (DNA extractions flow is shown in
Fig. 1)：
1. take about 20mg rice leafs that 96 orifice plates are placed in into 60min in 65 DEG C of baking oven into the orifice plates of 2mL 96；
2. taking out 96 orifice plates, 2 4mm steel balls are added per hole, pellosil is covered rapidly, is placed in genogrinder,
1200rpm is ground 2 minutes；
3. tearing pellosil, add DNA extract solution 500uL per hole, cover pellosil, fully mixed in vortex oscillator；
4. 96 orifice plates are placed in into 30min in 75 DEG C of baking ovens, 96 orifice plates are taken out to be placed in vortex oscillator in 20min and filled
Divide and mix；
5. 96 orifice plates are taken out, 4000rpm, centrifugation 10min；
6. supernatant 20uL is extracted to the new orifice plates of 2mL 96；
7. adding 380-1180uL ultra-pure waters (diluting 20-60 times) per hole, mix and produce DNA.
Wherein, DNA extract recipes used are as follows：
| Reagent | Dosage | Final concentration |
| KCl | 74.55g | 1M |
| 1M Tris-HCl(pH 8.0) | 100mL | 0.1M |
| 0.5M EDTA(pH 8.0) | 20mL | 0.01M |
| H2O | 880mL |
Experiment 1
Using 94 parts of rice leaf materials (existing CTAB methods genotype), supernatant 20uL is extracted, it is dilute with ultra-pure water respectively
10,15,20,25,30,40,50 times are released, using 4 primers, parting is carried out on Array tape.
The DNA of 10,15 times of dilution can not carry out parting on Array tape, therefore not count its result.Missing rates are
The ratio of the sample of genotype can not be divided.
Error rate is shown as：One-step method is that homozygous CTAB methods are heterozygous or one-step method is that heterozygous CTAB is homozygous
Type, do not find that one-step method is homozygous and CTAB methods are another homozygous phenomenon.
Experimental result is as follows：
1) 20 times are diluted to contrast with CTAB methods
K_010104 results are shown in Fig. 1, and the result sub-clustering that one-step method dilutes 20 times is obvious, as a result also concentrates, NTC generally within
Origin.D7 samples is homozygous in CTAB methods, but it is heterozygous to dilute the results of D7 samples in 20 times in one-step method, by upper figure
Though it can be found that D7 samples delimited as heterozygous, its position be located at heterozygous and it is homozygous between, this phenomenon is probably
Caused by liquid separation inequality, it is also possible to caused by sample is impure.Similar situation has occurred in other primers, but does not occur
One-step method is homozygosis and CTAB methods are another homozygous situation.
2) 25 times are diluted to contrast with CTAB methods
K_010108 results are shown in Fig. 2, and the result sub-clustering that one-step method dilutes 25 times is obvious, as a result also more concentrates, NTC is located at
Origin.In CTAB methods, C11 samples are heterozygous, but dilute the result of C11 samples in 25 times in one-step method to be homozygous.Class
As situation also appear in other primers, but do not occur that one-step method is homozygous and CTAB methods are another homozygous situation,
And this error probability is less than 0.7%.
3) 30 times are diluted to contrast with CTAB methods
K_010104 results are shown in Fig. 3, and the result sub-clustering that one-step method dilutes 30 times is obvious, as a result also concentrates, NTC generally within
Origin.In CTAB methods, D6 samples is homozygous, but D6 samples are heterozygous in one-step method dilutes 30 times, can be with by upper figure
Though it was found that D6 samples delimited as heterozygous, its position be located at heterozygous and it is homozygous between, this phenomenon is probably liquid separation
Caused by inequality, it is also possible to caused by sample is impure.
4) 40 times are diluted to contrast with CTAB methods
K_010115 results are shown in Fig. 4, and the result sub-clustering that one-step method dilutes 40 times is obvious, as a result also concentrates, and NTC is positioned at original
Point.In CTAB methods, H6 samples are homozygous, but H6 samples are heterozygous in one-step method dilutes 40 times, can be sent out by upper figure
Though existing H6 samples delimited as heterozygous, its position be located at heterozygous and it is homozygous between, this phenomenon be probably liquid separation not
Caused by.
5) 50 times are diluted to contrast with CTAB methods
K_010115 results are shown in Fig. 5, and the result sub-clustering that one-step method dilutes 50 times is obvious, as a result also more concentrates.In CTAB
In method, F12 samples is homozygous, but it is heterozygous to dilute the results of F12 samples in 50 times in one-step method.Similar situation also goes out
In other present primers, and this error probability is less than 0.3%.
6) 20,25,30,40,50 times are diluted to compare
K_070067 results are shown in Fig. 6, Fig. 6-1,6-2,6-3,6-4,6-5,6-6 be respectively one-step method dilution 20,25,30,
40th, 50 times and CTAB method result figures, from the point of view of primer K_070067, one-step method dilutes 20,25,30,40,50 times of results very
Good, sub-clustering is obvious and concentrates, and NTC is in origin.Compared with CTAB methods, no significant difference.
7) K_010115 results are shown in Fig. 7, Fig. 7-1,7-2,7-3,7-4,7-5,7-6 be respectively one-step method dilution 20,25,
30th, 40,50 times and CTAB method result figures.
8) K_110223 results are shown in Fig. 8：
Fig. 8-1,8-2,8-3,8-4,8-5,8-6 are respectively that one-step method dilutes 20,25,30,40,50 times and CTAB method results
Figure
In terms of primer K_010115 and K_110223 result, one-step method, which dilutes 20,25,30,40,50 times, can obtain
Preferable genotyping result, NTC positions are generally within origin.The result no significant difference compared with CTAB methods.
Analysis：
1) one-step method at least dilutes more than 20 times, the genotyping result that could be stablized on Array tape.This be by
Very small (0.8ul) in Array tape reaction systems, the DNA of higher concentration is due to carrying more impurity thus inhibiting
PCR reacts.
2) one-step method dilutes 20,25,30,40,50 times can obtain preferable parting in all primers, and recall rate exists
More than 97.9%, 0.7% is respectively less than with the erroneous matching rate of CTAB methods, and it is homozygous CTAB that all error rates, which are all from footwork,
Method is heterozygosis or one-step method is that heterozygosis CTAB is homozygous, does not find that one-step method is homozygosis and CTAB methods are another homozygous show
As.Because the error of minimum probability occurs in large-scale work station liquid separation, such error rate is to keep away in high flux detection
Exempt from.
Experiment 2
Using 95 parts of rice leaf materials (existing CTAB methods genotype), supernatant 20uL is extracted, it is dilute with ultra-pure water respectively
30,40,50,60 times are released, using 4 marks, parting is carried out on Array tape.
Primer is：K_010104, K_010115, K_100016, K_110223.
| Extension rate | With CTAB method matching rates | Missing rates | Error rate |
| 30 times | 98.77% | 1.01% | 0.12% |
| 40 times | 99.04% | 0.88% | 0.08% |
| 50 times | 98.68% | 1.01% | 0.26% |
| 60 times | 98.68% | 1.14% | 0.18% |
Missing rates are the ratio for the sample that can not divide genotype.
All error rates are all due to that one-step method is that homozygous CTAB methods are heterozygosis or one-step method is that heterozygosis CTAB is homozygous, institute
Have does not have to find that one-step method is homozygosis and CTAB methods are another homozygous phenomenon in experimental result.
Experimental result is as follows：
K_010104 results are shown in Fig. 9, and Fig. 9-1,9-2,9-3,9-4 are respectively that one-step method dilutes 30,40,50,60 times of results
Figure.
One-step method dilutes that 30,40,50,60 times of results are fine, and sub-clustering is obvious and concentrates, and NTC is in origin, as a result unanimously
Property is good.Compared with CTAB methods, indifference.
K_010115 results are shown in Figure 10.Figure 10-1,10-2,10-3,10-4 are respectively that one-step method dilutes 30,40,50,60 times
Result figure.
30,40,50,60 times of results of one-step method dilution are fine, and sub-clustering is obvious and concentrates, and NTC is in origin, difference dilution
Multiple result uniformity is good.Compared with CTAB methods, indifference.
K_100016 results are shown in Figure 11.
Figure 11-1,11-2,11-3,11-4 are respectively that one-step method dilutes 30,40,50,60 times of result figures.
30,40,50,60 times of results of one-step method dilution are fine, and sub-clustering is obvious and concentrates, and NTC is in origin, difference dilution
Multiple result uniformity is good.Compared with CTAB methods, indifference.
K_110223 results are shown in Figure 12.Figure 12-1,12-2,12-3,12-4 are respectively that one-step method dilutes 30,40,50,60 times
Result figure.
30,40,50,60 times of results of one-step method dilution are fine, and sub-clustering is obvious and concentrates, and NTC is in origin, difference dilution
Multiple result uniformity is good.Compared with CTAB methods, indifference.
Analysis：
Consistent with 1 result of experiment, 30,40,50,60 times of dilution can carry out good parting on Array tape, and
As a result sub-clustering is substantially concentrated, and the matching rate with CTAB results is all more than 98.5%, and error rate is below 0.3%.
Experiment 3
The blade of 12 kinds of rice is taken, (supernatant 20uL is extracted according to above DNA extraction experimental procedure extractions DNA, uses respectively
Ultra-pure water dilutes 30 times), gained DNA carries out KASP genotypings, carries out the detection of 5 marks, sample arrangement and parting altogether
As a result it is as follows：
Experimental result is as follows：
K_010104 results are shown in Figure 13.Figure 13-1 and Figure 13-2 is that one-step method dilutes 30 times of results with CTAB methods respectively
Figure.
K_010111 results are shown in Figure 14.Figure 14-1 and Figure 14-2 is that one-step method dilutes 30 times of results with CTAB methods respectively
Figure.
K_070067 results are shown in Figure 15.Figure 15-1 and Figure 15-2 is that one-step method dilutes 30 times of results with CTAB methods respectively
Figure.
K_010115 results are shown in Figure 16：Figure 16-1 and Figure 16-2 is that one-step method dilutes 30 times of results with CTAB methods respectively
Figure.
K_100016 results are shown in Figure 17：Figure 17-1 and Figure 17-2 is that one-step method dilutes 30 times of results with CTAB methods respectively
Figure.
In the parting figure of above-mentioned 5 marks, it may be seen that the leaf DNA extracted with our methods can be carried out very
Good amplification, the genotyping result of same sample is consistent, and genotyping result sub-clustering is obvious, and the result of phase homogenic type gathers concentration,
Genotype can be easily divided very much, NTC also is located at origin.
Analysis：
1) one-step method, which dilutes 20~60 times, can meet that KASPar detects 0.8ul reaction systems, and from final parting knot
Find out that 20~60 times of one-step method dilution is basically identical with the result of CTAB methods on fruit figure.
2) NTC is respectively positioned on origin in result, and genotyping result concentrates degree of gathering height.
3) 20,25 times of results of one-step method dilution are relatively weaker, and it is fine that one-step method dilutes 30~60 times of results.
The primer of the present invention is as follows：
K_010104
Forward primer 1：GAAGGTGACCAAGTTCATGCTATCTTTGAATTTAAAGAATTACTCACCGATA
Forward primer 2：GAAGGTCGGAGTCAACGGATTCTTTGAATTTAAAGAATTACTCACCGATC
Reverse primer：CCATAATGTGGATAAGGATTTTCTGAAGTT
K_010108
Forward primer 1：GAAGGTGACCAAGTTCATGCTCGTTGCATCGTGGAGCACGAAAT
Forward primer 2：GAAGGTCGGAGTCAACGGATTGTTGCATCGTGGAGCACGAAAC
Reverse primer：GATCACCGCTCTCGTAGCGCTT
K_010111
Forward primer 1：GAAGGTGACCAAGTTCATGCTCCAAGATCAAGAACCAAGTATTGCAG
Forward primer 2：GAAGGTCGGAGTCAACGGATTACCAAGATCAAGAACCAAGTATTGCAA
Reverse primer：TGCAAGAGCGTCGGGCACGAT
K_010115
Forward primer 1：GAAGGTGACCAAGTTCATGCTCGGTACCTTGAGAGAGCGCAA
Forward primer 2：GAAGGTCGGAGTCAACGGATTCGGTACCTTGAGAGAGCGCAG
Reverse primer：GCACGGCAGAGATGTACCGCAT
K_070067
Forward primer 1：GAAGGTGACCAAGTTCATGCTGACTGCGTTGAATTGAACCGGGA
Forward primer 2：GAAGGTCGGAGTCAACGGATTGACTGCGTTGAATTGAACCGGGT
Reverse primer：ATGAAACAGCGACGGCCATTACCTT
K_100016
Forward primer 1：GAAGGTGACCAAGTTCATGCTGGAAACTCTGATCCGGAACGT
Forward primer 2：GAAGGTCGGAGTCAACGGATTGGAAACTCTGATCCGGAACGC
Reverse primer：GTAGATGGTTTGCGCGGAGTATACAT
K_110223
Forward primer 1：GAAGGTGACCAAGTTCATGCTGTGCCATATGGTGGCATGAGACA
Forward primer 2：GAAGGTCGGAGTCAACGGATTGCCATATGGTGGCATGAGACC
Reverse primer：ATTGGTGGTTCAACAAGTGACATCCATTA
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.
<110>Hua Zhi rice biologicals Technology Co., Ltd.
<120>A kind of method of high-flux rice leaf DNA extraction
<130> KHP171112764.0
<160> 21
<170> PatentIn version 3.3
<210> 1
<211> 52
<212> DNA
<213>Artificial sequence
<400> 1
gaaggtgacc aagttcatgc tatctttgaa tttaaagaat tactcaccga ta 52
<210> 2
<211> 50
<212> DNA
<213>Artificial sequence
<400> 2
gaaggtcgga gtcaacggat tctttgaatt taaagaatta ctcaccgatc 50
<210> 3
<211> 30
<212> DNA
<213>Artificial sequence
<400> 3
ccataatgtg gataaggatt ttctgaagtt 30
<210> 4
<211> 44
<212> DNA
<213>Artificial sequence
<400> 4
gaaggtgacc aagttcatgc tcgttgcatc gtggagcacg aaat 44
<210> 5
<211> 43
<212> DNA
<213>Artificial sequence
<400> 5
gaaggtcgga gtcaacggat tgttgcatcg tggagcacga aac 43
<210> 6
<211> 22
<212> DNA
<213>Artificial sequence
<400> 6
gatcaccgct ctcgtagcgc tt 22
<210> 7
<211> 47
<212> DNA
<213>Artificial sequence
<400> 7
gaaggtgacc aagttcatgc tccaagatca agaaccaagt attgcag 47
<210> 8
<211> 48
<212> DNA
<213>Artificial sequence
<400> 8
gaaggtcgga gtcaacggat taccaagatc aagaaccaag tattgcaa 48
<210> 9
<211> 21
<212> DNA
<213>Artificial sequence
<400> 9
tgcaagagcg tcgggcacga t 21
<210> 10
<211> 42
<212> DNA
<213>Artificial sequence
<400> 10
gaaggtgacc aagttcatgc tcggtacctt gagagagcgc aa 42
<210> 11
<211> 42
<212> DNA
<213>Artificial sequence
<400> 11
gaaggtcgga gtcaacggat tcggtacctt gagagagcgc ag 42
<210> 12
<211> 22
<212> DNA
<213>Artificial sequence
<400> 12
gcacggcaga gatgtaccgc at 22
<210> 13
<211> 44
<212> DNA
<213>Artificial sequence
<400> 13
gaaggtgacc aagttcatgc tgactgcgtt gaattgaacc ggga 44
<210> 14
<211> 44
<212> DNA
<213>Artificial sequence
<400> 14
gaaggtcgga gtcaacggat tgactgcgtt gaattgaacc gggt 44
<210> 15
<211> 25
<212> DNA
<213>Artificial sequence
<400> 15
atgaaacagc gacggccatt acctt 25
<210> 16
<211> 42
<212> DNA
<213>Artificial sequence
<400> 16
gaaggtgacc aagttcatgc tggaaactct gatccggaac gt 42
<210> 17
<211> 42
<212> DNA
<213>Artificial sequence
<400> 17
gaaggtcgga gtcaacggat tggaaactct gatccggaac gc 42
<210> 18
<211> 26
<212> DNA
<213>Artificial sequence
<400> 18
gtagatggtt tgcgcggagt atacat 26
<210> 19
<211> 44
<212> DNA
<213>Artificial sequence
<400> 19
gaaggtgacc aagttcatgc tgtgccatat ggtggcatga gaca 44
<210> 20
<211> 42
<212> DNA
<213>Artificial sequence
<400> 20
gaaggtcgga gtcaacggat tgccatatgg tggcatgaga cc 42
<210> 21
<211> 29
<212> DNA
<213>Artificial sequence
<400> 21
attggtggtt caacaagtga catccatta 29
Claims (10)
- A kind of 1. method of high-flux rice leaf DNA extraction, it is characterised in that including：Appropriate rice leaf is taken to be put into suitably In container, it is baked under the conditions of being placed in 55-65 DEG C dry；Grinding；Then DNA extract solutions are added, are extracted after mixing；Will extraction Liquid centrifuges；Appropriate supernatant is taken, adds the ultra-pure water of 19-60 times of volume, mixes, produces DNA.
- 2. according to the method for claim 1, it is characterised in that the DNA extract recipes are as follows：
- 3. method according to claim 1 or 2, it is characterised in that add the ultra-pure water of 29-59 times of volume of supernatant.
- 4. according to the method described in claim any one of 1-3, it is characterised in that in terms of mg/uL, rice leaf extracts with DNA The mass volume ratio of liquid is (15-40):(500-700), preferably 20:(500-600), more preferably 20:500.
- 5. according to the method described in claim any one of 1-3, it is characterised in that the baking time is 60-90min；It is preferred that 60min or so is toasted under the conditions of 65 DEG C.
- 6. according to the method described in claim any one of 1-3, it is characterised in that it is ground using genogrinder, in 1200-1400rpm grinds 1-3 minutes.
- 7. according to the method described in claim any one of 1-6, it is characterised in that the Extracting temperature is 65-80 temperature, preferably For 75 DEG C；And/or the extraction time is 30-45min, preferably 30min.
- 8. according to the method described in claim any one of 1-6, it is characterised in that it is described centrifugation be in 3600-5300rpm, from Heart 10-20min；It is preferable over 4000rpm, centrifugation 10min.
- 9. according to the method described in claim any one of 1-8, it is characterised in that comprise the following steps：1. take about 20mg rice leafs that 96 orifice plates are placed in into 60-90min in 5065 DEG C of baking oven into the orifice plates of 2mL 96；2. taking out 96 orifice plates, 2 4mm steel balls are added per hole, pellosil is covered rapidly, is placed in genogrinder, 1200- 1400rpm is ground 13 minutes；3. tearing pellosil, add DNA extract solution 500-600uL per hole, cover pellosil, fully mixed in vortex oscillator；4. 96 orifice plates are placed in into 30-45min in 65-80 DEG C of baking oven, 96 orifice plates are taken out in 15-20min and are placed in vortex oscillation Fully mixed on device；5. 96 orifice plates are taken out, 3600-5300rpm centrifugations 10-20min；6. appropriate supernatant is extracted to new appropriate containers；7. every part of ultra-pure water for adding 19-59 times of supernatant volume, mixes and produces DNA.
- 10. any one of claim 1-9 methods described, the application on KASP genotypings.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710539435.7A CN107365764B (en) | 2017-07-04 | 2017-07-04 | Method for extracting DNA (deoxyribonucleic acid) of high-flux rice leaves |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710539435.7A CN107365764B (en) | 2017-07-04 | 2017-07-04 | Method for extracting DNA (deoxyribonucleic acid) of high-flux rice leaves |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107365764A true CN107365764A (en) | 2017-11-21 |
| CN107365764B CN107365764B (en) | 2020-08-25 |
Family
ID=60305100
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710539435.7A Active CN107365764B (en) | 2017-07-04 | 2017-07-04 | Method for extracting DNA (deoxyribonucleic acid) of high-flux rice leaves |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107365764B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107828781A (en) * | 2018-01-12 | 2018-03-23 | 江苏徐淮地区徐州农业科学研究所(江苏徐州甘薯研究中心) | A kind of simple and quick paddy DNA extracting method |
| CN109022422A (en) * | 2018-09-10 | 2018-12-18 | 吉林农业大学 | A method of extracting fungal genomic DNA |
| CN110484533A (en) * | 2019-09-05 | 2019-11-22 | 毕节市农业科学研究所 | A kind of preparation method of the rice leaf largely extracted for DNA |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102839167A (en) * | 2011-06-23 | 2012-12-26 | 匡贤彦 | Method for simple and rapid high-throughout extraction of plant genome DNA |
| CN103436524A (en) * | 2013-06-17 | 2013-12-11 | 华南农业大学 | Method for batch extraction of rice endosperm DNA |
| CN105779441A (en) * | 2016-05-16 | 2016-07-20 | 中国农业科学院棉花研究所 | Method for extracting DNA (deoxyribonucleic acid) by rapidly drying plant leaves with oven |
-
2017
- 2017-07-04 CN CN201710539435.7A patent/CN107365764B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102839167A (en) * | 2011-06-23 | 2012-12-26 | 匡贤彦 | Method for simple and rapid high-throughout extraction of plant genome DNA |
| CN103436524A (en) * | 2013-06-17 | 2013-12-11 | 华南农业大学 | Method for batch extraction of rice endosperm DNA |
| CN105779441A (en) * | 2016-05-16 | 2016-07-20 | 中国农业科学院棉花研究所 | Method for extracting DNA (deoxyribonucleic acid) by rapidly drying plant leaves with oven |
Non-Patent Citations (2)
| Title |
|---|
| THOMAS H. TAI等: "A rapid and inexpensive method for isolation of total DNA from dehydrated plant tissue", 《PLANT MOLECULAR BIOLOGY REPORT》 * |
| 韩玉杰等: "几种提取植物DNA方法的比较", 《山西农业科学》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107828781A (en) * | 2018-01-12 | 2018-03-23 | 江苏徐淮地区徐州农业科学研究所(江苏徐州甘薯研究中心) | A kind of simple and quick paddy DNA extracting method |
| CN109022422A (en) * | 2018-09-10 | 2018-12-18 | 吉林农业大学 | A method of extracting fungal genomic DNA |
| CN110484533A (en) * | 2019-09-05 | 2019-11-22 | 毕节市农业科学研究所 | A kind of preparation method of the rice leaf largely extracted for DNA |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107365764B (en) | 2020-08-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107365764A (en) | A kind of method of high-flux rice leaf DNA extraction | |
| CN108060159B (en) | A kind of DNA extraction method rich in polysaccharide polyphenol plant | |
| CN114134236A (en) | Application of reagent for detecting SNP molecular marker in goat RBP4 genotyping and/or goat molecular marker assisted breeding | |
| CN106755374A (en) | A kind of tick worm nest-type PRC specific primer and tick worm nest-type PRC authentication method | |
| CN104561332A (en) | SSR molecular marker for identifying aspen gender and application of SSR molecular marker | |
| CN105255873B (en) | The related SNP marker of cucumber female character is marked and its applied with InDel | |
| Kacar et al. | Genetic relationships of some Citrus genotypes based on the candidate iron chlorosis genes | |
| CN104404030A (en) | Kit and method for rapidly extracting plant genome DNA | |
| CN109371009A (en) | A kind of method that high throughput maize leaf DNA is extracted | |
| CN103275968A (en) | Method for rapidly extracting single seed DNA (Deoxyribonucleic Acid) | |
| CN108531546A (en) | The method of efficiently convenient extraction paddy DNA | |
| CN107245519A (en) | A kind of PWS and AS quick determination method | |
| CN109666758B (en) | InDel-labeled primer for identifying ligusticum wallichii franchetii and identification method | |
| CN106434645A (en) | ITS (internal transcribed spacer) sequence of dalbergia odorifera and method for identifying dalbergia odorifera by ITS sequence | |
| CN107365763B (en) | Method for rapidly extracting DNA from rice seeds | |
| Yu et al. | Genetic differentiation and delimitation of Pugionium dolabratum and Pugionium cornutum (Brassicaceae) | |
| CN103898236A (en) | Primer pair, kit and method for detecting verticillium lecanii ferment powder added in cordyceps sinensis ultra-fine powder | |
| Yang et al. | Autoscreening of restriction endonucleases for PCR-restriction fragment length polymorphism identification of fungal species, with Pleurotus spp. as an example | |
| CN114622035A (en) | Sweet potato whole genome high-throughput specific InDel molecular marker primer group and application thereof | |
| CN102747153A (en) | Millet waxy gene cosegregation molecular marker and detection method thereof | |
| CN109897886A (en) | A kind of rice plumule Miho Dockyard NA template preparation method and PCR method for PCR amplification | |
| CN106701965A (en) | Mulberry genetic typing method based on single-nucleotide polymorphism markers | |
| CN109055494A (en) | A kind of the RFLP method and kit of the mutation of detection yak horn character cause and effect | |
| CN113832237B (en) | SNP molecular marker related to cholesterol metabolism of meat rabbits and application thereof | |
| CN109457023A (en) | Identify the assortment of genes, the combination of SSR primer, identification method and the application of Chinese honey locust gender |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CP03 | Change of name, title or address |
Address after: 410000 No.618 Heping Road, Furong district, Changsha City, Hunan Province Patentee after: Huazhi Biotechnology Co., Ltd Address before: 410125 Hunan province Changsha Yuanda road two Changsha Longping high tech Industrial Development Zone of High-tech Park National Hybrid Rice Research Center Hospital Patentee before: HUAZHI RICE BIO-TECH Co.,Ltd. |
|
| CP03 | Change of name, title or address |