CN107365763A

CN107365763A - A kind of rice paddy seed DNA rapid extracting methods

Info

Publication number: CN107365763A
Application number: CN201710538088.6A
Authority: CN
Inventors: 李宇飞; 郑秀婷; 许娜
Original assignee: Huazhi Rice Bio-Tech Co Ltd
Current assignee: Huazhi Rice Bio-Tech Co Ltd
Priority date: 2017-07-04
Filing date: 2017-07-04
Publication date: 2017-11-21
Anticipated expiration: 2037-07-04
Also published as: CN107365763B

Abstract

The present invention relates to a kind of rice paddy seed DNA rapid extracting methods, including rice is shelled into seed with adding appropriate buffer B after appropriate buffer A warm bath, centrifuged after abundant shaken well, appropriate supernatant is taken to be placed in certain time in 20 DEG C of refrigerators after adding the appropriate abundant shaken well of isopropanol, centrifuge again and abandon supernatant, by drying precipitate, appropriate ultra-pure water dissolving is added；Produce DNA sample.This method can be from rice paddy seed efficiently, quick, easy extraction template DNA, meet KASP requirements；This method need not use the organic solvents such as chloroform and not need grinding seed.

Description

A kind of rice paddy seed DNA rapid extracting methods

Technical field

The present invention relates to a kind of rice paddy seed DNA rapid extracting methods.

Background technology

Using National Standard Method extract rice paddy seed DNA can meet KASP (i.e. competitive ApoE gene, Kompetitive Allele Specific PCR) Genotyping requirement, the systems of LGC 384 and 1538 and Array tape On can obtain preferable result.But time-consuming for this method, and flux is low, seed grinding difficulty is big, and uses a large amount of chloroforms Etc. poisonous organic solution, seed authenticity inspection is only applicable to, for extensive high flux single seed DNA extraction such as purity Identification, pure lines material mark parting etc. to be then not suitable for very much on a small quantity.Therefore the rapid extraction without using poisonous organic reagent is developed Single-seed rice seed DNA method is very important.

Chinese patent application CN201010157407 discloses a kind of method of rapid extraction paddy DNA, and this method is most Traditional centrifuge tube single tube DNA extraction method, flux is low, organic reagent uses more, experimental procedure complexity.Chinese patent application CN201210564828 discloses a kind of method for extracting paddy DNA, and this method belongs to the flux suitable for blade and seed DNA extraction method, experiment use organic reagent, really by conventional centrifugal pipe CTAB method migrations to 96 orifice plates and use the volley of rifle fire Operated.The method that Chinese patent application CN201410115253 discloses fast high-flux extraction plant genome DNA, This method belongs to the high flux DNA extraction method suitable for organs such as blade, stem, roots, by CTAB, SDS and NaOH these three Extracting method is described, and wherein CTAB, SDS method and " CN201210564828 " is essentially identical, has simply used shifting Liquid work station.Can other this method do not have explanation be applied to seed yet.

By State of Zhao it is precious " it is a kind of efficiently easily paddy DNA extraction method and its application (《Rice in China science》,2012, 26(4):495-499) " and the graceful articles of Zheng Xiu " Non-destructive high-throughput DNA extraction And genotyping methods for cotton seeds and seedlings ", it is understood that HOTSHOT methods are extracted Paddy DNA seed, can meet under certain condition KASP require (96 systems are feasible, and 384 and 1536 systems are unknown).But The grinding of rice paddy seed high flux is difficult many compared with blade, therefore it is desirable that obtaining on the premise of grinding seed is not needed, energy Extraction meets the seed DNA of KASP requirements method.

In view of this, it is special to propose the present invention.

The content of the invention

Present invention aims at a kind of rice paddy seed DNA rapid extracting methods are provided, this method can be high from rice paddy seed Effect, quick, easy extraction template DNA, meet KASP requirements；This method need not use the organic solvents such as chloroform and be not required to Want grinding seed；It can also realize that high flux extracts.

Technical solution of the present invention is as follows, a kind of rice paddy seed DNA rapid extracting methods, comprises the following steps：

1) the rice seed that shells is put into appropriate containers, adds appropriate buffer A, baking oven is put into after lid lid or sealer, 16-48 hours or more are placed in 35~42 DEG C；

2) and then again it is placed in baking oven in 94~98 DEG C of warm bath 30~45 minutes；

3) appropriate buffer B, abundant shaken well are added into the container；

4) centrifugation (general 3600~5300rpm centrifuges 10~20min)；

5) appropriate supernatant is taken into new container after centrifuging；

6) appropriate isopropanol is added, certain time in -20 DEG C of refrigerators is placed in after abundant shaken well；

7) centrifugation (general 3600~5300rpm centrifuges 10~20min)；

8) supernatant is abandoned, by drying precipitate, adds appropriate ultra-pure water dissolving；Produce DNA sample.

In the above method, usually can by the use of 96 hole depth orifice plates (such as NUNC96 hole depths orifice plate) or ELISA Plate as container, Lid silica gel lid or aluminium foil paper membrane can be sealed up.

Preferably, every 1 Rice seeds add 300~400uL buffer A in step 1).

Preferably, every 1 Rice seeds add 300~400uL buffer B in step 3).

Preferably, the addition of institute's isopropanol and the volume ratio of supernatant are 150-250ul in step 6):150-250ul； More preferably 150ul:150ul.

Preferably, in step 1) the placement temperature of container in an oven be 35~42 DEG C, standing time be 16-48 hours or More than.

Preferably, the placement temperature of container in an oven is 94~98 DEG C in step 2), and standing time is 30~45 minutes； More preferably it is put into warm bath 35 minutes in 94 DEG C of baking ovens.

Specifically, above-mentioned a kind of rice paddy seed DNA rapid extracting methods, comprise the following steps：

1) 1 Rice seeds is put into every hole of deep-well plates (porous) or ELISA Plate and adds 300uL buffer A, 16-48 hour of 37 DEG C of baking ovens or more is put into after lid lid or sealer；

2) deep-well plates or ELISA Plate are put into warm bath 35 minutes in 94 DEG C of baking ovens；

3) deep-well plates or ELISA Plate are taken out, buffer B 300ul are added into every hole, composition shaken well is (such as in whirlpool Fully mixed on oscillator)；

4) deep-well plates or ELISA Plate are placed in a centrifuge, 4000rpm centrifugations 10min；

5) 150ul supernatants are taken to new deep-well plates or ELISA Plate；

6) isopropanol 150ul and lid or sealer are added into every hole, composition shaken well is (such as in vortex oscillator fully Mix) after be placed in -20 DEG C of refrigerators 1 hour；

7) deep-well plates or ELISA Plate are placed in a centrifuge, 4000rpm centrifugation 10min (preferably under the conditions of 4 DEG C)；

8) supernatant is abandoned, by drying precipitate, the dissolving of 300 μ L ultra-pure waters is added into every hole；Produce DNA sample.

Further to improve the quality of gained DNA sample, the present invention is improved above method, mainly step 2) Warm bath in baking oven is revised as carrying out warm bath in water-bath, and research finds to carry out warm bath, uniform in effect and very using water-bath Good, seed has obvious deformation after warm bath, and the seed DNA mass of subsequent extracted is good, goes for Array tape System, and possess the potentiality of automation.

A kind of rice paddy seed DNA rapid extracting methods, comprise the following steps：

2) deep-well plates or ELISA Plate are put into warm bath 40 minutes in 94 DEG C of water-baths；

5) after centrifugation terminates, (using Tecan) takes 150ul supernatants to new hole depth orifice plate or ELISA Plate；

6) add isopropanol 150ul into every hole and lid or sealer, composition shaken well (such as fill in vortex oscillator Point mix) after be placed in -20 DEG C of refrigerators 1 hour；

The inventive method be particularly suitable for use in Nipponbare, 9311, river is fragrant No. 8, deep two excellent 5814, II is excellent 416, II excellent bright 88 etc. The seed of rice varieties.

Present invention additionally comprises application of the above method on KASP Genotypings.

Compared with existing paddy DNA extracting method, the invention has the advantages that：Organic examinations such as chloroform need not be used Agent, rice need not pulverize and can extract DNA, and the DNA of extraction can be in the case where KASP marks 0.8ul reaction system very Good amplification.

Brief description of the drawings

Fig. 1-1 represents experiment 1. experimental result；

Fig. 2-1 represents experiment 2. experimental result；

Fig. 3-1 and Fig. 3-2 represents experiment 3. experimental result；

Fig. 4-1 and Fig. 4-2 represents experiment 4. experimental result；

Fig. 5-1 and Fig. 5-2 represents experiment 5. experimental result；

Fig. 6-1 and Fig. 6-2 represents experiment 6. experimental result；

Fig. 7-1 and Fig. 7-2 represents experiment 7. experimental result；

Fig. 8-1 represents experiment 8. experimental result；

Fig. 9-1 to Fig. 9-5 represents experiment 9. experimental result；

Figure 10 is that DNA extracts flow chart.

Embodiment

Following examples are used to illustrate the present invention, but are not limited to the scope of the present invention.It is unreceipted specific in embodiment Technology or condition person, according to the technology or condition described by document in the art, such as Sambrook equimolecular cloning experimentation hands Volume (Sambrook J＆Russell DW, Molecular Cloning:A Laboratory Manual, 2001), or press Carried out according to product description.Agents useful for same or the unreceipted production firm person of instrument, it is that can be commercially available by regular distributor Conventional products.

Experimentation

Based on testing HOTSHOT methods below, tested by the condition for changing different.DNA extractions flow is shown in Figure 10.

Test below and use work station.Following laboratory sample is rice paddy seed.Extract recipe used in testing below is such as Under：

Buffer A (now with the current)

Reagent	Volume	Final concentration
			5M NaOH	100uL	0.1M
TWEEN 20	100uL	2%
			H₂O	4.8mL

Buffer B(pH 2.0)

Reagent	Volume	Final concentration
			1M Tris-HCl(pH 8.0)	500uL	0.1M
0.5M EDTA(pH 8.0)	20uL	2mM
			H₂O	4.48mL
Concentrated hydrochloric acid (adjusts pH)	About 28uL

1. whether experiment is soaked using 2% amylase solution

First, experimental procedure is as follows：

A:Soda boiling method is soaked without using amylase solution

1. taking 1 seed that shells, 1.0ml NUNC96 hole depth orifice plates are put into, add 200uL buffer A, covering to go out Bacterium silica gel lid, it is put into 24 hours of 37 DEG C of baking ovens；

2. deep-well plates are put into warm bath 12 minutes in 94 DEG C of baking ovens；

3. taking out deep-well plates, pellosil is torn, adds buffer B 200ul, is fully mixed in vortex oscillator；

4. 4000rpm centrifuges 10min；

5. 200ul supernatants are taken to new 1.0ml NUNC96 hole depth orifice plates；

6. adding isopropanol 200ul, it is placed in after being mixed in vortex oscillator in -20 DEG C of refrigerators 1 hour；

7. deep-well plates are taken out, 4000rpm centrifugations 10min；

8. supernatant is abandoned, dry DNA, and add the dissolving of 300 μ L ultra-pure waters；Obtain DNA sample.

B：Soda boiling method is soaked with amylase solution

1. taking 1 seed that shells, 1.0ml NUNC96 hole depth orifice plates are put into, the amylase solutions of 100ul 2% is added, covers Can be sterilized silica gel lid, be put into 20 hours of 37 DEG C of baking ovens；

2. adding 100ul 2*buffer A, deep-well plates are put into warm bath 12 minutes in 94 DEG C of baking ovens；

3-8 steps are consistent with A methods.

2nd, material and primer

Table 1-1

Row 1

1

2

3

4

5

6

7

8

9

10

11

12

A

Nipponbare

9311

River is fragrant No. 8

Deep two excellent 5814

II excellent 416

II excellent bright 88

NTC

B

Nipponbare

9311

River is fragrant No. 8

Deep two excellent 5814

II excellent 416

II excellent bright 88

NTC

C

Nipponbare

9311

River is fragrant No. 8

Deep two excellent 5814

II excellent 416

II excellent bright 88

D

Nipponbare

9311

River is fragrant No. 8

Deep two excellent 5814

II excellent 416

II excellent bright 88

E

Nipponbare

9311

River is fragrant No. 8

Deep two excellent 5814

II excellent 416

II excellent bright 88

F

Nipponbare

9311

River is fragrant No. 8

Deep two excellent 5814

II excellent 416

II excellent bright 88

G

Nipponbare

9311

River is fragrant No. 8

Deep two excellent 5814

II excellent 416

II excellent bright 88

H

Nipponbare

9311

River is fragrant No. 8

Deep two excellent 5814

II excellent 416

II excellent bright 88

By the use of the DNA of 1ul extractions as template, tested in the systems of LGC 384, detect 4 primers：Primer K_ 010104、 K_010108、K_010111、K_010115.Experiment material include Nipponbare, 9311, river it is fragrant No. 8, deep two excellent 5814th, II is excellent 416, excellent bright 88 (being seed) of II.Layout of the seed in 96 orifice plates is as shown in table 1-1.

3rd, result

As a result as Figure 1-1,

1) seed largely has begun to deform after 94 DEG C of warm bath, but also has small part profile variation and unobvious.

2) in the case of without using amylase, 36 circulation when, have obvious sub-clustering, genotype corresponding to sample is therewith Preceding result is identical but result is more scattered and has several sample results bad.During 39 circulations, the obvious results contrast of sub-clustering gathers Hold together, but still have in the bad i.e. result figure of several sample results shown in powder point, recall rate is 90% or so.Use the feelings of amylase Under condition, 36 circulations are as a result very poor without sub-clustering phenomenon.39 circulation results slightly improve but do not reach parting requirement still.

Thus result is adversely affected it is considered that can be extracted using amylase solution immersion to seed DNA, subsequently This method is eliminated in experiment.As a result have that result of the individual samples in all marks is bad in, estimation be due to DNA amount too Caused by few.It is helpful whether follow-up test adds the cleaning of the ethanol of a step 75% to be extracted to seed DNA.

2. whether experiment is cleaned using 75% ethanol

First, experimental procedure is as follows：

Method is consistent without using amylase solution immersion alkaline-heating method with 1. experiment, only increases by a step between 7,8 steps：Abandon Supernatant, the ethanol of 400ul 70%, 4000rpm centrifugations 10min are added per hole.

2nd, material and primer

With " material and the primer " in 1. testing

3rd, result

As a result as shown in Fig. 2-1,

1) seed largely has begun to deform after 94 DEG C of warm bath, but also has the not too much big change of small part profile

2) in the case where being cleaned without using ethanol, 36 circulation when, have obvious sub-clustering, genotype corresponding to sample with Result before is identical but result is more scattered and has several sample results bad.During 39 circulations, the obvious results contrast of sub-clustering Gather, but still there are several sample results bad.

3) in the case of being cleaned using 75% ethanol, 36 circulations have mass data point not have signal without sub-clustering phenomenon.39 Individual circulation result is still bad, parting unobvious

Add that the method parting effect of the alcohol washes of a step 75% is poor, caused by the amount of probable dna is too low, can wash in a pan Eliminate.Subsequent experimental can omit the step.In seed extraction process, there are white depositions inevitable when extracting supernatant Take out of, and eventually enter into DNA solution.Follow-up test accordingly increases supernatant volume by increasing the extraction of extract solution, Whether can effectively reduce sediment and improve follow-up PCR efficiency.

3. experiment suitably increases Buffer A and Buffer B volume

First, experimental procedure is as follows：

Method is consistent without using amylase solution immersion alkaline-heating method with 1. experiment, simply by Buffer A and Buffer B Volume increase to 300ul, while the volume for extracting supernatant is increased into 300ul or keeps 200ul constant.

2nd, material and primer

With " material and the primer " in 1. testing

3rd, result

As a result such as Fig. 3-1 (seed deformation pictorial diagram after 94 DEG C of warm bath), after warm bath, there are 7 samples in 48 samples Almost without modal change, all there is obvious gelatinization phenomenon in the overwhelming majority in other samples.

As a result as shown in figure 3-2,

1) it is all poor that either 36 or 39 circulations of result of 200ul supernatants are extracted, can be with indivedual primers Parting.

2) result of 300ul supernatants is preferable, and on the basis of 39 circulations, most of sample can complete parting, The bad sample of genotyping result is all just metamorphosis unobvious after warm bath, the sample of no gelatinization phenomenon.

Extracting enough supernatants, just to can guarantee that the accuracy of result illustrates that DNA amount can cause to genotyping result huge Influence, therefore turn into the key of Success in Experiment, but the impurity that can not be introduced into excessive seed obtaining enough DNA.

Not being gelatinized deformation after some sample warm bath causes, and DNA amount may be caused few, therefore the sufficiently long warm bath time is Can guarantee that seed DNA amount can meet KASP requirements.In subsequent experimental, ladder is made with 37 DEG C of warm bath times and 94 DEG C of warm bath times Degree experiment, ensure the concentration and quality of DNA extractions.

4. experiment suitably increases Buffer A soak times and warm bath time

First, experimental procedure is as follows：

1. taking 1 seed that shells, 1.0ml NUNC96 hole depth orifice plates are put into, add 300uL buffer A, covering to go out Bacterium silicon lid, it is put into 48 hours of 37 DEG C of baking ovens；

2. deep-well plates are put into warm bath 15 minutes in 94 DEG C of baking ovens；Or warm bath 20 or 25 minutes

3. taking out deep-well plates, pellosil is torn, adds buffer B 300ul, is fully mixed in vortex oscillator；

4. 4000rpm centrifuges 10min；

5. 300ul supernatants are taken to new 1.0ml NUNC96 hole depth orifice plates；

6. adding isopropanol 300ul per hole, it is placed in after fully being mixed in vortex oscillator in -20 DEG C of refrigerators 1 hour；

7. deep-well plates are taken out, 4000rpm centrifugations 10min；

8. supernatant is abandoned, dry DNA, and add the dissolving of 300uL ultra-pure waters；

2nd, material and primer

With " material and the primer " in 1. testing

3rd, result

As a result as shown in Fig. 4-1,

94 DEG C of warm bath are after 15 minutes, have 4 samples almost without modal change in 48 samples, in other samples absolutely It is most of obvious gelatinization phenomenon all occur.

94 DEG C of warm bath are after 20 minutes, have 3 samples almost without modal change in 48 samples, in other samples absolutely It is most of obvious gelatinization phenomenon all occur.

94 DEG C of warm bath are after 25 minutes, have 1 sample almost without modal change in 48 samples, in other samples absolutely It is most of obvious gelatinization phenomenon all occur.

As a result as shown in the Fig. 4-2,

In the case of warm bath 15 minutes, 36 circulate and have the trend of parting, but have that a large amount of sample parting effects are bad, and point Cluster is not concentrated.Parting is preferable during 39 circulations, but still has pole individual samples result bad.

In the case of warm bath 20 minutes, 36 circulate and have the trend of parting, but have that a few sample parting effect is bad, and point Cluster is not concentrated.Parting is preferable during 39 circulations, but still has pole individual samples result bad.

In the case of warm bath 25 minutes, 36 circulate and have the trend of parting, but have that a few sample parting effect is bad, and point Cluster is not concentrated.Parting is good during 39 circulations, and nearly all sample uniform is preferable.

In the case where 2 days soak, warm bath 15, the result of 20,25 minutes are better than immersion 1 day.Therefore subsequently survey again The result of 2 days is soaked in examination, it may be determined that final soak time.

With the increase of warm bath time, as a result also become more preferable.And in the case of warm bath 25 minutes, although final paste Change situation aggravates, and draws the sediment increase suctioned out during supernatant, but final PCR genotyping results are had no effect on from result. And when warm bath 25 minutes, although also pole individual samples do not have the phenomenon being gelatinized in form, cans are circulated at 36 Preferable genotyping result is obtained, can so be reduced due to the false positive data that period increases and rises.

It subsequently can suitably increase warm bath time progress gradient experiment again, obtain the most suitable warm bath time.

5. suitably increase warm bath time, guarantee sample are gelatinized for experiment

First, experimental procedure is as follows：

Methods experiment is 4. consistent, simply increases to 94 DEG C of warm bath times 25,30,35 minutes.

2nd, material and primer

With " material and the primer " in 1. testing

3rd, result

As a result as shown in fig. 5-1,

94 DEG C of warm bath have 1 sample almost all to go out without modal change, other samples after 25 minutes in 48 samples Obvious gelatinization phenomenon is showed.

94 DEG C of warm bath have 1 sample almost all to go out without modal change, other samples after 30 minutes in 48 samples Obvious gelatinization phenomenon is showed.

94 DEG C of warm bath are after 35 minutes, and obvious gelatinization phenomenon all occur in all samples in 48 samples.

As a result as shown in Fig. 5-2,

1) for warm bath in the case of 25,30 minutes, 36 circulation partings are preferable, but still have pole individual samples bad.39 are followed Ring result is preferable, but NTC begins with the phenomenon of sideslip.

2) warm bath is in the case of 35 minutes, and 36 circulation partings are good, and all data points are preferable.39 circulation results compared with It is good, but NTC begins with the phenomenon of sideslip.

3) warm bath 25, in the case of 30,35 minutes, draw 300ul supernatants it is highly difficult, typically in 250ul or so.With The increase of warm bath time, the sediment in Aspirate supernatant can also increase therewith.

In the case where 2 days soak, warm bath 25, the result of 30,35 minutes are significantly better than warm bath 15, the knot of 20,25 minutes Fruit.Even in the case where 36 circulate, also only only have the data of 1 sample undesirable.When this should be due to warm bath Between increase cause more DNA to be precipitated, although the increase of warm bath time causes in DNA impurity content increase, this not shadow The result of final Genotyping is rung, final more DNA result in more preferable genotypic results.

The increase of warm bath time, cause the increase of seed gelatinization degree, this improves the difficulty of Aspirate supernatant, it is also difficult to logical Cross the extraction that work station carries out DNA.Therefore subsequent experimental does a gradient experiment for supernatant volume aspirated, is ensureing experiment knot More suitable supernatant volume is tested on the basis of fruit and the operation of suitable services station.

Test the volume gradient experiment of 6. Aspirate supernatant

First, experimental procedure is as follows：

1. taking 1 seed that shells, 1.0ml NUNC96 hole depth orifice plates are put into, 300uL buffer A is added, covers aluminium foil Paper, it is put into 48 hours of 37 DEG C of baking ovens；

2. deep-well plates are put into warm bath 35 minutes in 94 DEG C of baking ovens

3. taking out deep-well plates, aluminium-foil paper is torn, adds buffer B 300ul, is mixed 20 seconds in vortex oscillator；

4. 4000rpm centrifuges 10min；

5. 250ul or 150ul supernatants are taken to new 1.0ml NUNC96 hole depth orifice plates；

6. adding isopropanol 250ul or 150ul, it is placed in after being mixed in vortex oscillator in -20 DEG C of refrigerators 1 hour；

7. deep-well plates are taken out, 4000rpm centrifugations 10min；

8. supernatant is abandoned, dry DNA, and add the dissolving of 300 μ L ultra-pure waters；

2nd, material and primer see the table below 6-1

Table 6-1

Row 1

1

2

3

4

5

6

7

8

9

10

11

12

A

Nipponbare

9311

River is fragrant No. 8

Deep two excellent 5814

II excellent 416

II excellent bright 88

B

Nipponbare

9311

River is fragrant No. 8

Deep two excellent 5814

II excellent 416

II excellent bright 88

C

Nipponbare

9311

River is fragrant No. 8

Deep two excellent 5814

II excellent 416

II excellent bright 88

D

Nipponbare

9311

River is fragrant No. 8

Deep two excellent 5814

II excellent 416

II excellent bright 88

E

Nipponbare

9311

River is fragrant No. 8

Deep two excellent 5814

II excellent 416

II excellent bright 88

NTC

F

Nipponbare

9311

River is fragrant No. 8

Deep two excellent 5814

II excellent 416

II excellent bright 88

NTC

G

Nipponbare

9311

River is fragrant No. 8

Deep two excellent 5814

II excellent 416

II excellent bright 88

NTC

H

Nipponbare

9311

River is fragrant No. 8

Deep two excellent 5814

II excellent 416

II excellent bright 88

NTC

7-12 row A-D and E-H are the seed of same kind, altogether 11 kinds.

Primer is K_010104 and K_010108.

3rd, result

Aluminium-foil paper shrouding this time is used, causes deep-well plates upper deformation to be melted after warm bath, silica gel can not be used by ultimately resulting in Lid shrouding, therefore add and can not fully mix after Buffer B.

As a result as in Figure 6-1, for warm bath after 35 minutes, all samples are all gelatinized deformation.

As a result as in fig. 6-2,

1) DNA for extracting 150ul supernatants just has a good parting in 36 circulations, result on the contrary poor one during 39 circulations A bit.

2) DNA for extracting 250ul supernatants has that 2% data point is bad when circulating for 36, and result is preferable during 39 circulations.

3) either extract 150ul or 250ul supernatants, 36 circulation when result it is preferable, more period meetings Cause bigger false positive possible, therefore with reference to the experience of blade Genotyping, 36 circulations are our first choices.

KASP requirements can also be met by extracting the DNA that 150ul supernatants are extracted, and compared to 250ul supernatants, be drawn Supernatant it is fairly simple, manually operated very easy can draws 150ul supernatants and will not suck the impurity of bulky grain, this Be advantageous to the operation of Automation workstation.

Deep-well plates can be deformed using aluminium-foil paper shrouding, silica gel lid shrouding can only be used from now on.

The experiment is subsequently repeated again, and DNA is tested for 1536 orifice plates.

Test the volume gradient experiment and 1536 experiments of 7. Aspirate supernatant

First, experimental procedure is as follows：

With experiment 6.

2nd, material and primer

With experiment 6.

3rd, result

As a result as shown in Fig. 7-1,

1) DNA for extracting 150ul supernatants just has a good parting in 36 circulations, and result is good during 39 circulations but NTC unrest Run.

2) DNA for extracting 250ul supernatants has that K_010115 primer results are bad when circulating for 36, other preferably, 39 Result is preferably during circulation but NTC runs chaotically seriously.

1536 systems：As a result as shown in Fig. 7-2,

1) extract the result that combines of 150ul and 250ul supernatants and both show that result is without obvious in 1536 systems Difference, when circulating for 36, preferable genotyping result is only obtained in the primer of part, bad parting is mainly due to heterozygosis Son is not run away also completely,

2) when circulating for 39, in addition to K_010115, other results are all fine.Although K_010115 data point parting knots Fruit is correct, but result is more scattered and NTC runs chaotically that phenomenon is very serious.

KASP requirements can also be met by extracting the DNA that 150ul supernatants are extracted, and this is advantageous to the behaviour of Automation workstation Make.

The seed DNA of VELOCITY EXTRACTION method extraction can meet the systems of KASP 1536, except K_010115 (all realities of the primer Test middle NTC to run chaotically seriously, and sub-clustering is not concentrated), other all primer results are very good.

384 systems just can obtain preferable result in 36 circulations, but 1536 systems have to 39 circulations and just can guarantee that As a result reliability, this is similar with blade genotypic results.

8. Array tape are tested for experiment

First, material and primer

Directly tested using the DNA in experiment 7. on Array tape

2nd, result

As a result as shown in Fig. 8-1, preferable result can be obtained on Array tape by extracting the DNA of 150ul supernatants, Except K_010054 primers heterozygote with homozygote is more difficult separates, all samples obtain correct genotyping result, and sub-clustering compared with To concentrate.

3rd, analysis and conclusion

384 system Genotyping recall rate such as following table 8-1 of above-mentioned all experiments are (due to K_010115 primers quality itself not It is good, so being free of its result in following data)：All results are counted with the data of 36 circulations

Table 8-1

1536 system Genotyping recall rate such as following table 8-2 are (due to K_010115 primer quality itself for above-mentioned all experiments It is bad, so being free of its result in following data)：All results are counted with the data of 39 circulations

Table 8-2

By above-mentioned experiment, we determined that the DNA that rice paddy seed immersion alkaline-heating method is extracted is can meet KASP 384 systems and 1536 systems, and appropriate extracting method is selected, we can ensure the premise of minimum false positive as far as possible Under, seed cdna parting recall rate in 384 (36 circulations) and 1536 (39 circulations) systems is reached more than 99%.Together When the extracting method be suitable for the semi-automatic extraction of manual extraction and work station.The extracting method finally determined is as follows：

1. taking 1 Rice seeds, 1.0ml NUNC96 hole depth orifice plates are put into, 300uL buffer A is added, covers Silica gel lid, deep-well plates are put into 48 hours of 37 DEG C of baking ovens；

2. deep-well plates are put into warm bath 35 minutes in 94 DEG C of baking ovens；

3. taking out deep-well plates, aluminum silica gel lid is torn, adds buffer B 300ul, is fully mixed in vortex oscillator；

4. deep-well plates are placed in a centrifuge, 4000rpm centrifugations 10min；

5. tearing silica gel lid, 150ul supernatants are taken to new 1.0ml NUNC96 hole depth orifice plates；

6. add isopropanol 150ul and cover silica gel lid, it is small that 1 is placed in -20 DEG C of refrigerators after fully being mixed in vortex oscillator When；

7. taking out deep-well plates, deep-well plates are placed in a centrifuge, 4000rpm centrifugations 10min；

8. supernatant is abandoned, dry DNA, and add the dissolving of 300 μ L ultra-pure waters；Produce DNA sample.

Experiment is 9.

In research more than, a kind of method that can be used for the extraction of single-seed rice seed high flux, this method are explored It there is also an issue, be exactly that warm bath in baking oven is ineffective, warm bath effect is uneven, causes sample segment DNA extraction effects Fruit is bad.

Therefore, further study show that warm bath is carried out using water-bath, uniform in effect and very good, seed is after warm bath There is obvious deformation, the seed DNA mass of subsequent extracted is good, goes for Array tape systems, and possesses automatic The potentiality of change.Concrete outcome is as follows.

Rice paddy seed DNA rapid extracting methods, comprise the following steps：

1. taking 1 Rice seeds, 1.0ml NUNC96 hole depth orifice plates are put into, add 300uL buffer A, Aluminium foil paper membrane is sealed up on KUBE, deep-well plates are put into 37 DEG C of baking ovens, 16 hours or more；

2. deep-well plates are put into warm bath 40 minutes in 94 DEG C of water-baths；

3. taking out deep-well plates, aluminium foil paper cap is torn, adds buffer B 300ul, is fully mixed in vortex oscillator；

After 5. centrifugation terminates, 150ul supernatants are taken to new 1.0ml NUNC96 hole depth orifice plates using Tecan；

7. taking out deep-well plates, deep-well plates are placed in a centrifuge, 4 DEG C of 4000rpm centrifuge 10min；

Experimental result

Purity experiment NO.004 on November 3 (primer K_110223), as a result as shown in fig. 9-1, parent has polymorphism, its Remaining sample is the sample for needing to carry out Purity.Genotyping result sub-clustering is obvious, and in result set, can easily divide very much Genotype, NTC also are located at origin.

November 10, purity tested NO.002 (primer K_050073) result as shown in Fig. 9-2, and parent has polymorphism, its Remaining sample is the sample for needing to carry out Purity.Genotyping result sub-clustering is obvious, and in result set, can easily divide very much Genotype, NTC also are located at origin.

Purity experiment NO.002 on November 10 (primer K_070067), as a result as shown in Fig. 9-3, parent has polymorphism, Remaining sample is the sample for needing to carry out Purity.Genotyping result sub-clustering is obvious, and in result set, can easily draw very much Divide genotype, NTC also is located at origin.

Purity experiment NO.004 on November 10 (primer K_100016), as a result as shown in Fig. 9-4, parent has polymorphism, Remaining sample is the sample for needing to carry out Purity.Genotyping result sub-clustering is more obvious, and in result set, there is indivedual heterozygosis For sample between homozygous and heterozygosis, NTC is located at origin.Because the combination only has in 12 marks of screening polymorphic marker There is polymorphism in this 1 mark, therefore this mark can only be selected to carry out Purity.

Purity experiment NO.005 on November 17 (primer K_050073), as a result as shown in Fig. 9-5, parent has polymorphism, Remaining sample is the sample for needing to carry out Purity.Genotyping result sub-clustering is obvious, and in result set, can easily draw very much Divide genotype, NTC also is located at origin.

Analysis：

1) Purity project in November is passed through, it is determined that single-seed rice seed DNA extracting method, and this method can be high The extraction of effect meets Array tape DNA, and this method can effectively utilize the work station in laboratory, greatly improve The efficiency of Purity.This method substantially increases conventional efficient and reduced to instrument without seed is ground simultaneously Dependency degree.

2) because rice paddy seed is endosperm type seed, DNA is mainly triploid, and this proposes challenge to KASPar partings. Therefore we when carrying out Purity, polymorphism primer needs are more careful between selecting parent.Drawing used in Purity Thing, its heterozygous must be located between two kinds of homozygosis and easily distinguishable.

The primer of the present invention is as follows：

K_010104

Forward primer 1：GAAGGTGACCAAGTTCATGCTATCTTTGAATTTAAAGAATTACTCACCGATA

Forward primer 2：GAAGGTCGGAGTCAACGGATTCTTTGAATTTAAAGAATTACTCACCGATC

Reverse primer：CCATAATGTGGATAAGGATTTTCTGAAGTT

K_010108

Forward primer 1：GAAGGTGACCAAGTTCATGCTCGTTGCATCGTGGAGCACGAAAT

Forward primer 2：GAAGGTCGGAGTCAACGGATTGTTGCATCGTGGAGCACGAAAC

Reverse primer：GATCACCGCTCTCGTAGCGCTT

K_010111

Forward primer 1：GAAGGTGACCAAGTTCATGCTCCAAGATCAAGAACCAAGTATTGCAG

Forward primer 2：GAAGGTCGGAGTCAACGGATTACCAAGATCAAGAACCAAGTATTGCAA

Reverse primer：TGCAAGAGCGTCGGGCACGAT

K_010115

Forward primer 1：GAAGGTGACCAAGTTCATGCTCGGTACCTTGAGAGAGCGCAA

Forward primer 2：GAAGGTCGGAGTCAACGGATTCGGTACCTTGAGAGAGCGCAG

Reverse primer：GCACGGCAGAGATGTACCGCAT

K_050073

Forward primer 1：GAAGGTGACCAAGTTCATGCTGGAAAACAAAACAGACGAGACGAGA

Forward primer 2：GAAGGTCGGAGTCAACGGATTGGAAAACAAAACAGACGAGACGAGT

Reverse primer：CCACCTAGGAGTAGTAGTTTGGGTT

K_070067

Forward primer 1：GAAGGTGACCAAGTTCATGCTGACTGCGTTGAATTGAACCGGGA

Forward primer 2：GAAGGTCGGAGTCAACGGATTGACTGCGTTGAATTGAACCGGGT

Reverse primer：ATGAAACAGCGACGGCCATTACCTT

K_100016

Forward primer 1：GAAGGTGACCAAGTTCATGCTGGAAACTCTGATCCGGAACGT

Forward primer 2：GAAGGTCGGAGTCAACGGATTGGAAACTCTGATCCGGAACGC

Reverse primer：GTAGATGGTTTGCGCGGAGTATACAT

K_110223

Forward primer 1：GAAGGTGACCAAGTTCATGCTGTGCCATATGGTGGCATGAGACA

Forward primer 2：GAAGGTCGGAGTCAACGGATTGCCATATGGTGGCATGAGACC

Reverse primer：ATTGGTGGTTCAACAAGTGACATCCATTA

Although above the present invention is described in detail with a general description of the specific embodiments, On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause This, these modifications or improvements, belong to claimed model without departing from theon the basis of the spirit of the present invention Enclose.

SEQUENCE LISTING

<110>Hua Zhi rice biologicals Technology Co., Ltd.

<120>A kind of rice paddy seed DNA rapid extracting methods

<130> KHP171110670.4

<160> 24

<170> PatentIn version 3.3

<210> 1

<211> 52

<212> DNA

<213>Artificial sequence

<400> 1

gaaggtgacc aagttcatgc tatctttgaa tttaaagaat tactcaccga ta 52

<210> 2

<211> 50

<212> DNA

<213>Artificial sequence

<400> 2

gaaggtcgga gtcaacggat tctttgaatt taaagaatta ctcaccgatc 50

<210> 3

<211> 30

<212> DNA

<213>Artificial sequence

<400> 3

ccataatgtg gataaggatt ttctgaagtt 30

<210> 4

<211> 44

<212> DNA

<213>Artificial sequence

<400> 4

gaaggtgacc aagttcatgc tcgttgcatc gtggagcacg aaat 44

<210> 5

<211> 43

<212> DNA

<213>Artificial sequence

<400> 5

gaaggtcgga gtcaacggat tgttgcatcg tggagcacga aac 43

<210> 6

<211> 22

<212> DNA

<213>Artificial sequence

<400> 6

gatcaccgct ctcgtagcgc tt 22

<210> 7

<211> 47

<212> DNA

<213>Artificial sequence

<400> 7

gaaggtgacc aagttcatgc tccaagatca agaaccaagt attgcag 47

<210> 8

<211> 48

<212> DNA

<213>Artificial sequence

<400> 8

gaaggtcgga gtcaacggat taccaagatc aagaaccaag tattgcaa 48

<210> 9

<211> 21

<212> DNA

<213>Artificial sequence

<400> 9

tgcaagagcg tcgggcacga t 21

<210> 10

<211> 42

<212> DNA

<213>Artificial sequence

<400> 10

gaaggtgacc aagttcatgc tcggtacctt gagagagcgc aa 42

<210> 11

<211> 42

<212> DNA

<213>Artificial sequence

<400> 11

gaaggtcgga gtcaacggat tcggtacctt gagagagcgc ag 42

<210> 12

<211> 22

<212> DNA

<213>Artificial sequence

<400> 12

gcacggcaga gatgtaccgc at 22

<210> 13

<211> 46

<212> DNA

<213>Artificial sequence

<400> 13

gaaggtgacc aagttcatgc tggaaaacaa aacagacgag acgaga 46

<210> 14

<211> 46

<212> DNA

<213>Artificial sequence

<400> 14

gaaggtcgga gtcaacggat tggaaaacaa aacagacgag acgagt 46

<210> 15

<211> 25

<212> DNA

<213>Artificial sequence

<400> 15

ccacctagga gtagtagttt gggtt 25

<210> 16

<211> 44

<212> DNA

<213>Artificial sequence

<400> 16

gaaggtgacc aagttcatgc tgactgcgtt gaattgaacc ggga 44

<210> 17

<211> 44

<212> DNA

<213>Artificial sequence

<400> 17

gaaggtcgga gtcaacggat tgactgcgtt gaattgaacc gggt 44

<210> 18

<211> 25

<212> DNA

<213>Artificial sequence

<400> 18

atgaaacagc gacggccatt acctt 25

<210> 19

<211> 42

<212> DNA

<213>Artificial sequence

<400> 19

gaaggtgacc aagttcatgc tggaaactct gatccggaac gt 42

<210> 20

<211> 42

<212> DNA

<213>Artificial sequence

<400> 20

gaaggtcgga gtcaacggat tggaaactct gatccggaac gc 42

<210> 21

<211> 26

<212> DNA

<213>Artificial sequence

<400> 21

gtagatggtt tgcgcggagt atacat 26

<210> 22

<211> 44

<212> DNA

<213>Artificial sequence

<400> 22

gaaggtgacc aagttcatgc tgtgccatat ggtggcatga gaca 44

<210> 23

<211> 42

<212> DNA

<213>Artificial sequence

<400> 23

gaaggtcgga gtcaacggat tgccatatgg tggcatgaga cc 42

<210> 24

<211> 29

<212> DNA

<213>Artificial sequence

<400> 24

attggtggtt caacaagtga catccatta 29

Claims

1. a kind of rice paddy seed DNA rapid extracting methods, it is characterised in that comprise the following steps：

1) the rice seed that shells is put into appropriate containers, adds appropriate buffer A, baking oven is put into after lid lid or sealer, in 35 ~42 DEG C are placed 16-48 hours or more；

3) appropriate buffer B, abundant shaken well are added into the container；

4) centrifuge；

5) appropriate supernatant is taken into new container after centrifuging；

7) centrifuge；

2. according to the method for claim 1, it is characterised in that in step 1) every 1 Rice seeds add 300~ 400uLbuffer A；

And/or every 1 Rice seeds add 300~400uL buffer B in step 3).

3. method according to claim 1 or 2, it is characterised in that the placement temperature of container in an oven is in step 1) 35~42 DEG C, standing time is 16-48 hours or more；

And/or the placement temperature of container in an oven is 94~98 DEG C in step 2), standing time is 30~45 minutes；It is preferred that To be put into warm bath 35 minutes in 94 DEG C of baking ovens.

4. according to the method described in claim any one of 1-3, it is characterised in that in step 6) addition of institute's isopropanol with it is upper The volume ratio of clear liquid is 150-250ul:150-250ul；Preferably 150ul:150ul.

5. according to the method for claim 1, it is characterised in that comprise the following steps：

1) 1 Rice seeds is put into every hole of deep-well plates or ELISA Plate and adds 300uL buffer A, lid lid or 16-48 hour of 37 DEG C of baking ovens or more is put into after sealer；

3) deep-well plates or ELISA Plate are taken out, buffer B 300ul, composition shaken well are added into every hole；

5) 150ul supernatants are taken to new deep-well plates or ELISA Plate；

6) isopropanol 150ul and lid or sealer are added into every hole, is placed in after composition shaken well in -20 DEG C of refrigerators 1 hour；

7) deep-well plates or ELISA Plate are placed in a centrifuge, 4000rpm centrifugations 10min；

6. according to the method for claim 1, it is characterised in that comprise the following steps：

5) after centrifugation terminates, 150ul supernatants are taken to new hole depth orifice plate or ELISA Plate；

6) add into every hole plus isopropanol 150ul and cover or sealer, it is small that 1 is placed in -20 DEG C of refrigerators after composition shaken well When；

7. according to the method described in claim any one of 1-6, it is characterised in that the Buffer A formulas are as follows：

The pH of the Buffer B is 2.0, and formula is as follows：

8. according to the method described in claim any one of 1-7, it is characterised in that the rice paddy seed includes rice varieties Japan It is fine, 9311, river is fragrant No. 8, deep two excellent 5814, II is excellent 416, II excellent bright 88.

9. application of the method described in claim any one of 1-8 on KASP Genotypings.