CN105779441A - Method for extracting DNA (deoxyribonucleic acid) by rapidly drying plant leaves with oven - Google Patents
Method for extracting DNA (deoxyribonucleic acid) by rapidly drying plant leaves with oven Download PDFInfo
- Publication number
- CN105779441A CN105779441A CN201610321613.4A CN201610321613A CN105779441A CN 105779441 A CN105779441 A CN 105779441A CN 201610321613 A CN201610321613 A CN 201610321613A CN 105779441 A CN105779441 A CN 105779441A
- Authority
- CN
- China
- Prior art keywords
- dna
- extracting solution
- plant
- dried
- solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1003—Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
Landscapes
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for extracting DNA (deoxyribonucleic acid) by rapidly drying plant leaves with an oven. The method comprises the following steps: drying organs and/or tissues of a plant in vitro with microwaves (radio waves having a wavelength being 0.12m), crushing the dried organs and/or tissues of the plant, and adding a cell lysis solution into the plant powder to react for 60 to 70 minutes at 65 DEG C to obtain a DNA-containing extracting solution which is referred to as an extracting solution 1; removing impurities from the extracting solution 1 to obtain the DNA. Proved by experiments, the DNA is extracted by drying the tissues and the organs of the plant with the oven, with a short drying time of only 4 to 10 minutes; the extracted DNA can be used for SSR-PCR (Simple Sequence Repeat-Polymerase Chain Reaction), and the dried organs and/or tissues of the plant are convenient to carry, transport, post and the like, such that molecular breeding and molecular detection can be applied more widely; therefore, the method disclosed by the invention has a broad application prospect in molecular mark assisted breeding, purity detection of varieties and identification of authenticity.
Description
Technical field
The method that the present invention relates to utilize microwave oven flash baking plant leaf blade to extract DNA in biological technical field.
Background technology
The extraction of DNA of plants is the basis carrying out biotic experiment, is normally applied low-temp antistaling method and preserves plant leaf blade,
Prevent degraded and the oxidation of DNA, as utilized Liquid nitrogen storage or preserving with ice bag, but carry equal inconvenience.Adopt in recent years
With silica-gel desiccant dried plant blade, extract DNA with dried blade, need 48 hours general drying time,
Centre also needs to change desiccant, operates cumbersome.It is badly in need of one at present and can extract DNA with flash baking plant leaf blade
Method.
Summary of the invention
The technical problem to be solved is how to extract DNA of plants.
For solving above-mentioned technical problem, present invention firstly provides Method of Plant DNA Extraction, described method includes following
1) and 2):
1) it is dried in vitro plant organ and/or tissue with microwave oven, obtains plant organ and/or the tissue being dried；
2) extract described dry plant organ and/or the DNA of tissue, obtain DNA.
In said method, described microwave be wavelength be the radio wave of 0.12 meter.
In said method, described plant tissue and/or organ can be non-tender tissue and/or organ.Tender group of described non-children
Knit and/or the tissue of the most non-new life of organ and/or organ, such as open and flat cotyledon or open and flat true leaf.
In said method, the in vitro plant organ of described microwave drying and/or tissue are concretely by described in vitro plant device
Official and/or be organized in microwave oven processes, and obtains described dry plant organ and/or tissue.
The operating frequency of described microwave oven can be 2450 megahertzs.Described microwave oven concretely Glanz group product, type
Number it is G80F23N1P-M8.
By described in vitro plant organ and/or be organized in described microwave oven the condition concretely a1 carrying out processing), a2)
Or a3):
A1) under the conditions of high fire, microwave dries 4 minutes；A2) dry 6 minutes under the conditions of moderate heat；A3) 10 are dried under the conditions of low fire
Minute.
In said method, described 2) comprise the steps that
21) broken described dry plant organ and/or tissue, obtain plant powder；
22) in described plant powder, add cell pyrolysis liquid to react 60-70 minute in 65 DEG C, obtain containing DNA
Extracting solution, this extracting solution is referred to as extracting solution 1, removes the impurity of described extracting solution 1, obtain DNA；
Described cell pyrolysis liquid is made up of water and solute, and described solute is Tris, EDETATE SODIUM salt, cetyl trimethyl
Ammonium bromide (CTAB), polyvinylpyrrolidone (pvp), NaCl, beta-mercaptoethanol and HCl, Tris, EDETATE SODIUM
Salt, cetyl trimethylammonium bromide (CTAB), polyvinylpyrrolidone (pvp), NaCl and beta-mercaptoethanol
Concentration is respectively 0.1M, 0.02M, 2% (weight/mass percentage composition), 2% (weight/mass percentage composition), 1.5M, 1% (body
Long-pending percentage composition), regulate pH to 8.0 with HCl.
Described in vitro plant organ and/or be organized as can being directly from plant tissue and/or the organ of plant isolated.
In said method, the proportioning of described dry plant organ and/or tissue and described cell pyrolysis liquid is 50mg:
700-800 μ l, such as 50mg:700 μ l.
In said method, the impurity of the described extracting solution of described removing 1 comprises the steps that addition solution in described extracting solution 1
S obtains the extracting solution containing DNA, and this extracting solution is referred to as extracting solution 2, removes the impurity of described extracting solution 2, obtains
DNA；
Described solution S is made up of chloroform and isoamyl alcohol, and in described solution S, the volume ratio of chloroform and isoamyl alcohol is 24:1.
Described extracting solution 1 can be 1:1 with the volume ratio of described solution S.
In said method, the impurity of the described extracting solution of described removing 2 comprises the steps that and is centrifuged by described extracting solution 2,
Make DNA enter in supernatant, collect supernatant, this supernatant is referred to as supernatant 1, adds in described supernatant 1
Enter isopropanol and obtain the extracting solution containing DNA, this extracting solution is referred to as extracting solution 3, remove the miscellaneous of described extracting solution 3
Matter, obtains DNA.
Wherein, isopropanol can be 2/3:1 with the volume ratio of described supernatant 1.
In said method, the impurity of the described extracting solution of described removing 3 comprises the steps that and is centrifuged by described extracting solution 3,
Make DNA enter in precipitation, collect precipitation, this precipitation is referred to as precipitation 1, removes the impurity of described precipitation 1, obtain
DNA。
In said method, the impurity of the described precipitation of described removing 1 comprises the steps that with described in ethanol water or washing with alcohol
Precipitation 1 obtains DNA.In described ethanol water, the percent by volume of ethanol can be 70%.
In said method, described plant can be dicotyledon or monocotyledon.Described dicotyledon can be Cotton Gossypii.
The device concretely microwave oven of described transmitting microwave.The operating frequency of described microwave oven can be 2450 megahertzs.Institute
Stating microwave oven concretely Glanz Products, model is G80F23N1P-M8.
For solving above-mentioned technical problem, present invention also offers the application in molecular mark of the described method,
Or the application that described method is in the authenticity identification of variety detection or kind.
In above-mentioned application, described plant can be dicotyledon or monocotyledon.Described dicotyledon can be Cotton Gossypii.
In above-mentioned application, described plant tissue and/or organ can be non-tender tissue and/or organ.Tender group of described non-children
Knit and/or the tissue of the most non-new life of organ and/or organ, such as open and flat cotyledon or open and flat true leaf.
In the present invention, described open and flat true leaf is the blade growing open and flat and later each time period from blade.
In the present invention, described being centrifuged all can be carried out at 4 DEG C.
It is demonstrated experimentally that present invention employs microwave oven to dry plant tissue and organ, it is used for extracting DNA, drying time
Short only needing 4-10 minute, (concentration up to 220.8-342.8ng/ μ l, OD260/OD280 is the DNA of extraction
As 2.00-2.03) being applied to the DNA that SSR molecular marker effect is extracted with fresh blade, bands of a spectrum are clear.And it is micro-
DNA and microwave oven that after ripple baking oven is dry, the same day extracts are dried and are placed the DNA mass extracted in a week all preferably (concentration
It is 2.02-2.06 up to 124.7-319.7ng/ μ l, OD260/OD280), all it is applicable to SSR Molecular Identification.This
The Method of Plant DNA Extraction of invention is applicable under conditions of not possessing molecule experiments first by quick to plant tissue and organ
Drying the extraction carrying out DNA the most again, and flash baking, do not affect the extraction of DNA, strange land sampling is simple, takes
Band is convenient.The Method of Plant DNA Extraction of the present invention can be applicable to marker assisted selection, and advanced clones selects individual plant, energy
Play quickening breeding process.This method can dry the application being generalized to other plant from the blade of Cotton Gossypii, applies model
Enclose wide.
Accompanying drawing explanation
Fig. 1 is the true leaf PCR result at the DNA of the dried extraction of microwave oven moderate heat of GK102 different times.
Fig. 2 be stone resist 126 open and flat cotyledons to extract after low fire, moderate heat and high fire drying DNA at SSR primer CS62
Collection of illustrative plates after amplification.
Fig. 3 is that the DNA that extracts after low fire, moderate heat and high fire drying of the full exhibition true leaf of GK102 is at SSR primer amplification
After collection of illustrative plates.
Fig. 4 is that stone resists 126 open and flat cotyledons at the SSR of the DNA extracted in low fire, moderate heat and high fire drying later week
Primer amplification collection of illustrative plates.
Fig. 5 is the DNA cloning collection of illustrative plates that GK102 opens up that true leaf extracted in low fire, moderate heat and high fire drying later week entirely.
Fig. 6 is the SSR primer amplification collection of illustrative plates of the DNA that the fresh leaf of GK102 extracts.
Detailed description of the invention
Below in conjunction with detailed description of the invention, the present invention is further described in detail, the embodiment be given only for
Illustrate the present invention rather than in order to limit the scope of the present invention.
Experimental technique in following embodiment, if no special instructions, is conventional method.
Material used in following embodiment, reagent etc., if no special instructions, the most commercially obtain.
The Cotton Gossypii used in following embodiment is GK102 (cotton variety of country's authorization in 2015, the Shandong prosperous autumn
Zhong Ye Science and Technology Ltd.) and stone resists 126, and (check variety of National Cotton district examination, Shijiazhuang City agricultural and forest science grinds
Study carefully institute).
Microwave oven in following embodiment is Glanz Products, and model is G80F23N1P-M8, launches during work
Microwave be wavelength be the radio wave of 0.12 meter, microwave power is 800w.The low fire of this microwave oven, moderate heat and height fire
Working method be respectively high fire: 100% power output, moderate heat: 66% power output, low fire: 17% power output.
Cell pyrolysis liquid in following embodiment is made up of water and solute, and solute is Tris, EDETATE SODIUM salt, hexadecane
Base trimethylammonium bromide (CTAB), polyvinylpyrrolidone (pvp), NaCl, beta-mercaptoethanol and HCl, Tris,
EDETATE SODIUM salt, cetyl trimethylammonium bromide (CTAB), polyvinylpyrrolidone (pvp), NaCl and β-mercapto
The concentration of base ethanol be respectively 0.1M, 0.02M, 2% (weight/mass percentage composition), 2% (weight/mass percentage composition), 1.5M,
1% (volumn concentration), regulates pH to 8.0 with HCl.
Embodiment 1, dried cotton cotyledon and the extraction of true leaf DNA
1, dried cotton cotyledon and the extraction of true leaf DNA
Experiment sets repetition, and the experimental technique every time repeated is as follows:
Being dried of 1.1 cotton cotyledons and true leaf
Gather the open and flat cotyledon that stone resists 126, be randomly divided into three groups, the lowest fire cotyledon group, moderate heat cotyledon group and height
Fire cotyledon group, by low fire cotyledon group, moderate heat cotyledon group and height fire cotyledon group respectively with low fire, moderate heat and the height of microwave oven
Fire processes, and processing mode is respectively low fire and dries 10 minutes, and moderate heat dries 6 minutes, and high fire dries 4 minutes, obtains low
Fire is dried cotyledon, moderate heat is dried cotyledon and height fire is dried cotyledon (same day gathers and was dried the same day).
Gather true leaf tender leaf not deployed for GK102, the full true leaf tender leaf launched and bottle-green ripe true leaf (to be remembered
For Lao Ye), these three true leaf all uses moderate heat dry 6 minutes, obtain moderate heat be dried do not open up tender leaf, moderate heat is dried full exhibition
Tender leaf and moderate heat are dried Lao Ye.Another gather the full true leaf launched, be randomly divided into three groups, the lowest fire entirely open up true leaf group,
Moderate heat opens up true leaf group and height fire full exhibition true leaf group entirely, low fire is opened up true leaf group, moderate heat entirely and entirely opens up true leaf group and the full exhibition of height fire
True leaf group processes with the low fire of microwave oven, moderate heat and height fire respectively, and processing mode is that low fire dries 10 minutes, moderate heat
Drying 6 minutes, high fire dries 4 minutes, obtain low fire be dried entirely open up true leaf, moderate heat is dried full exhibition true leaf and height fire is dried entirely
Exhibition true leaf.
1.2 dried cotton cotyledons and true leaf carried out the extraction of DNA the same day
Each dried leaves slabstone step 1.1 obtained resists that 126 low fire are dried cotyledon, moderate heat is dried cotyledon, Gao Huo
Be dried cotyledon and GK102 moderate heat be dried do not open up tender leaf, moderate heat be dried entirely open up tender leaf, moderate heat is dried Lao Ye, low fire is dried
Entirely open up true leaf, moderate heat be dried entirely open up true leaf, high fire is dried full exhibition true leaf and extracts DNA as follows (same day gathers
It is dried and extracted the same day), every kind of blade arranges at least three to be repeated:
A1) about 50mg is dried in the centrifuge tube that blade inserts 2ml, puts into the steel ball of a diameter 5mm, use
MM301 mixed type beveller grinds, and obtains blade powder；
A2) to step a1) blade powder in add 700 μ l cell pyrolysis liquids and shake up, react in the water-bath of 65 DEG C
60 minutes, middle every 10 minutes centrifuge tubes the most reverse, obtain the extracting solution containing DNA, this extracting solution is referred to as
Extracting solution 1；
A3) to step a2) extracting solution 1 in add with the isopyknic solution S of extracting solution 1 (solution S by chloroform and
Isoamyl alcohol forms, and wherein the volume ratio of chloroform and isoamyl alcohol is 24:1), after closeing the lid, under the most reverse 30-50,
Obtain the extracting solution containing DNA, this extracting solution is referred to as extracting solution 2；By extracting solution 2 at 4 DEG C, 12000r/min
Under be centrifuged, centrifugation time is 10 minutes, makes DNA enter in supernatant, collects supernatant, claimed by this supernatant
For supernatant 1；
A4) to step a3) supernatant 1 in add and the isopyknic solution S of supernatant 1, after closeing the lid, slow
Under slow reverse 30-50, obtain the extracting solution containing DNA, this extracting solution is referred to as extracting solution 2 '；By extracting solution 2 '
4 DEG C, be centrifuged under 12000r/min, centrifugation time is 10 minutes, makes DNA enter in supernatant, in collection
Clear liquid, is referred to as supernatant 1 ' by this supernatant；
A5) to step a4) supernatant 1 ' in be incorporated as supernatant 1 ' 2/3 volume the isopropanol of pre-cooling contained
There is the extracting solution of DNA, this extracting solution is referred to as extracting solution 3；
A6) by step a5) extracting solution 34 DEG C, be centrifuged under 8000r/min, centrifugation time is 1 minute,
Make DNA enter in precipitation, collect precipitation, this precipitation is referred to as precipitation 1；With ethanol water (in ethanol water
The percent by volume of ethanol is 70%) washing precipitates 1 twice, then by washing with alcohol once, vacuum is drained, and obtains DNA.
The DNA distilled water of 100 μ l is dissolved, obtains DNA solution.
According to step a1)-a6) method, it is molten to there are that low fire is dried cotyledon DNA solution, moderate heat is dried cotyledon DNA
It is molten that liquid, the dry cotyledon DNA solution of high fire, moderate heat are dried and do not open up true leaf DNA solution, moderate heat is dried full exhibition tender leaf DNA
It is molten that liquid, moderate heat are dried Lao Ye DNA solution, low fire is dried full exhibition true leaf DNA solution, moderate heat is dried full exhibition true leaf DNA
Liquid, high fire are dried full exhibition true leaf DNA solution.
1.3 preserve dried cotton cotyledon and the extraction of true leaf DNA after a period of time
The low fire of each dry blade step 1.1 obtained is dried cotyledon, moderate heat is dried cotyledon, high fire is dried cotyledon,
Low fire is dried and entirely opens up true leaf, moderate heat is dried full exhibition true leaf and height fire is dried full exhibition true leaf and is respectively charged in the centrifuge tube of 2ml
Seal, after room temperature places a week, carry out the extraction of DNA respectively according to the method for the extraction DNA in step 1.2,
Every kind of blade arranges at least three to be repeated, obtain that low fire is dried cotyledon DNA solution ', moderate heat is dried cotyledon DNA solution ',
It is molten that high fire is dried cotyledon DNA solution ', low fire is dried full exhibition true leaf DNA solution ', moderate heat is dried full exhibition true leaf DNA
Liquid ' and height fire are dried full exhibition true leaf DNA solution '.
2, the extraction of fresh cotton leaf DNA
Use CTAB method to extract fresh cotton leaf DNA, specifically comprise the following steps that
B1) gather GK102 Young Cotton leaflet tablet (the freshest blade) 1-2 sheet (about 200mg), be directly loaded on 2ml
Centrifuge tube in, put into the steel ball of a diameter 5mm, carry out freeze grinding with MM301 mixed type beveller, obtain
Young leaflet tablet powder；
B2) to step b1) young leaflet tablet powder add 700 μ l cell pyrolysis liquids and shake up, anti-in the water-bath of 65 DEG C
Answer 40 minutes, middle every 10 minutes centrifuge tubes the most reverse, obtain leaf extract 1；
B3) to step b2) leaf extract 1 in add with the isopyknic solution S of leaf extract 1, close the lid
After son, slowly under reverse 30-50,4 DEG C, be centrifuged under 12000r/min, centrifugation time is 10 minutes, receives
Collection supernatant, by named for this supernatant leaf extract 2；
B4) to step b3) leaf extract 2 in add with the isopyknic solution S of leaf extract 2, close the lid
After son, slowly under reverse 30-50,4 DEG C, be centrifuged under 12000r/min, centrifugation time is 10 minutes, receives
Collection supernatant, by named for this supernatant leaf extract 3；
B5) to step b4) leaf extract 3 in add be pre-cooling different of leaf extract 3 about 2/3 volume
Propanol, slowly overturns centrifuge tube, until there being flocculent deposit to assemble, and static 10 minutes, with the first floccule of pipettor gun
Choose in centrifuge tube；Floccule is washed with ethanol water (in ethanol water, the percent by volume of ethanol is 70%)
Twice, then by washing with alcohol once, air-dry, obtain fresh leaf DNA.By double with 500 μ l of fresh leaf DNA
Steam water dissolution, obtain fresh blade DNA solution, be stored in-20 DEG C of refrigerators standby.
3, the qualification of the DNA obtained is extracted
3.1DNA quality testing (NANODROP2000)
Utilize each DNA solution and step 2 in ultramicrospectrophotometer NANODROP2000 detecting step 1 respectively
In the concentration of DNA and purity in fresh blade DNA solution, result meansigma methods is shown in Tables 1 and 2.
Table 1, microwave oven dry the DNA quality measurements that extracted the same day after blade and fresh leaf extracts
| DNA solution | Sequence number | Concentration (ng/ μ l) | OD260/OD280 |
| Low fire is dried cotyledon DNA solution | 1 | 286.2 | 2.03 |
| Moderate heat is dried cotyledon DNA solution | 2 | 220.8 | 2.02 |
| High fire is dried cotyledon DNA solution | 3 | 208.3 | 2.03 |
| Low fire is dried full exhibition true leaf DNA solution | 4 | 342.8 | 2.01 |
| Moderate heat is dried full exhibition true leaf DNA solution | 5 | 231.8 | 2.00 |
| High fire is dried full exhibition true leaf DNA solution | 6 | 312.3 | 2.01 |
| Fresh blade DNA solution | 7 | 324.3 | 1.91 |
The DNA quality measurements that table 2, microwave oven extract after sealing a week after drying blade
| Process | Sequence number | Concentration (ng/ μ l) | OD260/OD280 |
| Low fire is dried cotyledon DNA solution ' | 1 | 258.8 | 2.04 |
| Moderate heat is dried cotyledon DNA solution ' | 2 | 220.0 | 2.06 |
| High fire is dried cotyledon DNA solution ' | 3 | 256.1 | 2.05 |
| Low fire is dried full exhibition true leaf DNA solution ' | 4 | 236.4 | 2.04 |
| Moderate heat is dried full exhibition true leaf DNA solution ' | 5 | 319.7 | 2.02 |
| High fire is dried full exhibition true leaf DNA solution ' | 6 | 124.7 | 2.02 |
Result shows, in fresh blade DNA solution, the mean concentration of DNA is 324.3ng/ μ l, OD260/OD280
Average out to 1.91.When after microwave oven dries blade, the same day extracts DNA, low fire is dried cotyledon DNA solution, moderate heat
Be dried cotyledon DNA solution, high fire is dried cotyledon DNA solution, low fire is dried full exhibition true leaf DNA solution, moderate heat is done
Dry full exhibition true leaf DNA solution, high fire be dried the mean concentration of full exhibition true leaf DNA solution be respectively 286.2,220.8,
208.3,342.8,231.8 and 312.3ng/ μ l, OD260/OD280 averagely be respectively 2.03,2.02,2.03,
2.01,2.00 and 2.01.
Drying after runner sealing room temperature places a week at microwave oven and extract DNA, it is molten that low fire is dried cotyledon DNA
Liquid ', moderate heat are dried cotyledon DNA solution ', high fire is dried cotyledon DNA solution ', low fire is dried full exhibition true leaf DNA
Solution ', moderate heat are dried full exhibition true leaf DNA solution ', high fire is dried the full mean concentration opening up true leaf DNA solution '
Being respectively 258.8,220.0,256.1,236.4,319.7 and 124.7, OD260/OD280 meansigma methods is respectively
It is 2.04,2.06,2.05,2.04,2.02 and 2.02.Cotyledon extracts after microwave drying with full exhibition true leaf
DNA concentration and quality are not affected by dried standing time, and cotyledon can seal after the drying with full exhibition true leaf and put
Putting, its DNA can meet with carrying.
3.2DNA quality testing (SSR-PCR)
Utilize the primer in table 3 in fresh blade DNA solution in DNA solution each in detecting step 1 and step 2
DNA mass.
Table 3, primer sequence table
| Sequence number | Primer is to title | Forward primer sequence (5'to3') | Reverse primer sequences (5'to3') |
| 1 | CS62 | GATGGCTACCTCCCTTTGTA (sequence 1) | CGTAAGGAAGCCTAGCAAAA (sequence 2) |
| 2 | NAU1042 | CATGCAAATCCATGCTAGAG (sequence 3) | GGTTTCTTTGGTGGTGAAAC (sequence 4) |
| 3 | NAU1369 | TGGCAGAGATGAATGTAAGC (sequence 5) | GGTAACGGATGGAAAATCAC (sequence 6) |
| 4 | NAU2026 | GAATCTCGAAAACCCCATCT (sequence 7) | ATTTGGAAGCGAAGTACCAG (sequence 8) |
3.2.1SSR-PCR
Reaction system 10 μ l:DNA template 1 μ l, 10 × Buffer is (containing MgCl2) 1 μ l, 10mM dNTPs 0.3 μ l,
2.5U/ μ l Taq enzyme 0.2 μ l, 10 μMs of forward primer 0.5 μ l, 10 μMs of reverse primer 0.5 μ l, 6.5 μ l ddH2O。
Response procedures: 95 DEG C of denaturations 1 minute；94 DEG C of degeneration 30 seconds, anneal 45 seconds for 56 DEG C, and 72 DEG C extend 1 point
Clock, totally 30 circulations；94 DEG C of degeneration 1 minute, anneal 45 seconds for 56 DEG C, and 72 DEG C extend 2 minutes, 4 DEG C of preservations.
3.2.2 electrophoresis detection
Join glue: the composition of 8% polyacrylamide gel: dd H2O 21.2ml, 5 × TBE 8ml, PAGE mother solution 10.8
Ml, 10%AP (10% Ammonium persulfate .) 720 μ L, TEMED (tetramethylethylenediamine) 28.2 μ L, total amount 40ml.PAGE
Mother solution: acrylamide: methylene diacrylamide=29:1, every 30 grams add ultra-pure water to 100ml.
Electrophoresis: be contained on electrophoresis tank by the glass plate assembled, pours in glass plate by the glue prepared, and treats that glue is the most solidifying
1XTBE electrophoresis liquid is added in electrophoresis tank, each hole point sample 1.8 μ L, 180v voltage 1h after Gu.
Fixing: to fix 10 minutes with fixative.Infiltration: permeate 12 minutes with penetrating fluid.Distilled water is quickly washed twice.
Colour developing: develop the color 5 minutes with nitrite ion.Distillation washing twice.Terminate: pour stop buffer into, terminate reaction.Photograph is also
Record result.Fixative: 95% ethanol 40ml+100% acetic acid 2ml+358mldH2O, altogether 400ml.Penetrating fluid: 0.6
Gram AgNO3+300mlH2O.Nitrite ion: 6 grams of NaOH+5ml formaldehyde+2.5ml0.2%Na2S2O3(finally adding)+400mldH2O
(400ml altogether).Stop buffer: 3 grams of Na2CO3+400mldH2O。
Result is as shown in figs 1 to 6.
Fig. 1 is the PCR result of the true leaf dried DNA of microwave oven moderate heat of GK102 different times.Wherein, swimming
Road 1-3 is that moderate heat is dried and does not opens up true leaf DNA solution, and swimming lane 4-6 is that moderate heat is dried full exhibition tender leaf DNA solution, swimming lane
7-8 is that moderate heat is dried Lao Ye DNA solution.Result shows, does not flattens what tender leaf obtained after drying through the moderate heat of microwave oven
DNA mass is the most bad, all can not amplify purpose band；And it is dried through the moderate heat of microwave oven with Lao Ye entirely to open up tender leaf
The DNA mass obtained is all preferable, utilize collection of illustrative plates that NAU2026, CS62, NAU1042 and NAU1369 amplification obtains with
The result of cotton variety fingerprint databases is consistent.Showing, the most open and the most flat true leaf tender leaf should not extract after drying with microwave oven
DNA, and after full exhibition, true leaf and Lao Ye can be dried through microwave oven, and the DNA mass extracted is good.
Fig. 2 is that the DNA that stone resists 126 cotyledons to extract after low fire, moderate heat and high fire drying expands at SSR primer CS62
After collection of illustrative plates.Wherein, swimming lane 1-3 is low fire and is dried cotyledon DNA solution, and swimming lane 4-6 is moderate heat and is dried cotyledon
DNA solution, swimming lane 7-9 is high fire and is dried cotyledon DNA solution.The bands of a spectrum of Fig. 2 are consistent, reproducible, and with
The result of cotton variety fingerprint databases is consistent.Showing, cotton cotyledon can be dried through microwave oven, and the DNA extracted
Quality is good.
Fig. 3 is that the DNA that extracts after low fire, moderate heat and high fire drying of the full exhibition true leaf of GK102 is at SSR primer amplification
After collection of illustrative plates.Wherein, swimming lane 1-4 is low fire and is dried full exhibition true leaf DNA solution, and swimming lane 5-8 is moderate heat and is dried
Full exhibition true leaf DNA solution, swimming lane 9-12 is high fire and is dried full exhibition true leaf DNA solution, and M is DNA molecular amount standard.
Result shows, the bands of a spectrum of identical primer are consistent, reproducible, and with the master tape result of cotton variety fingerprint databases
Unanimously.Showing, Cotton Gossypii is entirely opened up true leaf and can be dried through low, medium and high fire in microwave oven, and the DNA mass extracted
The most fine.
Fig. 4 is that stone resists 126 cotyledons at the SSR primer of the DNA extracted in low fire, moderate heat and high fire drying later week
AFLP system.Wherein, swimming lane M is DNA molecular amount standard, and swimming lane 1-3 is low fire and is dried cotyledon DNA solution ',
Swimming lane 4-6 is moderate heat and is dried cotyledon DNA solution ', and swimming lane 7-9 is high fire and is dried cotyledon DNA solution '.Knot
Fruit display, the bands of a spectrum of identical primer are consistent, reproducible and consistent with the result of cotton variety fingerprint databases.
Showing, cotton cotyledon is all fine in the quality of the DNA extracted after microwave drying, is not affected by standing time, suitable
Close and long-distance carry and post, can accomplish with carrying.
Fig. 5 is the DNA cloning collection of illustrative plates that GK102 opens up that true leaf extracted in low fire, moderate heat and high fire drying later week entirely.
Wherein, swimming lane 1-4 is low fire and is dried full exhibition true leaf DNA solution ', and swimming lane 5-8 is moderate heat and is dried and entirely opens up true leaf
DNA solution ', swimming lane 9-12 is high fire and is dried full exhibition true leaf DNA solution '.Result shows, identical primer
Bands of a spectrum are consistent, reproducible and consistent with the result of cotton variety fingerprint databases.Showing, Cotton Gossypii is entirely opened up true leaf and exists
The quality of the DNA extracted after microwave drying is all fine, is not affected by standing time, is suitable for long-distance carrying and posting,
Can accomplish with carrying.
Fig. 6 is the SSR primer amplification collection of illustrative plates of the DNA that the fresh leaf of GK102 extracts.
Claims (10)
1. Method of Plant DNA Extraction, including following 1) and 2):
1) with the in vitro plant organ of microwave drying and/or tissue, plant organ and/or the tissue being dried is obtained；
2) extract described dry plant organ and/or the DNA of tissue, obtain DNA.
Method the most according to claim 1, it is characterised in that: described microwave be wavelength be 0.12 meter wireless
Electric wave；And/or, described plant tissue and/or organ are non-tender tissue and/or organ.
Method the most according to claim 1 and 2, it is characterised in that: described 2) including:
21) broken described dry plant organ and/or tissue, obtain plant powder；
22) in described plant powder, add cell pyrolysis liquid to react 60-70 minute in 65 DEG C, obtain containing DNA
Extracting solution, this extracting solution is referred to as extracting solution 1, removes the impurity of described extracting solution 1, obtain DNA；
Described cell pyrolysis liquid is made up of water and solute, and described solute is Tris, EDETATE SODIUM salt, cetyl trimethyl
Ammonium bromide, polyvinylpyrrolidone, NaCl, beta-mercaptoethanol and HCl, Tris, EDETATE SODIUM salt, cetyl
The concentration of trimethylammonium bromide, polyvinylpyrrolidone, NaCl and beta-mercaptoethanol be respectively 0.1M, 0.02M,
2% (weight/mass percentage composition), 2% (weight/mass percentage composition), 1.5M, 1% (volumn concentration), regulate with HCl
PH to 8.0.
Method the most according to claim 3, it is characterised in that: described dry plant organ and/or tissue with
The proportioning of described cell pyrolysis liquid is 50mg:700-800 μ l.
5. according to described method arbitrary in claim 1-4, it is characterised in that: the described extracting solution of described removing 1
Impurity include: in described extracting solution 1 add solution S obtain the extracting solution containing DNA, by this extracting solution be referred to as
Extracting solution 2, removes the impurity of described extracting solution 2, obtains DNA；
Described solution S is made up of chloroform and isoamyl alcohol, and in described solution S, the volume ratio of chloroform and isoamyl alcohol is 24:1.
Method the most according to claim 5, it is characterised in that: the impurity of the described extracting solution of described removing 2 includes:
Described extracting solution 2 is centrifuged, makes DNA enter in supernatant, collect supernatant, this supernatant is referred to as supernatant
Liquid 1, adds isopropanol in described supernatant 1 and obtains the extracting solution containing DNA, this extracting solution is referred to as extracting solution 3,
Remove the impurity of described extracting solution 3, obtain DNA.
Method the most according to claim 6, it is characterised in that: the impurity of the described extracting solution of described removing 3 includes:
Described extracting solution 3 is centrifuged, makes DNA enter in precipitation, collect precipitation, this precipitation is referred to as precipitation 1, removes
Remove the impurity of described precipitation 1, obtain DNA.
Method the most according to claim 7, it is characterised in that: the impurity of the described precipitation of described removing 1 includes:
DNA is obtained with precipitating 1 described in ethanol water or washing with alcohol.
9. according to described method arbitrary in claim 1-8, it is characterised in that: described plant be dicotyledon or
Monocotyledon.
10. microwave drying application in extracting DNA of plants, or arbitrary described DNA extraction side in claim 1-9
Method application in molecular mark, or in claim 1-9 arbitrary described DNA extraction method at variety pure
Application in the authenticity identification of degree detection or kind.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610321613.4A CN105779441B (en) | 2016-05-16 | 2016-05-16 | The method for extracting DNA using micro-wave oven flash baking plant leaf blade |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610321613.4A CN105779441B (en) | 2016-05-16 | 2016-05-16 | The method for extracting DNA using micro-wave oven flash baking plant leaf blade |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105779441A true CN105779441A (en) | 2016-07-20 |
| CN105779441B CN105779441B (en) | 2019-04-23 |
Family
ID=56378873
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610321613.4A Active CN105779441B (en) | 2016-05-16 | 2016-05-16 | The method for extracting DNA using micro-wave oven flash baking plant leaf blade |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105779441B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107365764A (en) * | 2017-07-04 | 2017-11-21 | 华智水稻生物技术有限公司 | A kind of method of high-flux rice leaf DNA extraction |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101434997A (en) * | 2008-12-23 | 2009-05-20 | 华中农业大学 | Early stage rapid molecular detection method for rape sclerotinia rot |
| CN101696450A (en) * | 2009-09-29 | 2010-04-21 | 中国农业科学院棉花研究所 | Method for distinguishing conventional cotton and hybrid cotton in assistant mode and special kit thereof |
| CN101787364A (en) * | 2009-11-16 | 2010-07-28 | 浙江大学 | Method for extracting DNA from old formalin-fixed tissues |
-
2016
- 2016-05-16 CN CN201610321613.4A patent/CN105779441B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101434997A (en) * | 2008-12-23 | 2009-05-20 | 华中农业大学 | Early stage rapid molecular detection method for rape sclerotinia rot |
| CN101696450A (en) * | 2009-09-29 | 2010-04-21 | 中国农业科学院棉花研究所 | Method for distinguishing conventional cotton and hybrid cotton in assistant mode and special kit thereof |
| CN101787364A (en) * | 2009-11-16 | 2010-07-28 | 浙江大学 | Method for extracting DNA from old formalin-fixed tissues |
Non-Patent Citations (3)
| Title |
|---|
| K.WANG，C.HIRUKI: "The molecular stability of genomic DNA of phytoplasma in the witches"-broom-affected paulownia tissues after microwave heat treatment", 《JOURNAL OF MICROBIOLOGICAL METHODS》 * |
| 付小琼 等: "棉花总DNA快速提取技术及其在国家棉花区试中的应用", 《中国棉花学会2011年年会论文汇编》 * |
| 程中平 等: "桃嫩叶及DNA处理方法用于RAPD分析的探讨", 《湖北林业科技》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107365764A (en) * | 2017-07-04 | 2017-11-21 | 华智水稻生物技术有限公司 | A kind of method of high-flux rice leaf DNA extraction |
| CN107365764B (en) * | 2017-07-04 | 2020-08-25 | 华智水稻生物技术有限公司 | Method for extracting DNA (deoxyribonucleic acid) of high-flux rice leaves |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105779441B (en) | 2019-04-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105636937B (en) | Stabilizer for preserving biological sample | |
| CN106916848A (en) | A kind of method that gene transient expression is realized in Peach fruits | |
| CN110195055A (en) | Polysaccharide polyphenol plant tissue method for extracting total RNA | |
| CN105063185A (en) | Closely-linked marker of spike length major QTL (quantitative trait loci) and application of closely-linked marker | |
| CN102725406A (en) | Improvements to nucleic acid elution | |
| CN105779441A (en) | Method for extracting DNA (deoxyribonucleic acid) by rapidly drying plant leaves with oven | |
| CN103993070B (en) | A kind of SSR primer for exquisite joint melon hybrid seed purity qualification and method | |
| CN104694530A (en) | Extraction method of wheat genome DNA | |
| Zutta et al. | Low-and high-temperature tolerance and acclimation for chlorenchyma versus meristem of the cultivated cacti Nopalea cochenillifera, Opuntia robusta, and Selenicereus megalanthus | |
| CN110616218A (en) | Blood RNA preservation solution and preparation method thereof, blood RNA preservation tube and preservation and extraction method | |
| CN108165663B (en) | Method for identifying sex of date palm tree | |
| CN102477423B (en) | Method for extracting DNA from shrimp shell of procambarus clarkii | |
| CN102888396B (en) | Method for separating low-molecular weight ribonucleic acid (RNA) of plant | |
| CN103966198B (en) | A kind of rapid extracting method of DNA of plants | |
| CN106337047B (en) | A kind of alcohol extraction procedure with high salt of cowpea blade DNA | |
| CN108060208A (en) | A kind of discrimination method of snake bile | |
| CN109456967B (en) | Specific nucleotide, labeled primer and identification method of physalis macrocarpa | |
| Ahmad et al. | Standardization of DNA extraction from invasive alien weed Parthenium hysterophorus | |
| CN114774406B (en) | Method for extracting total RNA from rosa plant tissues | |
| CN111321138A (en) | Method for extracting DNA from dry plant leaves at low cost and application | |
| CN110229926A (en) | Sweet potato chloroplaset SSR primer and its application in sweet potato runoff catchment paternity test | |
| CN109402166A (en) | China fir Gene Silencing system and its construction method | |
| CN113583967B (en) | Method for preserving strawberry mottle virus sample | |
| CN105248414A (en) | Fresh blade preserving fluid for extracting grass family genomic DNA and preserving method and application thereof | |
| Patoare et al. | Effect of calcium carbide on rat tissue |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |