CN107362372A - Use application of the CRISPR technologies in coronary atherosclerotic heart disease - Google Patents

Use application of the CRISPR technologies in coronary atherosclerotic heart disease Download PDF

Info

Publication number
CN107362372A
CN107362372A CN201710802371.5A CN201710802371A CN107362372A CN 107362372 A CN107362372 A CN 107362372A CN 201710802371 A CN201710802371 A CN 201710802371A CN 107362372 A CN107362372 A CN 107362372A
Authority
CN
China
Prior art keywords
heart disease
crispr
cas9
mir
coronary atherosclerotic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710802371.5A
Other languages
Chinese (zh)
Other versions
CN107362372B (en
Inventor
侯冬雪
万埝
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Aidi Gene Technology Co ltd
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to CN201710802371.5A priority Critical patent/CN107362372B/en
Publication of CN107362372A publication Critical patent/CN107362372A/en
Application granted granted Critical
Publication of CN107362372B publication Critical patent/CN107362372B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0066—Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention provides a kind of method that the genes of microRNA 8086 are specifically knocked out using CRISPR Cas9, and methods described is：（1) Cas9 expression vectors are built；(2 structure sgRNA expression vectors;(3) Cas9, sgRNA are mixed into mixed liquor, inject mammal embryonated egg, realize the purpose of 8086 gene site-directed knockouts of microRNA.

Description

Use application of the CRISPR technologies in coronary atherosclerotic heart disease
Technical field
The present invention relates to application of the CRISPR technologies in coronary atherosclerotic heart disease, belong to medicine bioengineering skill Art field.
Background technology
Coronary atherosclerotic heart disease is that coronary artery occurs atherosclerotic lesion and causes blood vessel Chamber stenosis or occlusion, heart disease caused by myocardial ischemia, anoxic or necrosis is caused, be commonly referred to as " coronary heart disease ".But it is preced with The scope of worry may more extensively, in addition to inflammation, embolism etc. cause luminal stenosis or occlusion.The World Health Organization is by coronary heart disease It is divided into 5 major classes：Silent ischemia (latent coronary heart disease), angina pectoris, myocardial infarction, ischemic heart failure (ischemic Heart disease) and 5 kinds of Clinical types of sudden death.Usually it is divided into SCHD and acute coronary syndrome in clinic.
Typical chest pain is mainly reflected in clinical manifestation.Because physical exertion, excited etc. induce, sense pareordia pain of dashing forward Bitterly, mostly ictal angina or squeezing pain, or sense of feeling oppressed.Pain is radiated to a left side upwards since after breastbone or pareordia Shoulder, arm, or even little finger of toe and the third finger, rest or buccal nitroglycerin can be alleviated.The position that pectoralgia is diffused can also refer to neck, under Jaw, tooth, belly etc..Pectoralgia may also appear under rest state or night, and caused by coronary spasm, also referred to as the anomaly heart twists Bitterly.As pectoralgia property changes, the progressive pectoralgia that such as occurs recently, the threshold of pain progressively declines so that pause physical exertion or Excited or even rest can also break out when sleeping soundly.Pain is gradually aggravated, frequency conversion, duration extension, is dispelled inducement or is contained Taking nitroglycerin can not alleviate, and now often suspect unstable angina.
At present, treatment coronary atherosclerotic heart disease mainly uses antianginal drug, such as nitrate esters, kidney Upper parathyrine beta receptor blocking agent, calcium channel blocker etc..One kind is disclosed in CN105816722A and treats coronary atherosclerosis Property cardiopathic Chinese medicine preparation, its bulk drug include Ligusticum wallichii, peach kernel, safflower, the radix paeoniae rubrathe, Radix Angelicae Sinensis, ground bettle, aspongopus, radix cyathulae, Red yeast rice, raw hawthorn, male black soya bean, pangolin, corydalis tuber, prepared RHIZOMA CYPERI with vinegar, ginkgo leaf, dalbergia wood, fushen, polygala, smoked jujube, rhizoma nardostachyos, amber, Cairo morningglory root or leaf, radix bupleuri, the root of kudzu vine, balloonflower root, cuttlefish fish ink sac.The Chinese medicine preparation is directed to etiology and pathogenesis prescription medicine, has diagnosis and treatment Advantage, overcome traditional Western medicine and cannot be distinguished by card type and carry out verification treatment, can be to a certain extent by for oral administration of Chinese medicine The use of Western medicine is substituted, reduces drug dependence and side effect etc..Treatment coronary heart disease and the heart are disclosed in the B of CN 101332246 The Chinese medicine preparation of angina, mainly include red sage root 18-22, pseudo-ginseng 4-6, radix paeoniae rubrathe 17-23, dalbergia wood 13-18, corydalis tuber 13-18, safflower 7- 11st, fleece-flower root 18-22, reticulate millettia 25-35, myrrh 18-22, ginseng 13-17, Chinese cassia tree 13-17, barrenwort 18-22, pilose antler 4-6, Ganoderma lucidum 11-15, cordyceps sinensis 7-9, Ligusticum wallichii 12-18, peach kernel 8-12, frankincense 13-17, scorpio 4-6, centipede 4-6, root bark of tree peony 12-17 Etc. component, according to from the point of view of experimental result with certain effect.
In the prior art, disclosed in the B of CN 103877576 with Card3 knock out mice and heartspecific Card3 transgenic mices are object, by blocking mouse heart ramus descendens anterior arteriae coronariae sinistrae to cause myocardial infarction model to be ground Study carefully, the results showed that contrasted with WT mouse, the degree of Card3 knock out mice cardiac infarctions ratio, myocardial hypertrophy and fibrosis Obvious to be suppressed, heart function is clearly better；With GDF1 knock out mice and heartspecific GDF1 in the B of CN 103893743 Transgenic mice is experimental subjects, by blocking mouse heart ramus descendens anterior arteriae coronariae sinistrae to cause myocardial infarction model to be ground Study carefully, the results showed that contrasted with MEM-Cre control mices, GDF1 knock out mice cardiac infarctions ratio, myocardial hypertrophy and fiber The degree of change substantially increases, and heart function substantially deteriorates；And cardiac infarction ratio, the cardiac muscle of heartspecific GDF1 transgenic mices Plump and fibrosis degree is substantially suppressed, and heart function is obviously improved.Disclosed in the B of CN 103898189 with SHPS-1 bases Because knock-out mice and heartspecific SHPS-1 transgenic mices are experimental subjects, before blocking mouse heart arteria coroaria sinistra Descending branch (LAD) causes myocardial infarction model, the results showed that is contrasted with WT control mices, SHPS-1 knock out mice is postoperative in MI The degree of cardiac infarction ratio, myocardial hypertrophy and fibrosis is substantially suppressed, and heart function is clearly better；In the B of CN 103893763 Disclose using Vinexin- β knock out mice and heartspecific Vinexin- β transgenic mices as experimental subjects, pass through resistance Disconnected mouse heart ramus descendens anterior arteriae coronariae sinistrae (LAD) causes myocardial infarction model, the results showed that contrasted with WT control mices, Vinexin- β knock out mice is substantially suppressed in the degree of MI postoperative cardiac infarct ratio, myocardial hypertrophy and fibrosis, the heart Function is clearly better.By result above it can be found that coronary atherosclerotic heart can be realized by gene interference The treatment of disease.
At present, rule repeats system (clustered regularly interspaced short into the short palindrome in race interval palindromic repeat；CRISPR-associated, CRISPR_Cas9) it is a kind of answering with endonuclease activity Zoarium, identifies specific DNA sequence dna, carry out specific site cutting cause double-strand DNA cleavage (Double-strand breaks, DSB), under conditions of no template, the non-homogeneous restructuring end connection of generation (Non-homologous end joining, NHEJ), frameshift mutation (frameshift mutation) is caused, causes gene knockout.This technology due to can it is quick, easy, Efficiently any gene of target gene group, so as to cause extensive concern, started to bud out into popularity as blast in 2012. Due to its easily operation, multiple genes can be targetted simultaneously, can be prepared with high flux, cost is low etc., and advantage, Cas9 have become A kind of technology with fastest developing speed.Just because of its superiority, this technology is ranked in the 20130 big progress that Nature recommends First.
Cas9 targeting cutting DNAs are by two kinds of tiny RNAs -- crRNA (CRISPR RNA) and tracrRNA (trans- Activating crRNA) and the complementary principle realization identified of target sequence.Two kinds of tiny RNAs one has been fused into now RNA chains, abbreviation sgRNA (single guide RNA).Therefore, can sgRNA accomplish that specificity, accurate targeting target gene are CRISPR-Cas9 can specific knockdown target gene prerequisite, either miss the target or mistake targeting, can all influence Specific knockdowns of the CRISPR-Cas9 to target gene.Therefore, it is possible to design, prepare accuracy and selectively targeted target The sgRNA of gene turns into the key technology of CRISPR-Cas9 gene knockouts.Compared with ZFN and siRNA, CRISPR-Cas9 has More rapidly, easy, efficient, more sites, the selectively targeted advantage for knocking out gene.
The content of the invention
According in a first aspect, the purpose of the present invention is to be directed to deficiency of the prior art, there is provided hprt minigene acid miR- 8086 purposes knocked out using CRISPR/Cas9 systems.This be first using CRISPR/Cas9 systemic characteristics general The miR-8086 of micrRNA families is knocked out.The purpose of miR knockouts can be efficiently realized using this new method.
Still further aspect of the present invention, obtain miR-8086 and Card3's and SHPS-1 by screening according to applicant's early stage Positive Expression modulation relation, there is provided suppress the expression of Card3 and SHPS-1 genes after miR-8086 knockout, so as to treat hat Shape atherosclerotic heart disease.
The present invention additionally provides a kind of sgRNA, its sequence is according to miR-8086 precursor sequences, and by early stage, more than 40 set The only one found in the sgRNA target spots of meter by preliminary test has the sgRNA for preferably knocking out effect, and its sequence is such as gcacagccttggtgtctctagtcc(SEQ ID NO：Shown in 1).
The present invention provides a kind of method that microRNA genes are specifically knocked out using CRISPR-Cas9, and methods described is： (1) Cas9 expression vectors are built；(2 structure sgRNA expression vectors；(3) Cas9, sgRNA- are mixed into mixed liquor, inject lactation Class fertilised non-human eggs, realize the purpose of the gene site-directed knockouts of microRNA.
Compared with prior art, the beneficial effects are mainly as follows：
1) genetic modification efficiency is higher, reduces the unreliability of conventional art；2) operating technology is simple, without by multiple The series of steps such as miscellaneous targeting vector structure, ES cell screenings, allophenic mice seed selection；3) can be real by a simple step Existing complicated cardiopathic treatment, has great market application foreground.
Brief description of the drawings
Fig. 1 lentiCRISPR v2 carrier figures.
Fig. 2 (1), (2), (3) are respectively the mrna expression amount pair before and after miR-8086, Card3 and SHPS-1 gene knockout Than figure.
Embodiment
With reference to specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in This：
Material therefor, reagent etc. in following embodiments, unless otherwise instructed, are commercially obtained.
The design of primers of embodiment 1
1st, the outer Cas9 expression vectors of construct, are named as pGEM-Cas9, are responsible for synthesizing by winning profit biology, its sequence is this The conventional sequence in field.
2nd, the vector construction of in-vitro transcription sgRNA skeetal codings sequence and preparation.
SgRNA is designed for mmu-miR-8086 genes, positive oligonucleotide sequence and reverse oligonucleotide sequence can be with It is complementarily shaped to the double chain DNA fragment with cohesive end：
F：CACCGgcacagccttggtgtctctagtcc
R:CggactagagacaccaaggctgtgcCAAA。
Embodiment 2, the sgRNA expression vectors for building mmu-miR-8086 genes
1. synthetic DNA Insert Fragment
(1) the forward and reverse oligonucleotide sequence of above-mentioned design is synthesized
Oligonucleotide sequence can specifically be synthesized by commercialized company (Shanghai Sheng Gong companies) according to the sequence of offer.
By the annealing of corresponding forward and reverse oligonucleotide sequence, renaturation, the double-stranded DNA piece with cohesive end is formed Section.
Reaction system (20 μ L) is as follows：
Positive oligonucleotides (10 μM)：1μL
Reverse oligonucleotide (10 μM)：1μL
10×PCR buffer：2μL
ddH2O：16μL
Above-mentioned reaction system is put into PCR instrument, and reacted by following procedure.
Response procedures：
95℃,5min；
80℃,5min；
70℃,5min；
59℃,5min；
50℃,5min；
Naturally it is down to room temperature.
2. build sgRNA expression vectors
(1) BsmB I digestion with restriction enzyme destination carrier lentiCRISPR v2 plasmids (excellent precious biology, goods are utilized Number：VT8107).
Prepared according to following reaction system：
LentiCRISPR v2 plasmids：1μg
10 × digestion buffer：2μL
BsmB I restriction enzymes：2μL
Supplement ddH2O to the μ L of cumulative volume 20
Endonuclease reaction system is placed in 37 DEG C of reaction 3h.
(2) electrophoretic separation and cmy vector fragment
After digestion terminates, digestion mixture is separated by agarose gel electrophoresis, selects carrier segments (about 12kb) cut, and reclaimed by DNA gel recovery column.
(3) double chain DNA fragment of synthesis and carrier main leaf section are attached and convert Escherichia coli
The carrier segments that the double chain DNA fragment that renaturation is obtained obtains with recovery are attached reaction, according to following reaction System is prepared：
LentiCRISPR v2 carrier segments：100ng
Double chain DNA fragment：200ng
T4 ligases：1μL
T4 coupled reactions buffer：1μL
Supplement ddH2O to the μ L of cumulative volume 10
Connection mixture is placed in 25 DEG C of reaction 2h.
Reaction will connection mixture conversion e.colistraindh5α after terminating：It is big that 100 μ L are added into connection mixture Enterobacteria DH5 α competent cells, are incubated 30min on ice；Mixture is put into 42 DEG C of water-baths, is put into after heat shock 90s cold on ice But；100 μ L LB culture mediums, 37 DEG C of shaking table culture 20min are added to mixture；Mixture is applied into Amp LB flat boards, 37 DEG C of cultures 14h。
(4) correct transformed clone is identified
Some bacterium colonies are selected from Amp LB flat boards and are enlarged culture, extraction plasmid carries out digestion identification.Select possibility Correctly clone is sequenced, and by sequencing, it is found that insetion sequence is correct.Carried for correct lentiCRISPR v2-sgRNA Body clone carries out conservation, and extracts corresponding plasmid.
It is prepared by embodiment 3, transgenic mice
1) it is as follows to inject mouse system by CRISPR/Cas9：
pGEM-Cas9 50ng/μl
lentiCRISPR v2-sgRNA 10ng/μl
Mixed population accumulates 20μl
2) inject
Using Eppendorf2xTransferManNK2 microinjection instruments draw 2 μ l steps 1) mixed liquors inject 60 by Smart ovum.Then become pregnant.
After mouse is born 5 days, clip mouse nail extracts genomic DNA.PCR identify miR-8086 and Card3 and SHPS-1 gene expression doses, it is only used as compareing not carry out the mouse 30 of gene knockout.As shown in Fig. 2 compared with the control, it is small MiR-8086 and Card3 and SHPS-1 gene expression doses in mouse body are reduced to relative to control, expression 0.2%th, 11.7%, 12.5%.This absolutely proves that the miR-8086 in Mice Body is completely knocked out, and gene expression is Through almost completely losing.Corresponding, Card3 and SHPS-1 gene expression doses also significantly decrease.
60 mouse are dissected, the mouse after miR-8086 knockouts, heart significantly diminishes, and average external volume is small not knock out The 65.2% of mouse.This is absolutely proved, can be used for doing physical therapy the coronary atherosclerotic heart with the knockout by miR-8086 Popular name for.
Although the embodiment of the present invention has obtained detailed description, it will be understood to those of skill in the art that.Root According to disclosed all teachings, those details can be carried out with various modifications and replacement, these change in the guarantor of the present invention Within the scope of shield.The four corner of the present invention is provided by appended claims and its any equivalent.
Sequence table
<110>Hou Dongxue
<120>Use application of the CRISPR technologies in coronary atherosclerotic heart disease
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 24
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 1
gcacagcctt ggtgtctcta gtcc 24
<210> 2
<211> 29
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 2
caccggcaca gccttggtgt ctctagtcc 29
<210> 3
<211> 29
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 3
cggactagag acaccaaggc tgtgccaaa 29

Claims (4)

  1. Applications of the 1.miR-8086 in the reagent for lowering Card3 and SHPS-1 gene expressions is prepared；Wherein described reagent can Treat coronary atherosclerotic heart disease.
  2. 2.miR-8086 knockout reagent is preparing the purposes for the medicine for being used to treat coronary atherosclerotic heart disease.
  3. 3. purposes as claimed in claim 2, CRISPR/CAS technologies are used wherein knocking out, wherein the sgRNA sequences such as SEQ used ID NO：Shown in 1.
  4. A kind of 4. method for treating coronary atherosclerotic heart disease, it is characterised in that：Struck using CRISPR/CAS technologies Except miR-8086.
CN201710802371.5A 2017-09-07 2017-09-07 Use application of the CRISPR technology in coronary atherosclerotic heart disease Active CN107362372B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710802371.5A CN107362372B (en) 2017-09-07 2017-09-07 Use application of the CRISPR technology in coronary atherosclerotic heart disease

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710802371.5A CN107362372B (en) 2017-09-07 2017-09-07 Use application of the CRISPR technology in coronary atherosclerotic heart disease

Publications (2)

Publication Number Publication Date
CN107362372A true CN107362372A (en) 2017-11-21
CN107362372B CN107362372B (en) 2019-01-11

Family

ID=60312568

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710802371.5A Active CN107362372B (en) 2017-09-07 2017-09-07 Use application of the CRISPR technology in coronary atherosclerotic heart disease

Country Status (1)

Country Link
CN (1) CN107362372B (en)

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103877576A (en) * 2014-04-10 2014-06-25 武汉大学 Function and application of Caspase activation and recruitment domain 3 (Card3) gene in coronary atherosclerotic heart disease
WO2014100252A1 (en) * 2012-12-18 2014-06-26 University Of Washington Through Its Center For Commercialization Methods and compositions to modulate rna processing
CN103898189A (en) * 2014-04-10 2014-07-02 武汉大学 Application of signal regulatory protein alpha (SHPS-1) gene in coronary atherosclerotic heart disease
CN104894068A (en) * 2015-05-04 2015-09-09 南京凯地生物科技有限公司 Method for preparing CAR-T cell by CRISPR/Cas9

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014100252A1 (en) * 2012-12-18 2014-06-26 University Of Washington Through Its Center For Commercialization Methods and compositions to modulate rna processing
CN103877576A (en) * 2014-04-10 2014-06-25 武汉大学 Function and application of Caspase activation and recruitment domain 3 (Card3) gene in coronary atherosclerotic heart disease
CN103898189A (en) * 2014-04-10 2014-07-02 武汉大学 Application of signal regulatory protein alpha (SHPS-1) gene in coronary atherosclerotic heart disease
CN104894068A (en) * 2015-05-04 2015-09-09 南京凯地生物科技有限公司 Method for preparing CAR-T cell by CRISPR/Cas9

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
SCOT J MATKOVICH，ET AL.: "Reciprocal regulation of myocardial miR and mRNA in human cardiomyopathy and reversal of the miR signature by biomechanical support", 《CIRCULATION.》 *
石晓凤 等: "microRNA 与冠状动脉粥样硬化性心脏病的相关性研究", 《中华临床医师杂志(电子版)》 *
高刚利，高燕: "关于心血管疾病一个新的潜在的标志物－microRNA研究的进展", 《心血管康复医学杂志》 *

Cited By (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12006520B2 (en) 2011-07-22 2024-06-11 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US11920181B2 (en) 2013-08-09 2024-03-05 President And Fellows Of Harvard College Nuclease profiling system
US10508298B2 (en) 2013-08-09 2019-12-17 President And Fellows Of Harvard College Methods for identifying a target site of a CAS9 nuclease
US10954548B2 (en) 2013-08-09 2021-03-23 President And Fellows Of Harvard College Nuclease profiling system
US11046948B2 (en) 2013-08-22 2021-06-29 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US10597679B2 (en) 2013-09-06 2020-03-24 President And Fellows Of Harvard College Switchable Cas9 nucleases and uses thereof
US10682410B2 (en) 2013-09-06 2020-06-16 President And Fellows Of Harvard College Delivery system for functional nucleases
US10858639B2 (en) 2013-09-06 2020-12-08 President And Fellows Of Harvard College CAS9 variants and uses thereof
US10912833B2 (en) 2013-09-06 2021-02-09 President And Fellows Of Harvard College Delivery of negatively charged proteins using cationic lipids
US11299755B2 (en) 2013-09-06 2022-04-12 President And Fellows Of Harvard College Switchable CAS9 nucleases and uses thereof
US11124782B2 (en) 2013-12-12 2021-09-21 President And Fellows Of Harvard College Cas variants for gene editing
US10465176B2 (en) 2013-12-12 2019-11-05 President And Fellows Of Harvard College Cas variants for gene editing
US11053481B2 (en) 2013-12-12 2021-07-06 President And Fellows Of Harvard College Fusions of Cas9 domains and nucleic acid-editing domains
US11578343B2 (en) 2014-07-30 2023-02-14 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US10704062B2 (en) 2014-07-30 2020-07-07 President And Fellows Of Harvard College CAS9 proteins including ligand-dependent inteins
US12043852B2 (en) 2015-10-23 2024-07-23 President And Fellows Of Harvard College Evolved Cas9 proteins for gene editing
US11214780B2 (en) 2015-10-23 2022-01-04 President And Fellows Of Harvard College Nucleobase editors and uses thereof
US10113163B2 (en) 2016-08-03 2018-10-30 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11999947B2 (en) 2016-08-03 2024-06-04 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US10947530B2 (en) 2016-08-03 2021-03-16 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11702651B2 (en) 2016-08-03 2023-07-18 President And Fellows Of Harvard College Adenosine nucleobase editors and uses thereof
US11661590B2 (en) 2016-08-09 2023-05-30 President And Fellows Of Harvard College Programmable CAS9-recombinase fusion proteins and uses thereof
US12084663B2 (en) 2016-08-24 2024-09-10 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
US11306324B2 (en) 2016-10-14 2022-04-19 President And Fellows Of Harvard College AAV delivery of nucleobase editors
US11820969B2 (en) 2016-12-23 2023-11-21 President And Fellows Of Harvard College Editing of CCR2 receptor gene to protect against HIV infection
US10745677B2 (en) 2016-12-23 2020-08-18 President And Fellows Of Harvard College Editing of CCR5 receptor gene to protect against HIV infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
US11542496B2 (en) 2017-03-10 2023-01-03 President And Fellows Of Harvard College Cytosine to guanine base editor
US11268082B2 (en) 2017-03-23 2022-03-08 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable DNA binding proteins
US11560566B2 (en) 2017-05-12 2023-01-24 President And Fellows Of Harvard College Aptazyme-embedded guide RNAs for use with CRISPR-Cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
US11932884B2 (en) 2017-08-30 2024-03-19 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11319532B2 (en) 2017-08-30 2022-05-03 President And Fellows Of Harvard College High efficiency base editors comprising Gam
US11795443B2 (en) 2017-10-16 2023-10-24 The Broad Institute, Inc. Uses of adenosine base editors
US11795452B2 (en) 2019-03-19 2023-10-24 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11643652B2 (en) 2019-03-19 2023-05-09 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11447770B1 (en) 2019-03-19 2022-09-20 The Broad Institute, Inc. Methods and compositions for prime editing nucleotide sequences
US11912985B2 (en) 2020-05-08 2024-02-27 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence
US12031126B2 (en) 2020-05-08 2024-07-09 The Broad Institute, Inc. Methods and compositions for simultaneous editing of both strands of a target double-stranded nucleotide sequence

Also Published As

Publication number Publication date
CN107362372B (en) 2019-01-11

Similar Documents

Publication Publication Date Title
CN107362372A (en) Use application of the CRISPR technologies in coronary atherosclerotic heart disease
CN107519492A (en) Applications of the 3p of miR 3187 in coronary atherosclerotic heart disease is knocked out using CRISPR technologies
CN106191071B (en) CRISPR-Cas9 system and application thereof in treating breast cancer diseases
CN107474129B (en) The method of specificity enhancing CRISPR-CAS system gene editorial efficiencies
CN106906242A (en) A kind of method that raising CRIPSR/Cas9 targeting knock outs gene produces nonhomologous end joint efficiency
CN108753772A (en) The construction method of the human neuroblastomacells of CAPNS1 genes is knocked out based on CRISPR/Cas technologies
CN105907758A (en) CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-Cas9) homing sequences and primers thereof, and transgenic expression vector and establishment method thereof
CN101805750B (en) Construction and application of farnesyl pyrophosphoric acid synthetase RNA (Ribonucleic Acid) interference recombinant lentivirus vector
CN108165549B (en) Universal expression framework of artificial circular RNA and application thereof
CN109266652A (en) SgRNA, carrier and application based on the mutational site CRISPR/Cas9 technical editor HBB-28
AU2017101108A4 (en) Construction method of animal model of mucopolysaccharidosis type II and use thereof
CN111304258B (en) Ndufs2 gene conditional point mutation mouse model and construction method and application thereof
CN109266651A (en) SgRNA based on CRISPR/Cas9 technical editor&#39;s HBB-41/42 deletion mutation site
CN103667338A (en) Fixed-point modification method for corn genome
CN106967716A (en) Double gRNA, double gRNA libraries, double gRNA vector libraries and its preparation method and application
Soeda et al. Similarity of nucleotide sequences around the origin of DNA replication in mouse polyoma virus and simian virus 40.
CN107686842A (en) A kind of target polynucleotide edit methods and its application
CN111849979A (en) sgRNA for targeted knockout of RPSA gene and construction method of RPSA gene knockout cell line
CN104928292B (en) The design method of sgRNA a kind of and slow virus carrier, the plasmid of building
CN105861551A (en) Vector for jointly expressing MicroRNAs to inhibit breast cancer cell proliferation and construction method and application thereof
CN110724748B (en) Molecular marker C3 of portunus trituberculatus parahaemolyticus and application thereof
CN107881248A (en) Pleuronectiformes Soleidae fish ribosomes the Internal Transcribed Spacer 1（ITS1）Universal primer design method and application
CN110527684A (en) Application of the nanosizing RNAi preparation in PVY prevention and treatment
CN108251456B (en) Preparation method of atherosclerosis mouse model with NOD genetic background
Okabe et al. A portion of the feline leukaemia virus genome is not endogenous in cat cells

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
TA01 Transfer of patent application right
TA01 Transfer of patent application right

Effective date of registration: 20181129

Address after: 528000 Sanshui Science and Technology Industrial Zone, Foshan City, Guangdong Province, No. 21 (F1) Complex Building, Block B, 5th Floor, No. 503 (Residence Declaration)

Applicant after: Foshan Boron Biotechnology Co., Ltd.

Address before: 450001 Zhengzhou University College of Life Sciences, 100 Science Avenue, Zhengzhou City, Henan Province

Applicant before: Hou Dongxue

GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20220608

Address after: 510000 room d501-d502, Zone D, Guangzhou International Business Incubator, No. 3, Juquan Road, Science City, Huangpu District, Guangzhou City, Guangdong Province

Patentee after: Guangzhou Aidi Gene Technology Co.,Ltd.

Address before: 528000 Sanshui Science and Technology Industrial Zone, Foshan City, Guangdong Province, No. 21 (F1) Complex Building, Block B, 5th Floor, No. 503 (Residence Declaration)

Patentee before: Foshan Boron Biotechnology Co.,Ltd.