CN107337736A - The double targeting Chimeric antigen receptors of OCTS CAR, encoding gene, recombinant expression carrier and its structure and application - Google Patents

Abstract

The invention provides a kind of double targeting Chimeric antigen receptors of OCTS CAR based on OCTS technologies, encoding gene, OCTS CAR T recombinant expression carriers and its construction method and application.The double targeting Chimeric antigen receptors of the OCTS CAR include the CD8 leader membrane receptor signal peptides being sequentially connected in series,Double antigen binding domains,CD8 Hinge Chimerical receptor hinges,CD8 Transmembrane Chimerical receptor transmembrane regions,CD28 Chimerical receptor costimulating factors,CD134 Chimerical receptors costimulating factor and TCR Chimerical receptor t cell activations domain,Wherein,Double antigen binding domains include the heavy chain VH and light chain VL of two single-chain antibodies connected in a certain way,Hinge Inter Linker between antibody inner hinge Inner Linker and single-chain antibody,Two single-chain antibodies refer to BCMA single-chain antibodies,CD319 single-chain antibodies,CD38 single-chain antibodies,PDL1 single-chain antibodies,Any combination of two between CD123 single-chain antibodies.In addition, additionally provide the gene of the double targeting Chimeric antigen receptors of the coding OCTS CAR, recombinant expression carrier and its construction method and application.

Description

The double targeting Chimeric antigen receptors of OCTS-CAR, encoding gene, recombinant expression carrier and its Structure and application

Technical field

The invention belongs to immunotherapy of tumors technical field, and in particular to a kind of for malignant tumour immunization therapy, base In the CAR of OCTS technologies double targeting Chimeric antigen receptor, encoding gene, OCTS-CAR recombinant expression carriers and its construction methods And application.

Background technology

The theoretical foundation of immunotherapy of tumors is that immune system has identification tumor associated antigen, regulation and control body attack tumour The ability of cell (e.g., the cell dissolving of high degree of specificity).Generation nineteen fifty, Burnet and Thomas are proposed " immunosurveillance " It is theoretical, it is believed that the tumour cell of the mutation often occurred in body can be identified and removed by immune system, be tumour immunity Theoretical foundation [Burnet FM.Immunological aspects of malignant have been established in treatment disease.Lancet,1967；1: 1171-4].Then, various tumour immunotherapies include cytokine therapy, monoclonal resists The sequential uses such as autogenic therapy, adoptive immunotherapy, vaccine therapy are in clinic.

A kind of more advanced tumour immunotherapy in 2013 --- CAR-T therapies are used successfully to clinic, and are demonstrated by preceding institute not Some clinical efficacies.CAR-T, full name are Chimeric Antigen Receptor T-Cell Immunotherapy, are fitted together to Antigen receptor T cell immunotherapy.The therapy is the means by transgenosis, by promoter, antigen recognizing district, costimulation because The chimeric molecule that son, effect area etc. collectively constitute, import in T cell genome, so that identification of the T cell to target cell, letter Number transduction, killing etc. function combine together, realize specific killing [the Eleanor J.Cheadle, et to target cell al.CAR T cells:driving the road from the laboratory to the clinic.Immunological Reviews 2014.Vol.257: 91–106].CAR-T therapies are clinically most leading There is the CLT019 of Novartis, refractory Patients With Acute Lymphoblastic Leukemia is recurred using CLT019 treatments, the tumour of six months is without entering Exhibition survival rate reaches 67%, wherein most long response time reached more than 2 years.General headquarters are located at the excellent Ka Disheng in Shanghai of Chinese Shanghai Thing Pharmaceutical Technology Co., Ltd cooperates with hospital, and by the end of 2 months 2017, the refractory white blood of acute lymphoblastic was recurred in treatment altogether Patient 36, wherein complete 24, alleviation ratio reaches 66.6%.Therefore, CAR-T cell therapies are the tops of anticancer research The property covered breaks through, it may be possible to one of most possible means for curing cancer, and by《Science》It is big that magazine was chosen as 2013 years ten First of technological breakthrough.

CAR-T at present evident in efficacy in terms of the neoplastic hematologic disorder of the treatment several types such as B- lymphocytic leukemias, but A kind of antigenic targets can only be identified by being that there is also some limitations, such as the previous Chimeric antigen receptor of mesh, but tumour cell is Individual complicated colony, after the tumour cell containing corresponding antigens is eliminated, the tumour cell without corresponding antigens can increase rapidly Grow, tumor recurrence is caused after a period of time.

CAR-T identifications is identified two kinds of antigens simultaneously, there are two schemes optional：First, by two groups of Chimeric antigen receptors Structure enters a slow virus transgene carrier, and two groups of Chimeric antigen receptor transductions disposably are entered into primary T lymphocytes； Second, being transduceed at twice with two slow virus transgene carriers, two groups of Chimeric antigen receptors are transduceed into primary T lymphs respectively Cell.

The shortcomings that scheme one, is the valuable capacity for taking slow virus transgene carrier, is unfavorable for loading other Functional Units Part；Transgene carrier packaging efficiency is low；Gene transduction efficiency is very low, it is difficult to transduce into primary T lymphocytes.

The shortcomings that scheme two, is needs by transduceing twice, and the overall efficiency transduceed twice is relatively low, transduces cycle time It is long, the easy aging of primary cell, cause multiplication capacity to fail, killing ability declines, and influences tumor clearance curative effect.

As the primary study object of immunotherapy of tumors, the tumour of Huppert's disease (Multiple myeloma) is thin Born of the same parents originate from the thick liquid cell in marrow, and thick liquid cell is cell of the bone-marrow-derived lymphocyte development to final function phases, therefore are one Kind is using the malignant plasma cell tumour that existing treatment method is difficult healing.The life cycle of usual patient is 3 years, it is short even only Have 6-12 months.

But research is found, Cucumber exists in B cell or malignant cell surface-stable or height is expressed, and can be used as thin Born of the same parents' label or target.Such as：

BCMA (B-cell maturation antigen) is (including more in B cell as a kind of mark selective expression Hair property myeloma cell) surface, can be as the target guiding CAR-T cell killing tumour cells (B-cell of CAR-T cells Maturation Antigen is a Promising Target for Adoptive T cell Therapy of Multiple Myeloma. Robert O.Carpenter,et al.Clin Cancer Res.2013April 15；19 (8):2048–2060.)。

CD319 is also known as CS1, SLAMF7, is a kind of cell surface marker of stabilization, in normal plasma cells and pernicious Thick liquid cell expression has expression.CD319 is a kind of and its stable antigen, even isolated by coarse means Malignant plasma cell system, even after freezing, what still can be stablized detects expression [Frigyesi I, Adolfsson J, Ali M,Christophersen MK,Johnsson E,Turesson I,Gullberg U,Hansson M,Nilsson B(Feb 2014)."Robust isolation of malignant plasma cells in multiple myeloma" .Blood.123(9): 1336–40.]。

CD38 is also referred to as cyclic ADP ribose hydrolase, is detected in many immunocyte surface energies, including B cell and NK cells.CD38 is a kind of mark of cell activation, is joined with HIV, leukaemia, myeloma, solid tumor etc. It is tied.Clinically have at present using targeting CD38 antibody to treat Huppert's disease [Lokhorst, Henk M.； Plesner,Torben；Laubach,Jacob P.；Nahi,Hareth；Gimsing,Peter；Hansson,Markus； Minnema, Monique C.；Lassen,Ulrik；Krejcik,Jakub(2015-09-24)."Targeting CD38with Daratumumab Monotherapy in Multiple Myeloma".The New England Journal of Medicine.373(13): 1207–1219.]。

CD123 is the alpha chains of human interleukin-13 acceptor, in most acute myeloid leukemia (AML) cell and a lot There is expression on hematopoietic cell surface, and CD123 is an extraordinary immunotherapeutic targets, because even seldom in CD123 expression Cell in, its expression can increase gradually enhancing with the time, and acute myeloid leukemia is likely due to be in white blood The candidate stem cell of sick early stage passes through clone evolution, using CD123 as target spot, then can play a part of clear marrow (Saar Gill,Carl H.June et al.Preclinical targeting of human acute myeloid leukemia and myeloablation using chimeric antigen receptor-modified T cells.Blood.2014；123(15):2343- 2354.).

PD-L1 overexpressions in most cancerous tissues, including NSCLC, melanoma, breast cancer, glioma, lymph [the Intlekofer AM, Thompson such as knurl, leukaemia and various urological cancers, tumor in digestive tract, system genitale tumour CB.At the bench:preclinical rationale for CTLA-4and PD-1blockade as cancer immunotherapy[J].J Leukoc Biol,2013,94(1):25-39.].Parsa in the tumour cell of mouse and people, It was found that the IFN-γ of T cell abnormal secretion, IFN-γ can with induced tumor cell the high expression of PD-L1 [Ding H, Wu X, Wu J,et al.Delivering PD-1 inhibitory signal concomitant with blocking ICOS co-stimulation suppresses lupus-like syndrome in autoimmune BXSB mice[J].Clin Immunol,2006,118(2/3):258-267.].The high expression of PD-L1, can be led to by suppressing RAS and PI3K/AKT signals Road, and then cell cycle regulation checkpoint albumen and cell multiplication related protein expression, ultimately result in the suppression of T cell propagation [11].The experiment in vitro such as Dong and mouse model also found that the activation of PD-1/PD-L1 signal paths can be with inducing specific CTL adjust dies, CTL cell toxicant lethal effect sensitiveness is declined, promote tumour cell generation immunologic escape [Dong H, Strome SE,Salomao DR,et al.Tumor-associated B7-H1promotes T-cell apoptosis:a potential mechanism of immune evasion[J].Nat Med,2002,8(8):793-800.]。

The content of the invention

The present invention be based on above-mentioned discovery and carry out, and it is an object of the present invention to provide a kind of be used for malignant tumour, it is especially multiple Property the double targeting Chimeric antigen receptors of the CAR based on OCTS technologies of myeloma immunization therapy, encoding gene, OCTS-CAR restructuring Expression vector and its construction method and application.

OCTS full name is One CAR with Two ScFvs, passes through the OCTS that connects (Series OCTS) or corner OCTS (Turn OCTS) connected mode, by two sections of scFv and it is integrated into a chimeric molecule (shown in Fig. 1), assigns T lymphs Mode non-dependent cell HLA identifies the ability of two kinds of tumour antigens, can be identified relative to traditional CAR-T cells wider General target, further expand the removing scope of tumour cell.

OCTS basic engineering includes two tumor associated antigens (tumor-associated antigen, TAA) knot Close area (the scFv sections for being typically derived from monoclonal antibody antigen calmodulin binding domain CaM), an extracellular hinge area, a transmembrane region, two Individual intracellular signal transduction area and a response element area.Specificity, validity and genetic modification of the scFv regions for OCTS It is crucial determinant for the security of T cell itself.

OCTS-CAR-T technologies of the present invention, it is on the basis of current CAR-T cell therapies, by embedding Close the Optimizing Reconstruction of antigen receptor (CAR) structure so that Chimeric antigen receptor can identify two kinds of antigens, greatly expand The identification range of CAR-T cells, the removing for cancer colonies is more thorough, and curative effect is more longlasting.

The first aspect of the present invention, there is provided a kind of double targeting Chimeric antigen receptors of CAR based on OCTS technologies, including CD8leader membrane receptors signal peptide, double antigen binding domains, CD8Hinge Chimerical receptors hinge, the CD8 being sequentially connected in series Transmembrane Chimerical receptors transmembrane region, CD28 Chimerical receptors costimulating factor, CD134 Chimerical receptors costimulating factor with And TCR Chimerical receptor t cell activations domain.Wherein, double antigen binding domains include two single-chain antibodies connected in a certain way Hinge Inter-Linker between heavy chain VH and light chain VL, antibody inner hinge Inner-Linker and single-chain antibody；Two lists Chain antibody refers to that BCMA single-chain antibodies, CD319 single-chain antibodies, CD38 single-chain antibodies, PDL1 single-chain antibodies, CD123 are single-stranded anti- Any combination of two between body.

Further, the double targeting Chimeric antigen receptors of OCTS-CAR of the invention, also with following technical characteristic：Two single-stranded Antibody with connect or the connected mode of corner connect.

The second aspect of the invention, there is provided encode the gene of the double targeting Chimeric antigen receptors of above-mentioned CAR, coding is above-mentioned The sequence number control of the gene of each several part is as follows：CD8leader membrane receptors signal peptide (SEQ ID NO.15), BCMA are single-stranded Antibody light chain VL (SEQ ID NO.16), BCMA single-chain antibody heavy chains VH (SEQ ID NO.17), CD319 single-chain antibody light chains VL (SEQ ID NO.18), CD319 single-chain antibody heavy chains VH (SEQ ID NO.19), CD38 single-chain antibody light chain VL (SEQ ID NO.20), CD38 single-chain antibodies heavy chain VH (SEQ ID NO.21), PDL1 single-chain antibody light chains VL (SEQ ID NO.22), PDL1 single-chain antibody heavy chains VH (SEQ ID NO.23), CD123 single-chain antibody light chains VL (SEQ ID NO.24), CD123 are single-stranded Hinge between heavy chain of antibody VH (SEQ ID NO.25), antibody inner hinge Inner-Linker (SEQ ID NO.26), single-chain antibody Inter-Linker (SEQ ID NO.27), CD8Hinge Chimerical receptors hinge (SEQ ID NO.28), CD8Transmembrane Chimerical receptors transmembrane region (SEQ ID NO.29), CD28 Chimerical receptors costimulating factor (SEQ ID NO.30), CD134 Chimerical receptors costimulating factor (SEQ ID NO.31), TCR Chimerical receptor t cell activations domain (SEQ ID NO.32)。

The third aspect of the present invention, there is provided a kind of OCTS-CAR recombinant expression carriers, there is such technical characteristic：Bag Include the gene of expression vector, people's EF1 α promoters and the double targeting Chimeric antigen receptors of coding CAR-T.Wherein, people EF1 α are opened The gene order of mover is as shown in SEQ ID NO.14, and the double genes for targetting each several part in Chimeric antigen receptors of coding CAR-T are such as It is upper described.Wherein, the gene order of antigen binding domain includes any two kinds in BCMA, CD319, CD38, PDL1, CD123 of list The light chain VL and heavy chain VH of chain antibody gene order.

Further, present invention also offers another OCTS-CAR recombinant expression carriers, relative to above-mentioned recombination expression Carrier, the recombinant expression carrier also include the gene of coding PDL1 single-chain antibodies, its gene order such as SEQ ID NO.33 institutes Show.

Expression vector skeleton of the present invention is third generation slow virus carrier (shown in Fig. 2A), and 3 ' SIN LTR are removed U3 regions, eliminate the possibility of slow virus carrier self-replacation, substantially increase security；Add cPPT and WPRE Element, improve transduction efficiency and the expression efficiency of transgenosis；Core when ensure that slow virus carrier packaging using RSV promoters Heart RNA lasting efficient transcription；Using the EF1 α promoters of people itself, enable CAR genes in human body long lasting for table Reach.

The Lentiviral includes the sequences of AmpR containing ampicillin resistance gene, prokaryotic replions pUC Ori sequences Row, Viral Replicon SV40Ori sequences, RSV promoters, slow virus 5terminal LTR, slow virus 3terminal Self- Inactivating LTR, Gag cis elements, RRE cis elements, env cis elements, cPPT cis elements, ZsGreen1 are green The enhanced marmot hepatitis B posttranscriptional regulatory element of color fluorescin, IRES ribosome binding sequences, eWPRE.

The present invention be by people EF1 α promoters, CD8leader Chimerical receptor signal peptides, BCMA, CD319, CD38, PDL1, Any two kinds of single-chain antibody light chain VL and heavy chain VH in CD123, antibody inner hinge Inner-Linker, cut with scissors between single-chain antibody Chain Inter-Linker, CD8Hinge Chimerical receptor hinge, CD8Transmembrane Chimerical receptor transmembrane regions, CD28 are fitted together to Acceptor costimulating factor, CD134 Chimerical receptor costimulating factors, TCR Chimerical receptor t cell activations domain, and PDL1 are single-stranded anti- The expressing gene structure of body enters recombined lentivirus vector, starts whole OCTS expression of structural gene by people EF1 α promoters.

CD8leader Chimerical receptors signal peptide is located at the N-terminal of OCTS albumen, for guiding OCTS albumen to be positioned at cell Film；The heavy chain and light chain of any two groups of single-chain antibodies are mutually combined to form double antigen recognizing districts, for identifying corresponding target antigen； CD8Hinge Chimerical receptors hinge is used to scFv being anchored on the outside of cell membrane；CD8Transmembrane Chimerical receptor cross-films Area is used to whole Chimerical receptor being fixed on cell membrane；CD28 Chimerical receptors costimulating factor is used to stimulate T lymphocyte bodies Outer activation and interior tumor cell lethal effect；CD134 Chimerical receptors costimulating factor be used for promote T lymphopoiesis and Cytokine secretion, strengthen tumour immunity, be advantageous to the long-term surviving of memory T cell；TCR Chimerical receptor t cell activations domain is used to swash The expression of downstream signaling pathway living；PDL1 single-chain antibody can effectively close PDL1, blocking immunity negative regulator signal path, face On bed can be used for suppress tumour immune escape, improve CAR-T cellular immunotherapies the effect of.

When antigen recognition region is combined with target antigen, signal is transferred into the cell by Chimerical receptor, thin so as to produce T One systems such as born of the same parents' propagation, cytokine secretion increase, Anti-apoptotic proteins secretion increase, cell death delay, cracking target cell Row biological effect.

In the present invention, BCMA single-chain antibody light chain VL, BCMA single-chain antibody heavy chain VH, CD319 single-chain antibody light chains VL, CD319 single-chain antibody heavy chain VH, CD38 single-chain antibody light chain VL, CD38 single-chain antibody heavy chain VH, PDL1 single-chain antibody light chains VL, PDL1 single-chain antibody heavy chain VH, CD123 single-chain antibody light chain VL, CD123 single-chain antibody heavy chain VH, PDL1 single-chain antibody, With with shown nucleotide sequence>=80% homology is (preferably,>=90% homology；Deng preferably,>=95% is homologous Property；Most preferably,>=97% homology；) nucleotide sequence.

In the present invention, BCMA single-chain antibody light chain VL, BCMA single-chain antibody heavy chain VH, CD319 single-chain antibody light chains VL, CD319 single-chain antibody heavy chain VH, CD38 single-chain antibody light chain VL, CD38 single-chain antibody heavy chain VH, PDL1 single-chain antibody light chains VL, PDL1 single-chain antibody heavy chain VH, CD123 single-chain antibody light chain VL, CD123 single-chain antibody heavy chain VH, PDL1 single-chain antibody, With the amino acid sequence corresponding with shown nucleotide sequence>=80% homology is (preferably,>=90% homology；Deng Preferably,>=95% homology；Most preferably,>=97% homology) amino acid sequence.

In the present invention, BCMA single-chain antibody light chain VL, BCMA single-chain antibody heavy chain VH, CD319 single-chain antibody light chains VL, CD319 single-chain antibody heavy chain VH, CD38 single-chain antibody light chain VL, CD38 single-chain antibody heavy chain VH, PDL1 single-chain antibody light chains VL, PDL1 single-chain antibody heavy chain VH, CD123 single-chain antibody light chain VL, CD123 single-chain antibody heavy chain VH, PDL1 single-chain antibody are equal By humanization modified, the production that the anti-mouse of internal people resists (Human anti-mouse antibodies, HAMA) can be effectively reduced It is raw, extend scFv half-life period and action effect.

The transgene carrier that the present invention uses is the replication defect type slow virus carrier after restructuring, can integrate exogenous sequences Enter host gene, it is disposable, it can not replicate and breed, securely and reliably.

The costimulating factor region in OCTS Chimerical receptors in the present invention can be 4-1BB, ICOS, CD27, OX40, CD28, MYD88, IL1R1, CD70, TNFRSF19L, TNFRSF27, TNFRSF1OD, the tumour such as TNFRSF13B, TNFRSF18 One kind in necrosis factor superfamily (tumor necrosis factor receptor superfamily, TNFRSF), two Kind, three kinds, several, tens kinds of combination.

The replication defect type slow virus transgene carrier used in the present invention can be two generations or the slow virus of three generations Transgene carrier.

The fourth aspect of the invention, there is provided the construction method of OCTS-CAR recombinant expression carriers, comprise the following steps：

A. ampicillin resistance gene AmpR sequences (SEQ ID NO.1), prokaryotic replions pUC Ori sequences will be contained (SEQ ID NO.2), Viral Replicon SV40Ori sequences (SEQ ID NO.3), RSV promoters (SEQ ID NO.4), slow disease Malicious 5terminal LTR (SEQ ID NO.5), slow virus 3terminal Self-Inactivating LTR (SEQ ID NO.6), Gag cis elements (SEQ ID NO.7), RRE cis elements (SEQ ID NO.8), env cis elements (SEQ ID NO.9), cPPT cis elements (SEQ ID NO.10), ZsGreen1 green fluorescent proteins (SEQ ID NO.11), IRES ribose Body binding sequence (SEQ ID NO.12), enhanced marmot hepatitis B posttranscriptional regulatory element (the SEQ ID of eWPRE NO.13) it is stored on third generation slow virus skeleton plasmid pLenti-3G basic, this method is developed by our company and built, And it is disclosed in《It is a kind of based on the CAR-T transgene carriers and its construction method of replication defective recombinant slow virus and application》 201610008360.5 in patent；

B. will coding CD8leader membrane receptors signal peptide, double antigen binding domains, CD8Hinge Chimerical receptors hinge, CD8 Transmembrane Chimerical receptors transmembrane region, CD28 Chimerical receptors costimulating factor, CD134 Chimerical receptors costimulating factor with And the gene in TCR Chimerical receptor t cell activations domain is cloned into slow virus skeleton plasmid by digestion, connection, recombining reaction In pLenti-3G basic, obtain the recombinant slow virus plasmid that the third generation is designed based on OCTS, as pOCTS123BCMAs, pOCTS319BCMAs、pOCTS38BCMAs、pOCTS-PDL1BCMAs、 pOCTS123BCMAt、pOCTS319BCMAt、 POCTS38BCMAt, pOCTS-PDL1BCMAt etc., wherein, the last letter " s " represents two sections of scFv and is connected in series, letter " t " represents two sections of scFv corners connections.

C. recombinant slow virus plasmid step B obtained respectively with slow virus packaging plasmid pPac-GP, pPac-R with And memebrane protein plasmid pEnv-G transfects HEK293T/17 cells jointly, and gene transcript expression is carried out in HEK293T/17 cells Afterwards, packing successfully recombined lentivirus vector can be discharged into cells and supernatant, collect the upper of the recombined lentivirus vector that includes Clear liquid；

D. obtained recombinant slow virus supernatant is purified using the post way of purification for filtering, adsorbing, eluting, respectively To CAR-T recombinant slow virus expression vectors, (be named as lvOCTS123BCMAs, lvOCTS319BCMAs, lvOCTS38BCMAs、lvOCTS-PDL1BCMAs、lvOCTS123BCMAt、lvOCTS319BCMAt、 lvOCTS38BCMAt、 lvOCTS-PDL1BCMAt)。

In addition, in stepb, will can also encode the genes of PDL1 single-chain antibodies together with other genes by digestion, Connection, recombining reaction are cloned into slow virus skeleton plasmid pLenti-3G basic, obtain what the third generation was designed based on OCTS Recombinant slow virus plasmid.

The fifth aspect of the present invention, there is provided a kind of OCTS-CAR-T cells, the OCTS-CAR-T cells are in genome The T lymphs for being imported with OCTS-CAR recombinant expression carriers or being modified through the double targeting Chimeric antigen receptors of the CAR based on OCTS are thin Born of the same parents.

After Workshop Production of the OCTS-CAR-T cells that the present invention uses by GMP ranks, available for human clinical trial.

The sixth aspect of the present invention, there is provided application of the OCTS-CAR-T cells in treating malignant tumor medicine is prepared.

Further, the treating malignant tumor medicine is that treatment malignant tumour is that malignant plasma cell tumour, acute myeloid are white Blood disease, melanoma, breast cancer, glioma, lymthoma, urological cancer, the medicine of tumor in digestive tract or system genitale tumour.

The effect of invention and effect

The present invention uses OCTS technologies on the basis of current traditional CAR-T cell therapies, by Chimeric antigen receptor (CAR) Optimizing Reconstruction of structure so that Chimeric antigen receptor can identify two kinds of antigens, and it is thin on the one hand to have expanded CAR-T significantly The identification range of born of the same parents, the removing for cancer colonies is more thorough, and curative effect is more longlasting；On the other hand batch culture CAR-T is avoided Cell, cost is greatlyd save, so as to avoid patient from repeatedly feeding back different targeting CAR-T cells, saved the economic branch of patient Go out, reduce the probability of recurrence, improve the life quality of patient indirectly.

By the OCTS that connects (Series OCTS) or corner OCTS (Turn OCTS) connected mode, by two sections ScFv is integrated into a chimeric molecule, not only assigns the energy that the non-dependent modes of T lymphocytes HLA identify two kinds of tumour antigens Power, and wider target can be identified relative to traditional CAR-T cells, further expand the removing of tumour cell Scope, as OCTS-CAR-T will enter clinical investigation phase, indicate that CAR-T cell therapies will enter for 2.0 epoch.

In addition, BCMA single-chain antibody light chain VL, BCMA single-chain antibody heavy chain VH, CD319 single-chain antibody light chains of the present invention VL, CD319 single-chain antibody heavy chain VH, CD38 single-chain antibody light chain VL, CD38 single-chain antibody heavy chain VH, PDL1 single-chain antibody are light Chain VL, PDL1 single-chain antibody heavy chain VH, CD123 single-chain antibody light chain VL, CD123 single-chain antibody heavy chain VH, PDL1 single-chain antibody By humanization modified, it can effectively reduce the anti-mouse of internal people and resist (Human anti-mouse antibodies, HAMA) Generation, extend scFv half-life period and action effect, increase the existence time of OCTS-CAR-T cells.

In addition, one kind of the costimulating factor used in the present invention or several combination, by increasing capacitance it is possible to increase cell after transduction The characteristics such as multiplication rate, time-to-live, killing-efficiency, immunological memory.

Therefore, OCTS-CAR-T cells of the present invention will treat to tumour cell and provide reliable guarantee.

Brief description of the drawings

Fig. 1 is the schematic diagram of the double targeting Chimeric antigen receptors (OCTS) of CAR of the present invention, wherein (A) is series connection OCTS The schematic diagram of (Series OCTS), (B) are corner OCTS (Turn OCTS) schematic diagram.

Fig. 2 is the slow virus carrier structural representation of the present invention；Wherein (A) figure is the third generation slow virus that the present invention uses Carrier structure schematic diagram, (B) figure are the second generation and third generation slow virus carrier structure comparison schematic diagram.

Fig. 3 is the structure flow chart of the recombined lentivirus vector of the present invention；Wherein, (A) figure is slow virus skeleton plasmid PLenti-3G basic structural representation；(B) figure is the schematic diagram of 8 OCTS plasmids；(C) figure is slow virus packaging plasmid The structural representation of pPac-GP plasmids；(D) figure is the structural representation of slow virus packaging plasmid pPac-R plasmids；(E) figure is Memebrane protein plasmid pEnv-G structural representation.

Fig. 4 is the element orders schematic diagram of the double targeting Chimeric antigen receptors (OCTS) of CAR, wherein, (A) figure is series connection OCTS (Series OCTS) structural representation, (B) figure are corner OCTS (Turn OCTS) structural representations.

Fig. 5 is recombinant slow virus plasmid pOCTS123BCMAs (A), pOCTS319BCMAs (B), pOCTS38BCMAs (C)、pOCTS-PDL1BCMAs(D)、pOCTS123BCMAt(E)、pOCTS319BCMAt (F)、pOCTS38BCMAt(G)、 POCTS-PDL1BCMAt (H) digestion prognostic chart and digestion agarose gel electrophoresis figure.Wherein, in A~H is schemed, lane1 is 1kb DNA ladder Marker digestion prognostic chart；Lane2 is the digestion prognostic chart of above-mentioned each recombinant slow virus plasmid； Lane3 is 1kb DNA ladder Marker digestion agarose gel electrophoresis figures；Lane4 is above-mentioned each recombinant slow virus plasmid Digestion agarose gel electrophoresis figure.

Fig. 6 is the titre testing result of recombined lentivirus vector.

Fig. 7 is the schematic flow sheet of the OCTS-CAR-T cell constructions of the present invention, comprising be separately cultured, activate, gene turns Lead, the stage such as OCTS-CAR-T cellular identifications.

Fig. 8 is the detection of mycoplasma result of OCTS-CAR-T cells, lane1 DL2000marker, from top to bottom band Band is followed successively by from top to bottom：2kb、1kb、750bp、500bp、250bp、100bp；Lane2 is positive control；Lane3 is the moon Property control；Lane4 is PBS；Lane5 is lysate；Lane6 is OCTS123BCMAs-CAR-T cells；Lane7 is OCTS319BCMAs-CAR-T cells；Lane8 is OCTS38BCMAs-CAR-T cells；Lane9 is OCTS-PDL1BCMAs- CAR-T cells；Lane10 is OCTS123BCMAt-CAR-T cells；Lane11 is OCTS319BCMAt-CAR-T cells； Lane12 is OCTS38BCMAt-CAR-T cells；Lane13 is OCTS-PDL1BCMAt-CAR-T cells.

Fig. 9 is the transduction efficiency and immunophenotyping result of flow cytometer detection OCTS-CAR-T cells.Scheme A to represent The transduction efficiency result of OCTS123BCMAs-CAR-T cells；Scheme the immunophenotyping that B represents OCTS123BCMAs-CAR-T cells As a result；Scheme the transduction efficiency result that C represents OCTS319BCMAs-CAR-T cells；Scheme D and represent that OCTS319BCMAs-CAR-T is thin The immunophenotyping result of born of the same parents；Scheme the transduction efficiency result that E represents OCTS38BCMAs-CAR-T cells；Scheme F to represent The immunophenotyping result of OCTS38BCMAs-CAR-T cells；Scheme the transduction effect that G represents OCTS-PDL1BCMAs-CAR-T cells Rate result；Scheme the immunophenotyping result that H represents OCTS-PDL1BCMAs-CAR-T cells；Scheme I and represent OCTS123BCMAt- The transduction efficiency result of CAR-T cells；Scheme the immunophenotyping result that J represents OCTS123BCMAt-CAR-T cells；Scheme K to represent The transduction efficiency result of OCTS319BCMAt-CAR-T cells；Scheme the immunophenotyping that L represents OCTS319BCMAt-CAR-T cells As a result；Scheme the transduction efficiency result that M represents OCTS38BCMAt-CAR-T cells；Scheme N and represent OCTS38BCMAt-CAR-T cells Immunophenotyping result；Scheme the transduction efficiency result that O represents OCTS-PDL1BCMAt-CAR-T cells；Scheme P and represent OCTS- The immunophenotyping result of PDL1BCMAt-CAR-T cells.

Under the conditions of Figure 10 is different effect target, OCTS-CAR-T cells are to target cell killing-efficiency block diagram：Scheme A to represent The Mortaility results of OCTS123BCMAs-CAR-T cells and OCTS123BCMAt-CAR-T cells to different target cells；Scheme B to represent The Mortaility results of OCTS319BCMAs-CAR-T cells and OCTS319BCMAt-CAR-T cells to different target cells；Scheme C to represent The Mortaility results of OCTS38BCMAs-CAR-T cells and OCTS38BCMAt-CAR-T cells to different target cells；Scheme D to represent The Mortaility results of OCTS-PDL1BCMAs-CAR-T cells and OCTS-PDL1BCMAt-CAR-T cell to different target cells.

Embodiment

Following examples are merely to illustrate the present invention, and without with limiting the scope of the present invention.Unreceipted tool in embodiment The experimental method of concrete conditions in the establishment of a specific crime, generally according to normal condition, or according to the condition proposed by manufacturer.

Embodiment is combined into dual anti-original with CD319, CD38, PDL1, CD123 single-chain antibody respectively with BCMA single-chain antibodies Exemplified by cog region, to structure, OCTS-CAR-T cell constructions and the function test method of the double targeting Chimeric antigen receptors of CAR Illustrate.In every kind of combination, two sections of scFv are connected in a manner of being connected in series and being connected with corner respectively, form eight altogether The double antigen recognizing districts of kind.

The light chain and heavy chain of the single-chain antibody of other four kinds of materials can also be combined into double antigen recognizing districts, the double targetings of its CAR Structure, OCTS-CAR-T cell constructions and the function test method of Chimeric antigen receptor and the side described in the present embodiment Method is identical.

Experiment material used in embodiment is as follows：

(1) slow virus skeleton plasmid pLenti-3G basic, slow virus packaging plasmid pPac-GP, pPac-R and film egg White matter grain pEnv-G, HEK293T/17 cell, homologous recombination enzyme, Oligo Annealing Buffer, mycoplasma test reagent Box, endotoxin detection kit, PSCA+K562, PDL1+K562, PDL1+PSCA+K562, K562 cell take wing purchased from generation (on Sea) biological medicine Science and Technology Ltd.；；

(2) people's fresh peripheral blood is provided by health donors；

(3)OCTS123BCMAs、OCTS319BCMAs、OCTS38BCMAs、OCTS-PDL1BCMAs、 OCTS123BCMAt, OCTS319BCMAt, OCTS38BCMAt, OCTS-PDL1BCMAt DNA sequence dna combination designed, designed (ginseng It is shown in Table 1), gives Shanghai Jierui Biology Engineering Co., Ltd's synthesis, and preserve with oligonucleotides dry powder or plasmid form；

The slow virus recombinant plasmid of table 1 designs

(4) toolenzyme Cla I, Pst I, BsrG I, Nde I, EcoR I, BamH I, ApaL I, Spe I, T4DNA connect Connect enzyme and be purchased from NEB companies；

(5) 0.22 μm of -0.8 μm of PES filters are purchased from millipore companies；D-PBS (-), 0.4% trypan blue, screen cloth, All types of Tissue Culture Dish, culture bag, culture plate are purchased from corning companies；

(6)Opti-MEM、Pen-Srep、Hepes、FBS、AIM-V、RPMI 1640、DMEM、lipofectamine 3000 are purchased from invitrogen companies；Biotinylated protein L are purchased from GeneScript companies；LDH detection kits Purchased from promega companies；Ficoll lymphocyte separation mediums are purchased from GE companies；20% human serum albumin injection is purchased from Ztel Belling company；CryoPremium frozen stock solutions, sorting buffer solution voluntarily configure；RIL-2, rIL-7, rIL-15, rIL-21 purchase From peprotech companies；CD3 monoclonal antibodies, CD28 monoclonal antibodies, CD3/CD28 magnetic bead CD4/CD8 magnetic beads are purchased from Germany Miltenyi companies；

(7) refrigerated centrifuge is purchased from ThermoScientific companies of the U.S.；FACS flow cytometers are public purchased from Thermo Department；Fluorescence inverted microscope is purchased from Olympus companies.

(8) CD4-FITC, CD8-APC are purchased from BioLegend companies；0.9% physiological saline is purchased from Jin Mai companies； ProteinL Magnetic Beads are purchased from BioVision companies；PrimeSTAR, RetroNectin are purchased from Takara companies； Phycoerythrin (PE)-conjugated streptavidin are purchased from BD Bioscience companies；Plasmid extraction reagent Box, Ago-Gel QIAquick Gel Extraction Kit are purchased from MN companies；Competent cell TOP10 is purchased from tiangen companies；NaCl、KCl、 Na₂HPO₄.12H₂O、KH₂PO₄、Trypsin、EDTA、CaCl₂, NaOH, PEG6000 be purchased from Shanghai life work.

(9) DNeasy kits are purchased from Shanghai JaRa company；SA-HRP is purchased from Shanghai Yi Sheng companies；

(10) primer：Primer according to needed for design of primers principle designs amplification of DNA fragments and target site, the primer is by upper Marine growth company synthesizes, and is specially：

EF1α-F：5’-attcaaaattttatcgatgctccggtgcccgtcagt-3’(SEQ ID NO.34)

EF1α-R：5’-TCACGACACCTGAAATGGAAGA-3’(SEQ ID NO.35)

OCTS-F：CATTTCAGGTGTCGTGAGGATCCGCCACCATGGCGCTGCCGGTGAC(SEQ ID NO.36)

OCTS-R：GGGGAGGGAGAGGGGCTTAGCGCGGCGGCAGCG(SEQ ID NO.37)

IRES-F：GCCCCTCTCCCTCCCCC(SEQ ID NO.38)

IRES-R：ATTATCATCGTGTTTTTCAAAGGAA(SEQ ID NO.39)

PDL1scab-F：AAAACACGATGATAATGCCACCATGAACTCCTTCTCCACAAGCG(SEQ ID NO.40)

PDL1scab-R：AATCCAGAGGTTGATTGTCGACGAATTCTCATTTGCCCGGGCTCAG(SEQ ID NO.41)

WPRE-QPCR-F：5’-CCTTTCCGGGACTTTCGCTTT-3’(SEQ ID NO.42)

WPRE-QPCR-R：5’-GCAGAATCCAGGTGGCAACA-3’(SEQ ID NO.43)

Actin-QPCR-F：5’-CATGTACGTTGCTATCCAGGC-3’(SEQ ID NO.44)

Actin-QPCR-R：5’-CTCCTTAATGTCACGCACGAT-3’(SEQ ID NO.45).

The OCTS-CAR-T cell constructions of embodiment one

First, recombined lentivirus vector lvOCTS123BCMAs, lvOCTS319BCMAs, lvOCTS38BCMAs, lvOCTS- PDL1BCMAs, lvOCTS123BCMAt, lvOCTS319BCMAt, lvOCTS38BCMAt, lvOCTS-PDL1BCMAt structure Build, purify, detect

As shown in figure 3, the construction method of recombined lentivirus vector of the present invention is as follows：

1st, by people EF1 α promoters, the double targeting Chimeric antigen receptors of the CAR based on OCTS (OCTS123BCMAs, OCTS319BCMAs、OCTS38BCMAs、OCTS-PDL1BCMAs、OCTS123BCMAt、 OCTS319BCMAt、 OCTS38BCMAt, OCTS-PDL1BCMAt), PDL1 single-chain antibodies be cloned into slow virus skeleton plasmid pLenti-3G basic, Respectively obtain recombinant slow virus plasmid pOCTS123BCMAs, pOCTS319BCMAs, pOCTS38BCMAs, pOCTS- PDL1BCMAs、pOCTS123BCMAt、 pOCTS319BCMAt、pOCTS38BCMAt、pOCTS-PDL1BCMAt。

(1) slow virus skeleton plasmid pLenti-3G basic are carried out using Cla I and EcoR I restriction enzymes double Digestion, product pass through 1.5% agarose gel electrophoresis, confirm 5823bp fragment V1, and recovery of tapping rubber is placed in In Eppendorf pipes, corresponding fragment (being shown in Table 2) is reclaimed with the Ago-Gel QIAquick Gel Extraction Kit of MN companies, and determine product Purity and concentration；

The Ago-Gel recycling step of table 2

Step	Concrete operations
		Colloidal sol	Sol solutionses are added in 200 μ l NTI/100mg gel ratios, 5-10 minutes are placed in 50 DEG C of water-baths.
With reference to DNA	11000g is centrifuged 30 seconds, discards filtrate.
		Wash film	700 μ l NT3,11000g centrifugation 30 seconds is added, discards filtrate.
Wash film	Repeat the 3rd step once
		Dry	11000g is centrifuged 1 minute, the collecting pipe renewed, and room temperature is placed 1 minute.
Eluted dna	15-30 μ l NE are added, room temperature is placed 1 minute, and 11000g is centrifuged 1 minute, collects filtrate.

(2) with primer EF1 α-F and EF1 α-R using the SEQ ID NO.14 synthesized as template, using the system in table 3, PCR cycle condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 2min) * 35cycle, 72 DEG C of 10min.Product By 1.5% agarose gel electrophoresis, 1208bp fragment a is confirmed, and recovery of tapping rubber is placed in Eppendorf pipes, uses MN The Ago-Gel QIAquick Gel Extraction Kit of company reclaims corresponding fragment (being shown in Table 2), and determines the purity and concentration of product.

The μ L PCR reaction systems of table 3 50

Reagent	Volume (μ L)
		H2O	32.5
5×Buffer(with Mg2+)	10
		DNTP (each 2.5mM)	4
Primer1(+)(10μM)	1
		Primer2 (-) (10 μM)	1
Template	1
		PrimeSTAR	0.5

(3) with primer OCTS-F and OCTS-R using the OCTS123BCMAs synthesized as template, using the system in table 3, PCR cycle condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product By 1.5% agarose gel electrophoresis, 2357bp fragment b is confirmed, and recovery of tapping rubber is placed in Eppendorf pipes, uses MN The Ago-Gel QIAquick Gel Extraction Kit of company reclaims corresponding fragment (being shown in Table 2), and determines the purity and concentration of product；

(4) with primer OCTS-F and OCTS-R using the OCTS319BCMAs synthesized as template, using the system in table 3, PCR cycle condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product By 1.5% agarose gel electrophoresis, 2375bp fragment c is confirmed, and recovery of tapping rubber is placed in Eppendorf pipes, uses MN The Ago-Gel QIAquick Gel Extraction Kit of company reclaims corresponding fragment (being shown in Table 2), and determines the purity and concentration of product；

(5) system in table 3, PCR are used using the OCTS38BCMAs synthesized as template with primer OCTS-F and OCTS-R Cycling condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis is crossed, confirms 2378bp fragment d, and recovery of tapping rubber is placed in Eppendorf pipes, it is public with MN The Ago-Gel QIAquick Gel Extraction Kit of department reclaims corresponding fragment (being shown in Table 2), and determines the purity and concentration of product；

(6) with primer OCTS-F and OCTS-R using the OCTS-PDL1BCMAs synthesized as template, using the system in table 3, PCR cycle condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product By 1.5% agarose gel electrophoresis, 2372bp fragment e is confirmed, and recovery of tapping rubber is placed in Eppendorf pipes, uses MN The Ago-Gel QIAquick Gel Extraction Kit of company reclaims corresponding fragment (being shown in Table 2), and determines the purity and concentration of product；

(7) with primer OCTS-F and OCTS-R using the OCTS123BCMAt synthesized as template, using the system in table 3, PCR cycle condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product By 1.5% agarose gel electrophoresis, 2387bp fragment f is confirmed, and recovery of tapping rubber is placed in Eppendorf pipes, uses MN The Ago-Gel QIAquick Gel Extraction Kit of company reclaims corresponding fragment (being shown in Table 2), and determines the purity and concentration of product；

(8) with primer OCTS-F and OCTS-R using the OCTS319BCMAt synthesized as template, using the system in table 3, PCR cycle condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product By 1.5% agarose gel electrophoresis, 2403bp fragment g is confirmed, and recovery of tapping rubber is placed in Eppendorf pipes, uses MN The Ago-Gel QIAquick Gel Extraction Kit of company reclaims corresponding fragment (being shown in Table 2), and determines the purity and concentration of product；

(9) system in table 3, PCR are used using the OCTS38BCMAt synthesized as template with primer OCTS-F and OCTS-R Cycling condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis is crossed, confirms 2406bp fragment h, and recovery of tapping rubber is placed in Eppendorf pipes, it is public with MN The Ago-Gel QIAquick Gel Extraction Kit of department reclaims corresponding fragment (being shown in Table 2), and determines the purity and concentration of product；

(10) body in table 3 is used using the OCTS-PDL1BCMAt synthesized as template with primer OCTS-F and OCTS-R System, PCR cycle condition are：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min. Product passes through 1.5% agarose gel electrophoresis, confirms 2433bp fragment i, and recovery of tapping rubber is placed in Eppendorf pipes, Corresponding fragment (being shown in Table 2) is reclaimed with the Ago-Gel QIAquick Gel Extraction Kit of MN companies, and determines the purity and concentration of product；

(11) with primer I RES-F and IRES-R using the SEQ ID NO.12 synthesized as template, using the system in table 3, PCR cycle condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product By 1.5% agarose gel electrophoresis, 575bp fragment j is confirmed, and recovery of tapping rubber is placed in Eppendorf pipes, uses MN The Ago-Gel QIAquick Gel Extraction Kit of company reclaims corresponding fragment (being shown in Table 2), and determines the purity and concentration of product；

(12) with primer PDL1scab-F and PDL1scab-R using the SEQ ID NO.33 synthesized as template, using in table 3 System, PCR cycle condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C 5min.Product passes through 1.5% agarose gel electrophoresis, confirms 1557bp fragment k, and recovery of tapping rubber is placed in Eppendorf In pipe, corresponding fragment (being shown in Table 2) is reclaimed with the Ago-Gel QIAquick Gel Extraction Kits of MN companies, and determine product purity and Concentration；

(16) by recombinant slow virus DNA fragment combination (being shown in Table 4) with 5 μ l cumulative volumes and mol ratio 1:1:1:1 ratio Example is added in Eppendorf pipes, is added the μ l of homologous recombination enzyme reaction solution 15, is incubated 30 minutes at 42 DEG C after mixing, is transferred to ice Upper placement 2-3 minutes, reaction solution was added in 50 μ l TOP10, gently rotated to mix content, 30 points are placed in ice Clock, pipe is put into pre-heating heat shock 90 seconds into 42 DEG C of thermostat water bath, quickly pipe is transferred in ice bath, makes cell cold But 2-3 minutes, often pipe, is then transferred on 37 DEG C of shaking tables by pipe plus 900 μ l LB nutrient solutions, and incubating 1 hour makes bacteria resuscitation, Take 100 μ l transformed bacteria solution to be coated on Amp LB agar plates, be inverted plate, 37 DEG C of cultures in constant incubator, 16 is small When.

The recombinant slow virus DNA fragment combination of table 4

Recombinant slow virus plasmid	Fragment combination
		pOCTS123BCMAs	a、b、j、k
pOCTS319BCMAs	a、c、j、k
		pOCTS38BCMAs	a、d、j、k
pOCTS-PDL1BCMAs	a、e、j、k
		pOCTS123BCMAt	a、f、j、k
pOCTS319BCMAt	a、g、j、k
		pOCTS38BCMAt	a、h、j、k
pOCTS-PDL1BCMAt	a、i、j、k

Picked clones carry out bacterium colony PCR identifications, identify that correctly clone is recombinant slow virus plasmid pOCTS123BCMA s、pOCTS319BCMAs、pOCTS38BCMAs、pOCTS-PDL1BCMAs、 pOCTS123BCMAt、pOCTS319BCMAt、 POCTS38BCMAt, pOCTS-PDL1BCMAt, digestion identification (see Fig. 5) is carried out to correctly clone, and send sequencing review knot Fruit.

As shown in figure 5, A figures represent pOCTS123BCMAs digestion prognostic chart and digestion agarose gel electrophoresis figure. Lane1 is 1kb DNA ladder Marker digestion prognostic chart, and band is followed successively by from top to bottom：10kb、8kb、6kb、 5kb、 4kb、3.5kb、3kb、2.5kb、2kb、1.5kb、1kb、750bp、500bp、250bp；Lane2 is pOCTS123BCMAs BamH I digestions prediction, band is followed successively by from top to bottom：9712bp、1277bp、1023bp、511bp；Lane3 is 1kb DNA ladder Marker electrophoresis result；Lane4 is pOCTS123BCMAs BamH I restriction enzyme digestion and electrophoresis results.

B figures represent pOCTS319BCMAs digestion prognostic chart and digestion agarose gel electrophoresis figure.Lane1 is 1kb DNA Ladder Marker digestion prognostic chart, band are followed successively by from top to bottom：10kb、8kb、6kb、5kb、4kb、3.5kb、 3kb、 2.5kb、2kb、1.5kb、1kb、750bp、500bp、250bp；Lane2 is pOCTS319BCMAs ApaL I digestions prediction： Band is followed successively by from top to bottom：6543bp、1961bp、1723bp、1234bp、488bp；Lane3 is 1kb DNA ladder Marker electrophoresis result；Lane4 is pOCTS319BCMAs ApaL I restriction enzyme digestion and electrophoresis results.

C figures represent pOCTS38BCMAs digestion prognostic chart and digestion agarose gel electrophoresis figure.Lane1 is 1kb DNA Ladder Marker digestion prognostic chart, band are followed successively by from top to bottom：10kb、8kb、6kb、5kb、4kb、3.5kb、 3kb、 2.5kb、2kb、1.5kb、1kb、750bp、500bp、250bp；Lane2 be pOCTS38BCMAs BsrG I digestions prediction, bar Band is followed successively by from top to bottom：10928bp、1087bp；Lane3 is 1kb DNA ladder Marker electrophoresis result；lane4 It is pOCTS38BCMAs BsrG I restriction enzyme digestion and electrophoresis results.

D figures represent pOCTS-PDL1BCMAs digestion prognostic chart and digestion agarose gel electrophoresis figure.Lane1 is 1kb DNA ladder Marker digestion prognostic chart, band are followed successively by from top to bottom：10kb、8kb、6kb、5kb、4kb、 3.5kb、 3kb、2.5kb、2kb、1.5kb、1kb、750bp、500bp、250bp；Lane2 is pOCTS-PDL1BCMAs Cla I digestions Prediction, band are followed successively by from top to bottom：8876bp、3139bp；Lane3 is 1kb DNA ladder Marker electrophoresis knot Fruit；Lane4 is pOCTS-PDL1BCMAs Cla I restriction enzyme digestion and electrophoresis results.

E figures represent pOCTS123BCMAt digestion prognostic chart and digestion agarose gel electrophoresis figure.Lane1 is 1kb DNA Ladder Marker digestion prognostic chart, band are followed successively by from top to bottom：10kb、8kb、6kb、5kb、4kb、3.5kb、 3kb、 2.5kb、2kb、1.5kb、1kb、750bp、500bp、250bp；Lane2 is pOCTS123BCMAt BamH I digestions prediction：Bar Band is followed successively by from top to bottom：9545bp、1467bp、977bp；Lane3 is 1kb DNA ladder Marker electrophoresis result； Lane4 is pOCTS123BCMAt BamH I restriction enzyme digestion and electrophoresis results.

F figures represent pOCTS319BCMAt digestion prognostic chart and digestion agarose gel electrophoresis figure.Lane1 is 1kb DNA Ladder Marker digestion prognostic chart, band are followed successively by from top to bottom：10kb、8kb、6kb、5kb、4kb、3.5kb、 3kb、 2.5kb、2kb、1.5kb、1kb、750bp、500bp、250bp；Lane2 be pOCTS319BCMAt Nde I digestions prediction, bar Band is followed successively by from top to bottom：9686bp、2342bp；Lane3 is 1kb DNA ladder Marker electrophoresis result；lane4 It is pOCTS319BCMAt Nde I restriction enzyme digestion and electrophoresis results.

G figures represent pOCTS38BCMAt digestion prognostic chart and digestion agarose gel electrophoresis figure.Lane1 is 1kb DNA Ladder Marker digestion prognostic chart, band are followed successively by from top to bottom：10kb、8kb、6kb、5kb、4kb、3.5kb、 3kb、 2.5kb、2kb、1.5kb、1kb、750bp、500bp、250bp；Lane2 is pOCTS38BCMAt Spe I digestions prediction：Band It is followed successively by from top to bottom：9976bp、1926bp；Lane3 is 1kb DNA ladder Marker electrophoresis result；Lane4 is POCTS38BCMAt Spe I restriction enzyme digestion and electrophoresis results.

H figures represent pOCTS-PDL1BCMAt digestion prognostic chart and digestion agarose gel electrophoresis figure.Lane1 is 1kb DNA ladder Marker digestion prognostic chart, band are followed successively by from top to bottom：10kb、8kb、6kb、5kb、4kb、3.5kb、 3kb、2.5kb、2kb、1.5kb、1kb、750bp、500bp、250bp；Lane2 is pOCTS-PDL1BCMAt Pst I digestions Prediction, band are followed successively by from top to bottom：10821bp、1340bp、411bp；Lane3 is 1kb DNA ladder Marker electricity Swimming result；Lane4 is pOCTS-PDL1BCMAt Pst I restriction enzyme digestion and electrophoresis results.

From the electrophoresis result shown by Fig. 5, the restriction enzyme digestion and electrophoresis result of each recombinant slow virus plasmid to be measured and digestion are pre- Survey result is basically identical, and the construction method of above-mentioned recombinant slow virus plasmid is effective.

2nd, recombined lentivirus vector lvOCTS123BCMAs, lvOCTS319BCMAs, lvOCTS38BCMAs, lvOCTS- PDL1BCMAs, lvOCTS123BCMAt, lvOCTS319BCMAt, lvOCTS38BCMAt, lvOCTS-PDL1BCMAt packaging

2.1 solution allocation

(1) complete medium：Preheated fresh culture is taken out, adds 10%FBS+5ml Pen-Srep, up and down top Mix；

(2) 1XPBS solution：Weigh NaCl 8g, KCl 0.2, Na₂HPO₄.12H₂O 3.58g, KH₂PO4 0.24g are placed in In 1000ml beakers, the dissolving of 900ml Milli-Q grade ultra-pure waters is added, after the completion of dissolving, uses 1000ml graduated cylinder constant volumes To 1000ml, 121 DEG C of high-temperature heat sterilization 20min；

(3) 0.25%Trypsin solution:Trypsin 2.5g are weighed, EDTA0.19729g is placed in 1000ml beakers, added Enter 900ml 1XPBS dissolvings, after the completion of dissolving, 1000ml is settled to using 1000ml graduated cylinders, 0.22 μM of filtration sterilization, for a long time Using can preserve to -20 DEG C of refrigerators；

(4) 0.5M CaCl2 solution：Weigh 36.75g CaCl₂Dissolved with 400ml Milli-Q grade ultra-pure waters；With Cumulative volume is settled to 500ml by Milli-Q grade ultra-pure waters, is mixed；0.22 μm of filtration sterilization, packing are saved in 50ml centrifugations Guan Zhong, often pipe 45ml or so, 4 DEG C of preservations.

(5) 2XHBS solution：Weigh 4.09g NaCl, 0.269g Na₂HPO4,5.96g Hepes, with 400ml Milli- Q grade ultra-pure waters dissolve；After calibrating pH instrument, the pH of HBS solution is transferred to 7.05 with 2M NaOH solutions.Adjust every bottle of HBS PH consumption 2M NaOH be 3ml or so.

2.2HEK293T/17 cell culture

(1) the HEK293T/17 cells frozen are taken out from liquid nitrogen container, are quickly transferred in 37 DEG C of water-baths, after 1~2min It is transferred in super-clean bench, the liquid in cryopreservation tube is fully transferred to 10cm by sterile working²In culture dish, supply containing 10%FBS DMEM to 8mL/10cm²Micro- sem observation cell after dish, 24h, the degree of cell confluency are passed on more than 80%；

(2) select that cell state is good, free of contamination HEK293T/17 cells, be one group per 2-6 culture dish, will be carefully After the digestion of born of the same parents' pancreatin, 4-12ml complete mediums are drawn with electric pipettor, 2ml is added into each postdigestive culture dish, is kept away Exempt from culture dish exsiccation；All cells are blown and beaten into single cell suspension using 1ml pipettors, are transferred in medium bottle；

(3) remaining cell in above-mentioned 2-6 culture dish is transferred in medium bottle, and rinsed again with culture medium once Culture dish；

(4) culture medium bottle cap is covered tightly, turns upside down 10 times or so and fully mixes cell suspension, cell is passed to 8-24 10cm²In culture dish, the cell density per ware should about 4 × 10⁶Individual/10ml complete mediums or so.If cell density and pre- The difference of phase is larger, then needs to count cell, then according to 4 × 10⁶The amount inoculation of individual/ware；

(5) every 6 culture dishes arrange piles up for one, pays attention to keeping the cooperation between ware up and down.By culture dish or so, front and rear rolling Move for several times, cell is fully spread out, be then placed in 5%CO₂Incubator.Remaining cell does same processing；

(6) institute's passage cell is checked, cell confluency degree should be 70-80%, and profile is full, adherent good, is trained in cell Support and be uniformly distributed in ware；

(7) liquid is changed for cell, culture medium is replaced with into fresh complete medium, per ware 9ml, and by the CO of incubator₂It is dense Degree setting value brings up to 8%；

2.3 cell transfecting

(1) DNA/CaCl is matched somebody with somebody according to N+0.5₂Solution.Per ware HEK293T/17 cell transfecting plasmid amounts according to following ratio Use：Recombinant slow virus plasmid (20 μ g), pPac-GP (15 μ g), pPac-R (10 μ g), pEnv-G (7.5 μ g).Take one it is new 5ml centrifuge tubes, add 0.5M CaCl2：0.25ml, the μ g of recombinant slow virus plasmid 20：pPac-GP 15μg：pPac-R 10μg： The μ g of pEnv-G 7.5, supplement ultra-pure water to 0.5ml close the lid, and fully mix；

(2) it is another to take a 5ml centrifuge tube, add 0.5ml DNA/CaCl2 solution.Turbula shaker is opened, a hand is taken The firmly upper end of 5ml centrifuge tubes, ttom of pipe is contacted oscillating end, liquid is scattered on tube wall flowing, another hand is by one 1mL Liquid-transfering gun, 0.5mL 2 × HBS solution is drawn, is slowly added dropwise into centrifuge tube, coutroi velocity, being dripped off with half a minute is advisable. 2× After HBS is added, continue vibration 5 seconds, stop oscillation, can be directly added into the cell for needing to transfect；

(3) take a ware cell, the 1mL calcium in centrifuge tube is turned into drop adds, make as far as possible calcium turn reagent be distributed to it is whole In individual culture dish；

(4) after calcium turns liquid addition, covered in ware and carry out mark, culture dish is released to another 5%CO₂In incubator. Ensure that culture dish is horizontal positioned, often pile up culture dish and do not exceed 6.In 5%CO₂(6-8h) is placed in incubator；

(5) by the CO of first incubator₂Concentration set point adjusts back to 5%；

After (6) 24 hours, cell state is checked.Cell confluency degree should be 80-85% or so, in good condition.Will culture Base siphons away, and changes the fresh DMEM complete mediums of 10ml；

After (7) 48 hours, transfection efficiency is observed.Most cells are still adherent.It is it can be seen that thin more than 95% Born of the same parents can carry green fluorescence.Same virus is packed into supernatant collection to together, and continues addition 10mL into culture dish Fresh culture；

After (8) 72 hours, same vial supernatant is collected into the virus together, collected twice again can be placed on one Rise, abandon culture dish；Contained in the supernatant now collected recombined lentivirus vector lvOCTS123BCMAs, lvOCTS319BCMAs、lvOCTS38BCMAs、lvOCTS-PDL1BCMAs、lvOCTS123BCMAt、 lvOCTS319BCMAt、 lvOCTS38BCMAt、lvOCTS-PDL1BCMAt。

3rd, ion exchange chromatography recombined lentivirus vector

(1) supernatant of collection is used into Thermo vavuum pumps, filtered through 0.22 μm -0.8 μm of PES filters, except impurity elimination Matter；

(2) 1 is pressed:1~1:10 ratio is toward adding 1.5M NaCl 250mM Tris-HCl (pH 6-8) in supernatant；

(3) 2 ion exchange columns are placed in series, with 4ml 1M NaOH, 4ml 1M NaCl, 5ml 0.15M NaCl 25mM Tris-HCl (pH 6-8) solution crosses post successively；

(4) solution obtained in step 2 is given to ion exchange column loading by peristaltic pump with 1-10ml/min speed；

(5) after whole supernatants cross post, cleaned using 10ml 0.15M NaCl 25mM Tris-HCl (pH 6-8) solution One time；

(6) eluted according to applied sample amount using 1-5ml 1.5M NaCl 25mM Tris-HCl (pH 6-8), collection is washed De- liquid；

(7) eluent is divided into 25 to 50 μ L mono- to manage, freezes -80 DEG C of refrigerators, preserved for a long time.

4th, recombined lentivirus vector titer determination

(1) 24 orifice plates are taken to be inoculated with 293T cells.It is 5 × 10 per hole cell⁴Individual, added culture volume is 500ul, different The vitro growth rates of species difference, cell confluency when carrying out virus infection is 40%-60%；

(2) prepare 3 sterile EP pipes, 90ul fresh complete medium (DMEM in high glucose+10% is added in each pipe FBS) inoculating cell takes the cell in two holes to be counted with blood counting chamber after 24 hours, it is determined that infection when cell actual number Mesh, it is designated as N；

(3) take virus stock solution used 10ul to be determined to be added in first pipe, after gently mixing, take 10ul to be added to second In individual pipe, a to the last pipe is then operated successively；410ul complete medium (DMEM in high glucose+10% is added in every pipe ), FBS final volume 500ul；

(4) 20 hours after infection starts, culture supernatant is removed, is replaced by 500 μ l complete medium (DMEM in high glucose+10% FBS), 5%CO₂Continue culture 48 hours；

After (5) 72 hours, luciferase expression situation is observed, under normal circumstances, fluorecyte number increases and phase with extension rate It should reduce, and take pictures；

(6) the pancreas enzyme -EDTA solution digestion cells of 0.2ml 0.25% are used, are placed 1 minute at 37 DEG C.Purged with culture medium whole Individual cell face, is collected by centrifugation cell.Genomic DNA is extracted according to the explanation of DNeasy kits.Added in each sample cell 200 μ l eluents are washed lower DNA and quantified；

(7) preparing target DNA detection house steward qPCRmix I, (QPCR primer sequences are SEQ ID NO.42---SEQ ID NO.43)：

Component in table house steward 5qPCRmix I

2×TaqMan Master Mix	25μl×n
		Forward primer(100pmol ml-1)	0.1μl×n
Reverse primer(100pmol ml-1)	0.1μl×n
		Probe(100pmol ml-1)	0.1μl×n
H2O	19.7μl×n

N=number of reactions. are for example：Overall reaction number is 40, by 2 × TaqMan of 1ml Universal PCR Master Mix, 4 μ l forward primer, 4 μ l reverse primer, 4 μ l probe and 788 μ l H2O are mixed Be placed on ice after concussion.

(8) preparing internal reference DNA detection qPCRmix pipes II, (QPCR primer sequences are SEQ ID NO.44---SEQ ID NO.45)：

Component in house steward qPCRmix II of table 6

2×TaqMan Master Mix	25μl×n
		10×RNaseP primer/probe mix	2.5μl×n
H2O	17.5μl×n

N=number of reactions. are for example：Overall reaction number is 40, by 2 × TaqMan of 1ml Universal PCR Master Mix, 100 μ l 10 × RNaseP primer/probe mix and 700 μ l H₂O is mixed, and ice is placed on after concussion On.

(9) PCR system is completed in 96 hole PCR plates of precooling to establish.45 μ l are respectively taken to be added to each rows of A-D from house steward I Hole in, respectively take 45 μ l to be added in the hole of each rows of E-G from house steward II.

(10) 5 μ l plasmid standards and testing sample genomic DNA is taken to be added in A-D rows respectively, each sample repeats 1 It is secondary.It is another to stay the water that 1 hole adds 5 μ l as no template control (no-template control).

(11) 5 μ l genomes standard items and testing sample genomic DNA is taken to be added in E-G rows respectively, each sample weight It is multiple 1 time.It is another to stay the water that 1 hole adds 5 μ l as no template control (no-template control).

(12) it is the quantitative systems of ABI PRISM 7500 to use quantitative PCR apparatus.Cycling condition is set as：50 DEG C 2 minutes, 95 DEG C 10 minutes, followed by 95 DEG C 15 seconds, 60 DEG C of 40 of 1 minute circulations.

(13) data analysis：The slow virus carrier copy number integrated in the DNA sample measured is demarcated with genome number, Obtain the viral copy number of every genome conformity.

Titre (integration units per ml, IU ml^-1) calculation formula it is as follows：

IU ml^-1=(C × N × D × 1000)/V

Wherein：Viral copy numbers of the C=averagely per genome conformity

The number (about 1 × 10 of cell when N=infects⁵)

The extension rate of D=viral vectors

The volume number for the dilution virus that V=is added

Recombined lentivirus vector lvOCTS123BCMAs, lvOCTS319BCMAs, lvOCTS38BCMAs, lvOCTS- PDL1BCMAs, lvOCTS123BCMAt, lvOCTS319BCMAt, lvOCTS38BCMAt, lvOCTS-PDL1BCMAt titre As a result it is as shown in Figure 6.

2nd, OCTS-CAR-T cell constructions

Fig. 7 shows OCTS-CAR-T cell construction flows, the construction method of the OCTS-CAR-T cells in the present embodiment It is as follows：

1st, PBMC is separated.

(1) health donors fresh peripheral blood 50ml is extracted；

(2) blood taking bag spray is wiped into alcohol twice, and dried.

(3) haemocyte in bag is sucked out with 50ml syringes and moved in new 50ml pipes.

(4) 400g, 20 DEG C of centrifugation 10min.

(5) upper plasma is moved on in new 50ml centrifuge tubes, 56 DEG C, 30min inactivation blood plasma, recovered to room temperature, 2000g, 30min is centrifuged, takes supernatant stand-by into 50ml centrifuge tubes.

(6) mended with D-PBS (-) to 50ml, tighten lid, overturned and mix.

(7) 2 new 50ml centrifuge tubes are taken, often pipe adds 15ml Ficoll lymphocyte separation mediums.

(8) to being carefully added into haemocyte dilution 25ml on every pipe Ficoll.800g, 20 DEG C of centrifugation 20min.

(9) liquid is divided into four layers in centrifuge tube, is respectively from top to bottom：The plasma layer (recovery stand-by) of yellow, tunica albuginea layer, The Ficoll layers of water white transparency, the cell mixing layer of reddish black.

(10) tunica albuginea layer is carefully drawn into new 50ml centrifuge tubes, is added D-PBS (-) to 50ml, is overturned 500g after mixing, 20 DEG C of centrifugation 10min.

(11) human serum albumins of 25ml 5% are added and cell is resuspended, 400g, 20 DEG C of centrifugation 10min.

(12) supernatant is abandoned, the human serum albumins of 25ml 5% is added and cell precipitation is resuspended, and crosses 70um screen clothes, is counted.

(13) 1 part is taken to contain 1.25x10⁸Cells is used to activate；Remaining cell suspension 400g, 20 DEG C of centrifugation 10min, adds CryoPremium simultaneously freezes.

2nd, CD4/CD8 positive T cells sort.

(1) PBMC of acquisition is counted, with 80ul/10⁷Cells ratio adds sorting buffer solution, and cell precipitation is resuspended.

(2) again with 20ul/10⁷Cells ratio adds CD4/CD8 magnetic beads, and piping and druming is put into 4 DEG C after mixing and is incubated 15min。

(3) magnetic bead-cell mixture is taken out, with 2ml/10⁷Cells ratio adds sorting buffer solution, overturns after mixing, 250g, 4 DEG C of centrifugation 10min.

(4) with 500ul/10⁸Cells ratio adds sorting buffer solution, and cell precipitation is resuspended.

(5) LS splitters are gripped to magnetic frame with tweezers.

(6) while prepare 2 15ml centrifuge tubes, mark respectively：CD4-/CD8- cell liquid (A pipes), CD4+/CD8+ cells Liquid (B pipes).

(7) 3ml dissociating buffer rinse LS are used, and buffer solution is connect with A pipes.

(8) cell-magnetic bead mixed liquor is added, 3ml wash buffers pillar is added after dripping off (during each no liquid residual again Add new liquid), altogether three times, collection obtains CD4/CD8- cells.

(9) LS splitters separate with magnetic frame, connect cell suspension with B pipes, add 5ml buffer solutions, will and be filled in in pillar Slightly firmly rinse, be collected as CD4+/CD8+ cells, sampling counts.

(10) 1x10 is pressed⁶/ml-4x10⁶/ ml cell density AIM-V culture mediums resuspension cell precipitation, and addition 2 × 10⁵~1 × 10⁶The U/L IFN-γ factors.

3rd, t cell activation.

(1) the previous day is carried by 1 × 10³Ug/L~1 × 10⁴Ug/L CD3 monoclonal antibodies and 1 × 10³Ug/L~1 × 10⁴Ug/L CD28 monoclonal antibodies add 24 orifice plates, and sealed membrane sealing, 4 DEG C are coated with overnight；

(2) coated T75 bottles are taken out, coating buffer is outwelled, washed once with D-PBS (-), and obtained cell will be sorted Suspension is inoculated into T75 bottles, is shaken up, and is put into 37 DEG C, 5%CO₂Cultivated in incubator.

4th, CAR gene transfers and OCTS-CAR-T cell induction cultures.

(1) the previous day coating 1 × 10 is put forward³Ug/L~1 × 10⁴In in 24 orifice plates, sealed membrane seals ug/L RetroNectin Mouthful, 4 DEG C are coated with overnight.

(2) toward in 24 orifice plates, according to every hole 5 × 10⁵Cell concentration, by the amount of MOI=5~20, it is separately added into lvOCTS123BCMAs、lvOCTS319BCMAs、lvOCTS38BCMAs、lvOCTS-PDL1BCMAs、 lvOCTS123BCMAt、 LvOCTS319BCMAt, lvOCTS38BCMAt, lvOCTS-PDL1BCMAt slow virus transgene carrier, while add containing 2 × 10⁵~5 × 10⁵U/L rIL-2,5 × 10³Ng/L~1 × 10⁴Ng/L rIL-7,5 × 10³Ng/L~1 × 10⁴ng/L rIL- 15,5 × 10³Ng/L~1 × 10⁴Ng/L rIL-21 and 37 DEG C of AIM-V culture mediums, 5%CO containing 10% autoserum₂Continue Culture.

5th, OCTS-CAR-T cell expansion ex vivos.

(1) every 2 days equivalent is added containing 2 × 10⁵~5 × 10⁵U/L rIL-2,5 × 10³Ng/L~1 × 10⁴ng/L rIL- 7,5 × 10³Ng/L~1 × 10⁴Ng/L rIL-15,5 × 10³Ng/L~1 × 10⁴Ng/L rIL-21 and containing 10% autoserum AIM-V culture mediums, make between pH value maintains 6.5~7.5, cell density maintains 5 × 10⁵~2 × 10⁶Between/ml, 37 DEG C, 5%CO₂Continue culture 10-14 days.

(2) the 7th days or so, the OCTS-CAR-T cells for freezing culture were used for subsequent detection.

Embodiment 2OCTS-CAR-T cells Pathogen test and detection of expression

First, endotoxin detects；

(1) endotoxin working standard is 15EU/ branch；

(2) sensitivity of the limulus reagent λ=0.25EU/ml, 0.5ml/ are managed

(3) endotoxin standard dilutes：Endotoxin standard one is taken, is diluted to 4 λ and 2 λ in proportion with BET water respectively Dissolving, sealed membrane sealing, concussion dissolving 15min；A step is often diluted during dilution all should mix 30s on eddy mixer；

(4) it is loaded：If taking the TAL Heavenly Stems and Earthly Branches, every adds BET water 0.5ml dissolvings, and as Heavenly Stems and Earthly Branches endotoxin-free is tried for packing Guan Zhong, often pipe 0.1ml.Wherein 2 are negative control pipe, add BET water 0.1ml；2 are positive control pipe, and it is dense to add 2 λ The endotoxin working standard solution 0.1ml of degree；2 are Sample Positive control tube, add 0.1ml and contain 2 λ endotoxin standards Sample solution (the testing sample 1ml+4 λ endotoxin standard solution 1ml=2ml of 20 times of dilution contains 2 λ endotoxin standards 40 times of samples of dilution).

Add 0.1mL samples in sample cell, dilution ratio be shown in Table 7,37 ± 1 DEG C of water-baths (or incubator) insulation 60 ± 1min；

The endotoxin testing result of the endotoxin dilution ratio of table 7 and OCTS-CAR-T cells

As shown in table 7, the endotoxin content of all cells is respectively less than 2.5EU/ml, meets《Pharmacopoeia of People's Republic of China》 In be less than 10EU/ml standard.

2nd, detection of mycoplasma

(1) first three day is being tested, cell sample is cultivated with antibiotic-free culture medium；

(2) (cell number is more than 1 × 10 to collection 1mL cell suspending liquids⁵), it is placed in 1.5mL centrifuge tubes；

(3) 13000g centrifuges 1min, collects precipitation, discards culture medium；

(4) 500ul PBS pipette tips pressure-vaccum or vortex oscillation are added, precipitation is resuspended.13000g centrifuges 5min；

(5) step 4 is repeated once；

(6) 50 μ l Cell Lysis Buffer are added, with pipette tips pressure-vaccum, after fully mixing, are incubated in 55 DEG C of water-baths 20min；

(7) sample is placed in 95 DEG C and heats 5min；

(8) after 13000g centrifuges 5min, the 5 μ l supernatants are taken to be as template, 25 μ l PCR reaction systems：ddH20 6.5μl、 The μ l of Myco Mix 1,2x Taq Plus Mix Master (Dye Plus) 12.5 μ l, the μ l of template 5；PCR cycle condition is：95 DEG C 30sec, (95 DEG C of 30sec, 56 DEG C of 30sec, 72 DEG C of 30sec) * 30cycle, 72 DEG C of 5min.

Detection of mycoplasma result shown see Fig. 8, the judgement explanation of positive control, negative control and sample in Fig. 8 It is shown in Table 8.As shown in Fig. 8 results, mycoplasma is free of in OCTS-CAR-T cells.

The judgement explanation of the positive control of table 8, negative control and sample

3rd, the detection of OCTS gene transduction efficiencies and immunophenotyping detection；

(1) T cell after viral transduction is collected, cell is resuspended with D-PBS (-) solution containing 1~4% human serum albumin And it is adjusted to 1 × 10⁶/ml。

(2) D-PBS (-) solution 1ml containing 1~4% human serum albumin is added into centrifuge tube and is mixed, 350g centrifugations 5min, abandon supernatant.

(3) repeat step 2 is once.

(4) cell is resuspended with 0.2ml D-PBS (-) solution containing 1~4% human serum albumin, and is added into centrifuge tube 1ul 1mg/ul protein L, 5ul CD4-FITC, 5ul CD8-APC, mix, 4 DEG C of incubation 45min.

(5) D-PBS (-) solution of the 1ml containing 1~4% human serum albumin is added into centrifuge tube and is mixed, 350g centrifugations 5min, abandon supernatant.

(6) repeat step 5 is twice.

(7) cell is resuspended with D-PBS (-) solution of 0.2ml containing 1~4% human serum albumin, and is added into centrifuge tube 0.2ul PE-SA, mix, 37 DEG C of lucifuges are incubated 15min.

(8) add D-PBS (-) solution of 1ml containing 1~4% human serum albumin into centrifuge tube to weigh and mix, 350g centrifugations 5min, abandon supernatant.

(9) cell precipitation is resuspended with 1ml D-PBS (-) solution, 350g centrifugation 5min, abandons supernatant.

(10) repeat step 9 is twice.

(11) cell precipitation is resuspended with 0.4ml D-PBS (-) solution, flow cytometer is detected.

OCTS gene transduction efficiencies and immunophenotyping test result are as shown in figure 9, the OCTS-CAR-T cells prepared Most of efficiency of infection between 37%~50%, the ratio of CD4 positive cells and CD8 positive cells is located at 1: 3~3: 1 Between, follow-up function detection can be carried out.

The Function detection of embodiment 3OCTS-CAR-T cells

First, target cell fragmentation effect is assessed.

(1) target cell [BCMA is cultivated respectively⁺K562、CD319⁺K562、CD38⁺K562、PDL1⁺K562、 CD123⁺K562、 BCMA⁺CD123⁺K562、BCMA⁺CD319⁺K562、BCMA⁺CD38⁺K562、 BCMA⁺PDL1⁺K562, K562 cell] and effect it is thin Born of the same parents' [OCTS-CAR-T cells], the packet that effector cell is incubated altogether with single target cell and double target cells respectively are as shown in table 9.

The group list that the effector cell of table 9 is incubated altogether with single target cell and double target cells respectively

Effector cell	Target cell 1	Target cell 2	Target cell 3
				OCTS123BCMAs-CAR-T	CD123+K562	BCMA+K562	BCMA+CD123+K562
OCTS319BCMAs-CAR-T	CD319+K562	BCMA+K562	BMCA+CD319+K562
				OCTS38BCMAs-CAR-T	CD38+K562	BCMA+K562	BCMA+CD38+K562
OCTS-PDLlBCMAs-CAR-T	PDL1+K562	BCMA+K562	BCMA+PDL1+K562
				OCTS123BCMAt-CAR-T	CD123+K562	BCMA+K562	BCMA+CD123+K562
OCTS319BCMAt-CAR-T	CD319+K562	BCMA+K562	BMCA+CD319+K562
				OCTS38BCMAt-CAR-T	CD38+K562	BCMA+K562	BCMA+CD38+K562
OCTS-PDL1BCMAt-CAR-T	PDL1+K562	BCMA+K562	BCMA+PDL1+K562

(2) target cell 4x10 is collected⁵Cells and OCTS-CAR-T cells 2.8x10⁶Cells, 800g, 6min are centrifuged, and are abandoned Supernatant；

(3) target cell and effector cell are resuspended respectively with 1ml D-PBS (-) solution, 800g, 6min centrifugation, abandon supernatant；

(4) repeat step 3 is once；

(5) effector cell is resuspended with 700ul culture mediums (+1~10%FBS of AIM-V culture mediums), with 2ml culture mediums (AIM- + 1~10%FBS of V culture mediums) target cell is resuspended；

(6) it is 1 to set effect target ratio:1、5:1、10:1 experimental port, packet situation is as shown in table 9, and sets control group (K562 cells), every group of 3 multiple holes；

(7) 250g, 5min flat board centrifuge；

(8) 37 DEG C, cultivated 4 hours in 5%CO2 incubators；

(9) 250g, 5min flat board centrifuge；

(10) the 50ul supernatants in each hole are taken into new 96 orifice plate, and 50ul substrate solutions (lucifuge behaviour is added per hole Make)；

(11) lucifuge is incubated 25min；

(12) 50ul terminate liquids are added per hole；

(13) ELIASA detection 490nm absorbances；

(14) 3 multiple holes are averaged；The light absorption value of all experimental ports, Target cell wells and effector cell hole is subtracted into training Support the average of base background light absorption value；The light absorption value of target cell maximum is subtracted to the average of volume correction control light absorption value.

(15) bring the corrected value obtained in step 14 into formula below, calculate thin caused by each effect target ratio Cellular toxicity percentage.

Killing-efficiency=(experimental port-effector cell hole-Target cell wells)/(target cell largest hole-Target cell wells) × 100%

As a result as shown in Figure 10, OCTS-CAR-T has preferably killing effect to respective single target cell and double target cells Fruit, the CAR-T that the CAR-T cells of Turn OCTS structures are slightly above Series OCTS structures to the killing-efficiency of target cell are thin Born of the same parents.

It is above-mentioned test result indicates that, by traditional CAR structures antigen recognizing district transformation formed OCTS structures, OCTS-CAR-T cell recognitions can be significantly improved and kill the scope of target cell, therefore OCTS-CAR-T cells will be in future The double positives of the BCMA positives/CD319 positives/CD38 positives/CD123 positives/PDL1 positives/BCMA, CD319/BCMA, CD38 In the cell therapies of malignant tumour such as the double positives of double positives/BCMA, CD123/double positive Huppert's diseases of BCMA, PDL1 Play huge effect.

General principle, principal character and the advantages of the present invention of the present invention has been shown and described above.The technology of the industry Personnel are it should be appreciated that the present invention is not limited to the above embodiments, and the simply explanation described in above-described embodiment and specification is originally The principle of invention, various changes and modifications of the present invention are possible without departing from the spirit and scope of the present invention, these changes Change and improvement all fall within the protetion scope of the claimed invention.The claimed scope of the invention by appended claims and Its equivalent defines.

SEQUENCE LISTING

<110>Shanghai You Kadi biological medicines Science and Technology Ltd.

<120>The double targeting Chimeric antigen receptors of OCTS-CAR, encoding gene, recombinant expression carrier and its structure and application

<130>Claims specification

<160> 45

<170> PatentIn version 3.5

<210> 1

<211> 837

<212> DNA

<213>Artificial sequence

<400> 1

atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct 60

gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca 120

cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc 180

gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc 240

cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg 300

gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta 360

tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc 420

ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt 480

gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg 540

cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctatcc 600

cggcaacaat taatagactg gatggaggcg gataaagttg caggaccact tctgcgctcg 660

gcccttccgg ctggctggtt tattgctgat aaatctggag ccggtgagcg tgggtctcgc 720

ggtatcattg cagcactggg gccagatggt aagccctccc gtatcgtagt tatctacacg 780

acggggagtc aggcaactat ggatgaacga aatagacaga tcgctgagat aggtgcc 837

<210> 2

<211> 674

<212> DNA

<213>Artificial sequence

<400> 2

cccgtagaaa agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc 60

ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca 120

actctttttc cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgtccttcta 180

gtgtagccgt agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct 240

ctgctaatcc tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg 300

gactcaagac gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc 360

acacagccca gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta 420

tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg 480

gtcggaacag gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt 540

cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg 600

cggagcctat ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg 660

ccttttgctc acat 674

<210> 3

<211> 147

<212> DNA

<213>Artificial sequence

<400> 3

atcccgcccc taactccgcc cagttccgcc cattctccgc cccatggctg actaattttt 60

tttatttatg cagaggccga ggccgcctcg gcctctgagc tattccagaa gtagtgagga 120

ggcttttttg gaggcctaga cttttgc 147

<210> 4

<211> 228

<212> DNA

<213>Artificial sequence

<400> 4

gtagtcttat gcaatactct tgtagtcttg caacatggta acgatgagtt agcaacatgc 60

cttacaagga gagaaaaagc accgtgcatg ccgattggtg gaagtaaggt ggtacgatcg 120

tgccttatta ggaaggcaac agacgggtct gacatggatt ggacgaacca ctgaattgcc 180

gcattgcaga gatattgtat ttaagtgcct agctcgatac aataaacg 228

<210> 5

<211> 180

<212> DNA

<213>Artificial sequence

<400> 5

ggtctctctg gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac 60

tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt 120

gtgactctgg taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca 180

<210> 6

<211> 234

<212> DNA

<213>Artificial sequence

<400> 6

tgctagagat tttccacact gactaaaagg gtctgaggga tctctagtta ccagagtcac 60

acaacagacg ggcacacact acttgaagca ctcaaggcaa gctttattga ggcttaagca 120

gtgggttccc tagttagcca gagagctccc aggctcagat ctggtctaac cagagagacc 180

cagtacaagc aaaaagcaga tcttattttc gttgggagtg aattagccct tcca 234

<210> 7

<211> 353

<212> DNA

<213>Artificial sequence

<400> 7

atgggtgcga gagcgtcagt attaagcggg ggagaattag atcgcgatgg gaaaaaattc 60

ggttaaggcc agggggaaag aaaaaatata aattaaaaca tatagtatgg gcaagcaggg 120

agctagaacg attcgcagtt aatcctggcc tgttagaaac atcagaaggc tgtagacaaa 180

tactgggaca gctacaacca tcccttcaga caggatcaga agaacttaga tcattatata 240

atacagtagc aaccctctat tgtgtgcatc aaaggataga gataaaagac accaaggaag 300

ctttagacaa gatagaggaa gagcaaaaca aaagtaagac caccgcacag caa 353

<210> 8

<211> 233

<212> DNA

<213>Artificial sequence

<400> 8

aggagctttg ttccttgggt tcttgggagc agcaggaagc actatgggcg cagcctcaat 60

gacgctgacg gtacaggcca gacaattatt gtctggtata gtgcagcagc agaacaattt 120

gctgagggct attgaggcgc aacagcatct gttgcaactc acagtctggg gcatcaagca 180

gctccaggca agaatcctgg ctgtggaaag atacctaaag gatcaacagc tcc 233

<210> 9

<211> 489

<212> DNA

<213>Artificial sequence

<400> 9

tggggatttg gggttgctct ggaaaactca tttgcaccac tgctgtgcct tggaatgcta 60

gttggagtaa taaatctctg gaacagattg gaatcacacg acctggatgg agtgggacag 120

agaaattaac aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca 180

agaaaagaat gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt 240

taacataaca aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt 300

aggtttaaga atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc 360

accattatcg tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat 420

agaagaagaa ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg 480

acggttaac 489

<210> 10

<211> 119

<212> DNA

<213>Artificial sequence

<400> 10

ttttaaaaga aaagggggga ttggggggta cagtgcaggg gaaagaatag tagacataat 60

agcaacagac atacaaacta aagaattaca aaaacaaatt acaaaaattc aaaatttta 119

<210> 11

<211> 696

<212> DNA

<213>Artificial sequence

<400> 11

atggcccagt ccaagcacgg cctgaccaag gagatgacca tgaagtaccg catggagggc 60

tgcgtggacg gccacaagtt cgtgatcacc ggcgagggca tcggctaccc cttcaagggc 120

aagcaggcca tcaacctgtg cgtggtggag ggcggcccct tgcccttcgc cgaggacatc 180

ttgtccgccg ccttcatgta cggcaaccgc gtgttcaccg agtaccccca ggacatcgtc 240

gactacttca agaactcctg ccccgccggc tacacctggg accgctcctt cctgttcgag 300

gacggcgccg tgtgcatctg caacgccgac atcaccgtga gcgtggagga gaactgcatg 360

taccacgagt ccaagttcta cggcgtgaac ttccccgccg acggccccgt gatgaagaag 420

atgaccgaca actgggagcc ctcctgcgag aagatcatcc ccgtgcccaa gcagggcatc 480

ttgaagggcg acgtgagcat gtacctgctg ctgaaggacg gtggccgctt gcgctgccag 540

ttcgacaccg tgtacaaggc caagtccgtg ccccgcaaga tgcccgactg gcacttcatc 600

cagcacaagc tgacccgcga ggaccgcagc gacgccaaga accagaagtg gcacctgacc 660

gagcacgcca tcgcctccgg ctccgccttg ccctga 696

<210> 12

<211> 575

<212> DNA

<213>Artificial sequence

<400> 12

gcccctctcc ctcccccccc cctaacgtta ctggccgaag ccgcttggaa taaggccggt 60

gtgcgtttgt ctatatgtta ttttccacca tattgccgtc ttttggcaat gtgagggccc 120

ggaaacctgg ccctgtcttc ttgacgagca ttcctagggg tctttcccct ctcgccaaag 180

gaatgcaagg tctgttgaat gtcgtgaagg aagcagttcc tctggaagct tcttgaagac 240

aaacaacgtc tgtagcgacc ctttgcaggc agcggaaccc cccacctggc gacaggtgcc 300

tctgcggcca aaagccacgt gtataagata cacctgcaaa ggcggcacaa ccccagtgcc 360

acgttgtgag ttggatagtt gtggaaagag tcaaatggct cacctcaagc gtattcaaca 420

aggggctgaa ggatgcccag aaggtacccc attgtatggg atctgatctg gggcctcggt 480

gcacatgctt tacatgtgtt tagtcgaggt taaaaaacgt ctaggccccc cgaaccacgg 540

ggacgtggtt ttcctttgaa aaacacgatg ataat 575

<210> 13

<211> 592

<212> DNA

<213>Artificial sequence

<400> 13

aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct 60

ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt 120

atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg 180

tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc aacccccact 240

ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct 300

attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg ggctcggctg 360

ttgggcactg acaattccgt ggtgttgtcg gggaaatcat cgtcctttcc ttggctgctc 420

gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc 480

aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt 540

cgccttcgcc ctcagacgag tcggatctcc ctttgggccg cctccccgcc tg 592

<210> 14

<211> 1178

<212> DNA

<213>Artificial sequence

<400> 14

gctccggtgc ccgtcagtgg gcagagcgca catcgcccac agtccccgag aagttggggg 60

gaggggtcgg caattgaacc ggtgcctaga gaaggtggcg cggggtaaac tgggaaagtg 120

atgtcgtgta ctggctccgc ctttttcccg agggtggggg agaaccgtat ataagtgcag 180

tagtcgccgt gaacgttctt tttcgcaacg ggtttgccgc cagaacacag gtaagtgccg 240

tgtgtggttc ccgcgggcct ggcctcttta cgggttatgg cccttgcgtg ccttgaatta 300

cttccacctg gctgcagtac gtgattcttg atcccgagct tcgggttgga agtgggtggg 360

agagttcgag gccttgcgct taaggagccc cttcgcctcg tgcttgagtt gaggcctggc 420

ctgggcgctg gggccgccgc gtgcgaatct ggtggcacct tcgcgcctgt ctcgctgctt 480

tcgataagtc tctagccatt taaaattttt gatgacctgc tgcgacgctt tttttctggc 540

aagatagtct tgtaaatgcg ggccaagatc tgcacactgg tatttcggtt tttggggccg 600

cgggcggcga cggggcccgt gcgtcccagc gcacatgttc ggcgaggcgg ggcctgcgag 660

cgcggccacc gagaatcgga cgggggtagt ctcaagctgg ccggcctgct ctggtgcctg 720

gcctcgcgcc gccgtgtatc gccccgccct gggcggcaag gctggcccgg tcggcaccag 780

ttgcgtgagc ggaaagatgg ccgcttcccg gccctgctgc agggagctca aaatggagga 840

cgcggcgctc gggagagcgg gcgggtgagt cacccacaca aaggaaaagg gcctttccgt 900

cctcagccgt cgcttcatgt gactccactg agtaccgggc gccgtccagg cacctcgatt 960

agttctcgag cttttggagt acgtcgtctt taggttgggg ggaggggttt tatgcgatgg 1020

agtttcccca cactgagtgg gtggagactg aagttaggcc agcttggcac ttgatgtaat 1080

tctccttgga atttgccctt tttgagtttg gatcttggtt cattctcaag cctcagacag 1140

tggttcaaag tttttttctt ccatttcagg tgtcgtga 1178

<210> 15

<211> 63

<212> DNA

<213>Artificial sequence

<400> 15

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccg 63

<210> 16

<211> 333

<212> DNA

<213>Artificial sequence

<400> 16

gatattgtgc tgacccagag cccgccgagc ctggcgatga gcctgggcaa acgcgcgacc 60

attagctgcc gcgcgagcga aagcgtgacc attctgggca gccatctgat tcattggtat 120

cagcagaaac cgggccagcc gccgaccctg ctgattcagc tggcgagcaa cgtgcagacc 180

ggcgtgccgg cgcgctttag cggcagcggc agccgcaccg attttaccct gaccattgat 240

ccggtggaag aagatgatgt ggcggtgtat tattgcctgc agagccgcac cattccgcgc 300

acctttggcg gcggcaccaa actggaaatt aaa 333

<210> 17

<211> 351

<212> DNA

<213>Artificial sequence

<400> 17

cagattcagc tggtgcagag cggcccggaa ctgaaaaaac cgggcgaaac cgtgaaaatt 60

agctgcaaag cgagcggcta tacctttacc gattatagca ttaactgggt gaaacgcgcg 120

ccgggcaaag gcctgaaatg gatgggctgg attaacaccg aaacccgcga accggcgtat 180

gcgtatgatt ttcgcggccg ctttgcgttt agcctggaaa ccagcgcgag caccgcgtat 240

ctgcagatta acaacctgaa atatgaagat accgcgacct atttttgcgc gctggattat 300

agctatgcga tggattattg gggccagggc accagcgtga ccgtgagcag c 351

<210> 18

<211> 324

<212> DNA

<213>Artificial sequence

<400> 18

gatattcaga tgacccagag cccgagcagc ctgagcgcga gcgtgggcga tcgcgtgacc 60

attacctgca aagcgagcca ggatgtgggc attgcggtgg cgtggtatca gcagaaaccg 120

ggcaaagtgc cgaaactgct gatttattgg gcgagcaccc gccataccgg cgtgccggat 180

cgctttagcg gcagcggcag cggcaccgat tttaccctga ccattagcag cctgcagccg 240

gaagatgtgg cgacctatta ttgccagcag tatagcagct atccgtatac ctttggccag 300

ggcaccaaag tggaaattaa acgc 324

<210> 19

<211> 357

<212> DNA

<213>Artificial sequence

<400> 19

gaagtgcagc tggtggaaag cggcggcggc ctggtgcagc cgggcggcag cctgcgcctg 60

agctgcgcgg cgagcggctt tgattttagc cgctattgga tgagctgggt gcgccaggcg 120

ccgggcaaag gcctggaatg gattggcgaa attaacccgg atagcagcac cattaactat 180

gcgccgagcc tgaaagataa atttattatt agccgcgata acgcgaaaaa cagcctgtat 240

ctgcagatga acagcctgcg cgcggaagat accgcggtgt attattgcgc gcgcccggat 300

ggcaactatt ggtattttga tgtgtggggc cagggcaccc tggtgaccgt gagcagc 357

<210> 20

<211> 321

<212> DNA

<213>Artificial sequence

<400> 20

gaaattgtgt tgacacagtc tccagccacc ctgtctttgt ctccagggga aagagccacc 60

ctctcctgca gggccagtca gagtgttagc agctacttag cctggtacca acagaaacct 120

ggccaggctc ccaggctcct catctatgat gcatccaaca gggccactgg catcccagcc 180

aggttcagtg gcagtgggtc tgggacagac ttcactctca ccatcagcag cctagagcct 240

gaagattttg cagtttatta ctgtcagcag cgtagcaact ggcctccgac gttcggccaa 300

gggaccaagg tggaaatcaa a 321

<210> 21

<211> 366

<212> DNA

<213>Artificial sequence

<400> 21

gaagtgcagc tgctggaaag cggcggcggc ctggtgcagc cgggcggcag cctgcgcctg 60

agctgcgcgg tgagcggctt tacctttaac agctttgcga tgagctgggt gcgccaggcg 120

ccgggcaaag gcctggaatg ggtgagcgcg attagcggca gcggcggcgg cacctattat 180

gcggatagcg tgaaaggccg ctttaccatt agccgcgata acagcaaaaa caccctgtat 240

ctgcagatga acagcctgcg cgcggaagat accgcggtgt atttttgcgc gaaagataaa 300

attctgtggt ttggcgaacc ggtgtttgat tattggggcc agggcaccct ggtgaccgtg 360

agcagc 366

<210> 22

<211> 333

<212> DNA

<213>Artificial sequence

<400> 22

gatattgtgc tgacccagag cccggcgagc ctggcggtga gcccgggcca gcgcgcgacc 60

attacctgcc gcgcgagcca gagcgtgagc accagcagca gcagctttat gcattggtat 120

cagcagaaac cgggccagcc gccgaaactg ctgattaaat atgcgagcaa cctggaaagc 180

ggcgtgccgg cgcgctttag cggcagcggc agcggcaccg attttaccct gaccattaac 240

ccggtggaag cgaacgatac cgcgaactat tattgccagc atagctggga aattccgtat 300

acctttggcc agggcaccaa actggaaatt aaa 333

<210> 23

<211> 348

<212> DNA

<213>Artificial sequence

<400> 23

gaagtgcagc tggtggaaag cggcggcggc ctggtgaaac cgggcggcag cctgcgcctg 60

agctgcgcgg cgagcggctt tatttttcgc agctatggca tgagctgggt gcgccaggcg 120

ccgggcaaag gcctggaatg ggtggcgagc attagcagcg gcggcagcac ctattatccg 180

gatagcgtga aaggccgctt taccattagc cgcgataacg cgaaaaacag cctgtatctg 240

cagatgaaca gcctgcgcgc ggaagatacc gcggtgtatg attgcgcgcg cggctatgat 300

agcggctttg cgtattgggg ccagggcacc ctggtgaccg tgagcagc 348

<210> 24

<211> 324

<212> DNA

<213>Artificial sequence

<400> 24

gatattgtga tgacccagag cccgagcagc gtgagcgcga gcgtgggcga tcgcgtgacc 60

attacctgcc gcgcgagcca gaacgtggat agcgcggtgg cgtggtatca gcagaaaccg 120

ggcaaagcgc cgaaagcgct gatttatagc gcgagctatc gctatagcgg cgtgccgagc 180

cgctttagcg gccgcggcag cggcaccgat tttaccctga ccattagcag cctgcagccg 240

gaagattttg cgacctatta ttgccagcag tattatagca ccccgtggac ctttggccag 300

ggcaccaaag tggaaattaa acgc 324

<210> 25

<211> 381

<212> DNA

<213>Artificial sequence

<400> 25

gaagtgaaac tggtggaaag cggcggcggc ctggtgcagc cgggccgcag cctgcgcctg 60

agctgcaccg cgagcggctt tacctttacc gattattata tgagctgggt gcgccaggcg 120

ccgggcaaag gcctggaatg ggtgggcctg attcgcagca aagcggatgg ctataccacc 180

gaatatagcg cgagcgtgaa aggccgcttt accattagcc gcgatgatag caaaagcatt 240

ctgtatctgc agatgaacag cctgaaaacc gaagataccg cggtgtatta ttgcgcgcgc 300

gatgcggcgt attatagcta ttatagcccg gaaggcgcga tggattattg gggccagggc 360

accctggtga ccgtgagcag c 381

<210> 26

<211> 45

<212> DNA

<213>Artificial sequence

<400> 26

ggtggcggtg gctcgggcgg tggtgggtcg ggtggcggcg gatct 45

<210> 27

<211> 57

<212> DNA

<213>Artificial sequence

<400> 27

gcctccacca agggcccatc tgtcttcccc ctggccccca gctcctctgg ctccgga 57

<210> 28

<211> 141

<212> DNA

<213>Artificial sequence

<400> 28

accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg 60

tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg 120

gacttcgcct gtgatatcta c 141

<210> 29

<211> 66

<212> DNA

<213>Artificial sequence

<400> 29

atctgggcgc ccttggccgg gacttgtggg gtccttctcc tgtcactggt tatcaccctt 60

tactgc 66

<210> 30

<211> 123

<212> DNA

<213>Artificial sequence

<400> 30

aggagtaaga ggagcaggct cctgcacagt gactacatga acatgactcc ccgccgcccc 60

gggcccaccc gcaagcatta ccagccctat gccccaccac gcgacttcgc agcctatcgc 120

tcc 123

<210> 31

<211> 111

<212> DNA

<213>Artificial sequence

<400> 31

cgccgcgatc agcgcctgcc gccggatgcg cataaaccgc cgggcggcgg cagctttcgc 60

accccgattc aggaagaaca ggcggatgcg catagcaccc tggcgaaaat t 111

<210> 32

<211> 336

<212> DNA

<213>Artificial sequence

<400> 32

cgcgtgaaat ttagccgcag cgcggatgcg ccggcgtatc agcagggcca gaaccagctg 60

tataacgaac tgaacctggg ccgccgcgaa gaatatgatg tgctggataa acgccgcggc 120

cgcgatccgg aaatgggcgg caaaccgcgc cgcaaaaacc cgcaggaagg cctgtataac 180

gaactgcaga aagataaaat ggcggaagcg tatagcgaaa ttggcatgaa aggcgaacgc 240

cgccgcggca aaggccatga tggcctgtat cagggcctga gcaccgcgac caaagatacc 300

tatgatgcgc tgcatatgca ggcgctgccg ccgcgc 336

<210> 33

<211> 1557

<212> DNA

<213>Artificial sequence

<400> 33

atgaactcct tctccacaag cgccttcggt ccagttgcct tctccctggg gctgctcctg 60

gtgttgcctg ctgccttccc tgccccagat attgtgctga cccagagccc ggcgagcctg 120

gcggtgagcc cgggccagcg cgcgaccatt acctgccgcg cgagccagag cgtgagcacc 180

agcagcagca gctttatgca ttggtatcag cagaaaccgg gccagccgcc gaaactgctg 240

attaaatatg cgagcaacct ggaaagcggc gtgccggcgc gctttagcgg cagcggcagc 300

ggcaccgatt ttaccctgac cattaacccg gtggaagcga acgataccgc gaactattat 360

tgccagcata gctgggaaat tccgtatacc tttggccagg gcaccaaact ggaaattaaa 420

ggtggcggtg gctcgggcgg tggtgggtcg ggtggcggcg gatctgaagt gcagctggtg 480

gaaagcggcg gcggcctggt gaaaccgggc ggcagcctgc gcctgagctg cgcggcgagc 540

ggctttattt ttcgcagcta tggcatgagc tgggtgcgcc aggcgccggg caaaggcctg 600

gaatgggtgg cgagcattag cagcggcggc agcacctatt atccggatag cgtgaaaggc 660

cgctttacca ttagccgcga taacgcgaaa aacagcctgt atctgcagat gaacagcctg 720

cgcgcggaag ataccgcggt gtatgattgc gcgcgcggct atgatagcgg ctttgcgtat 780

tggggccagg gcaccctggt gaccgtgagc agcggtggcg gtggctcggg cggtggtggg 840

tcgggtggcg gcggatctga accgaaaagc tgcgacaaaa ctcacacatg cccaccgtgc 900

ccagcacctg aactcctggg gggaccgtca gtcttcctct tccccccaaa acccaaggac 960

accctcatga tctcccggac ccctgaggtc acatgcgtgg tggtggacgt gagccacgaa 1020

gaccctgagg tcaagttcaa ctggtacgtg gacggcgtgg aggtgcataa tgccaagaca 1080

aagccgcggg aggagcagta caacagcacg taccgtgtgg tcagcgtcct caccgtcctg 1140

caccaggact ggctgaatgg caaggagtac aagtgcaagg tctccaacaa agccctccca 1200

gcccccatcg agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtac 1260

accctgcccc catcccggga ggagatgacc aagaaccagg tcagcctgac ctgcctggtc 1320

aaaggcttct atcccagcga catcgccgtg gagtgggaga gcaatgggca gccggagaac 1380

aactacaaga ccacgcctcc cgtgctggac tccgacggct ccttcttcct ctacagcaag 1440

ctcaccgtgg acaagagcag gtggcagcag gggaacgtct tctcatgctc cgtgatgcac 1500

gaggctctgc acaaccacta cacgcagaag agcctctccc tgtctccggg taaatga 1557

<210> 34

<211> 36

<212> DNA

<213>Artificial sequence

<400> 34

attcaaaatt ttatcgatgc tccggtgccc gtcagt 36

<210> 35

<211> 22

<212> DNA

<213>Artificial sequence

<400> 35

tcacgacacc tgaaatggaa ga 22

<210> 36

<211> 46

<212> DNA

<213>Artificial sequence

<400> 36

catttcaggt gtcgtgagga tccgccacca tggcgctgcc ggtgac 46

<210> 37

<211> 33

<212> DNA

<213>Artificial sequence

<400> 37

ggggagggag aggggcttag cgcggcggca gcg 33

<210> 38

<211> 17

<212> DNA

<213>Artificial sequence

<400> 38

gcccctctcc ctccccc 17

<210> 39

<211> 25

<212> DNA

<213>Artificial sequence

<400> 39

attatcatcg tgtttttcaa aggaa 25

<210> 40

<211> 44

<212> DNA

<213>Artificial sequence

<400> 40

aaaacacgat gataatgcca ccatgaactc cttctccaca agcg 44

<210> 41

<211> 46

<212> DNA

<213>Artificial sequence

<400> 41

aatccagagg ttgattgtcg acgaattctc atttgcccgg gctcag 46

<210> 42

<211> 21

<212> DNA

<213>Artificial sequence

<400> 42

cctttccggg actttcgctt t 21

<210> 43

<211> 20

<212> DNA

<213>Artificial sequence

<400> 43

gcagaatcca ggtggcaaca 20

<210> 44

<211> 21

<212> DNA

<213>Artificial sequence

<400> 44

catgtacgtt gctatccagg c 21

<210> 45

<211> 21

<212> DNA

<213>Artificial sequence

<400> 45

ctccttaatg tcacgcacga t 21

Claims (11)

1. the double targeting Chimeric antigen receptors of a kind of OCTS-CAR, it is characterised in that including the CD8 leader being sequentially connected in series Membrane receptor signal peptide, double antigen binding domains, CD8 Hinge Chimerical receptors hinge, CD8 Transmembrane Chimerical receptor cross-films Area, CD28 Chimerical receptors costimulating factor, CD134 Chimerical receptors costimulating factor and TCR Chimerical receptor t cell activations domain,

Wherein, double antigen binding domains include the heavy chain VH and light chain of two single-chain antibodies connected in a manner of series connection or corner Hinge Inter-Linker between VL, antibody inner hinge Inner-Linker and single-chain antibody,

Described two single-chain antibodies refer to that BCMA single-chain antibodies, CD319 single-chain antibodies, CD38 single-chain antibodies, PDL1 are single-stranded anti- Any combination of two between body, CD123 single-chain antibodies.

2. encode the gene of the double targeting Chimeric antigen receptors of OCTS-CAR described in claim 1, it is characterised in that：

The gene order of the CD8 leader membrane receptor signal peptides is encoded as shown in SEQ ID NO.15；It is mono- to encode the BCMA Chain antibody light chain VL gene order encodes the gene order of the BCMA single-chain antibodies heavy chain VH as shown in SEQ ID NO.16 As shown in SEQ ID NO.17；The gene order of the CD319 single-chain antibodies light chain VL is encoded as shown in SEQ ID NO.18, is compiled Code CD319 single-chain antibodies heavy chain VH gene order is as shown in SEQ ID NO.19；It is light to encode the CD38 single-chain antibodies Chain VL gene order encodes the gene order such as SEQ ID of the CD38 chain antibodies heavy chain VH as shown in SEQ ID NO.20 Shown in NO.21；The gene order of the PDL1 single-chain antibodies light chain VL is encoded as shown in SEQ ID NO.22, encodes the PDL1 Single-chain antibody heavy chain VH gene order is as shown in SEQ ID NO.23；Encode the gene of the CD123 single-chain antibodies light chain VL Sequence encodes the gene order such as SEQ ID NO.25 institutes of the CD123 single-chain antibodies heavy chain VH as shown in SEQ ID NO.24 Show；Encoding antibody inner hinge Inner-Linker gene order is as shown in SEQ ID NO.26；Hinge between coding single-chain antibody Inter-Linker gene order is as shown in SEQ ID NO.27；Encode the gene sequence of the CD8Hinge Chimerical receptors hinge Row are as shown in SEQ ID NO.28；Encode the gene order such as SEQ of the CD8 Transmembrane Chimerical receptor transmembrane regions Shown in ID NO.29；The gene order of the CD28 Chimerical receptors costimulating factor is encoded as shown in SEQ ID NO.30；Coding The gene order of the CD134 Chimerical receptors costimulating factor is as shown in SEQ ID NO.31；Encode the TCR Chimerical receptors T The gene order in cell-stimulating domain is as shown in SEQ ID NO.32.

A kind of 3. OCTS-CAR recombinant expression carriers, it is characterised in that including：

The gene of expression vector, people's EF1 α promoters and the double targeting Chimeric antigen receptors of coding OCTS-CAR,

Wherein, the gene order of people EF1 α promoters is as shown in SEQ ID NO.14, the double targeting chimeric antigens of coding OCTS-CAR The gene of acceptor is as claimed in claim 2.

A kind of 4. OCTS-CAR recombinant expression carriers, it is characterised in that including：

Expression vector, people EF1 α promoters, the gene of the double targeting Chimeric antigen receptors of coding OCTS-CAR and coding PDL1 are mono- The gene of chain antibody,

Wherein, the gene order of people EF1 α promoters is as shown in SEQ ID NO.14, the double targeting chimeric antigens of coding OCTS-CAR The gene of acceptor is as claimed in claim 2, encodes the gene order of PDL1 single-chain antibodies as shown in SEQ ID NO.33.

5. the OCTS-CAR recombinant expression carriers according to claim 3 or 4, it is characterised in that：

Wherein, the expression vector is Lentiviral, retrovirus expression vector, adenovirus expression carrier, adenopathy Malicious associated virus expression vector or plasmid.

6. OCTS-CAR recombinant expression carriers according to claim 5, it is characterised in that：

Wherein, the expression vector is third generation Lentiviral pLenti-3G basic, the Lentiviral bag Include the sequences of AmpR containing ampicillin resistance gene, prokaryotic replions pUC Ori sequences, Viral Replicon SV40 Ori sequences, RSV promoters, terminal LTR of slow virus 5, terminal Self-Inactivating LTR of slow virus 3, Gag are cis Element, RRE cis elements, env cis elements, cPPT cis elements, ZsGreen1 green fluorescent proteins, IRES ribosomes combine The enhanced marmot hepatitis B posttranscriptional regulatory element of sequence, eWPRE.

7. a kind of construction method of OCTS-CAR recombinant expression carriers as claimed in claim 3, it is characterised in that including following Step：

A. ampicillin resistance gene AmpR sequences, prokaryotic replions pUC Ori sequences, Viral Replicon SV40 Ori will be contained Sequence, RSV promoters, terminal LTR of slow virus 5, terminal Self-Inactivating LTR of slow virus 3, Gag cis elements, RRE cis elements, env cis elements, cPPT cis elements, ZsGreen1 green fluorescent proteins, IRES cores The enhanced marmot hepatitis B posttranscriptional regulatory element of sugared body binding sequence, eWPRE is stored in third generation slow virus skeleton matter On grain pLenti-3G basic；

B. will coding CD8 leader membrane receptors signal peptide, double antigen binding domains, CD8Hinge Chimerical receptors hinge, CD8 Transmembrane Chimerical receptors transmembrane region, CD28 Chimerical receptors costimulating factor, CD134 Chimerical receptors costimulating factor with And the gene in TCR Chimerical receptor t cell activations domain is cloned into slow virus skeleton plasmid by digestion, connection, recombining reaction In pLenti-3G basic, the recombinant slow virus plasmid that the third generation is designed based on OCTS is obtained；

C. recombinant slow virus plasmid step B obtained respectively with slow virus packaging plasmid pPac-GP, pPac-R and film Albumen plasmid pEnv-G transfects HEK293T/17 cells jointly, after carrying out gene transcript expression in HEK293T/17 cells, bag Dressing up work(recombined lentivirus vector can be discharged into cells and supernatant, collect the supernatant of the recombined lentivirus vector included；

D. obtained recombinant slow virus supernatant is purified using the post way of purification for filtering, adsorbing, eluting, respectively obtained CAR-T recombinant slow virus expression vectors.

8. a kind of construction method of OCTS-CAR recombinant expression carriers as claimed in claim 4, it is characterised in that including following Step：

A. ampicillin resistance gene AmpR sequences, prokaryotic replions pUC Ori sequences, Viral Replicon SV40 Ori will be contained Sequence, RSV promoters, terminal LTR of slow virus 5, terminal Self-Inactivating LTR of slow virus 3, Gag cis elements, RRE cis elements, env cis elements, cPPT cis elements, ZsGreen1 green fluorescent proteins, IRES cores The enhanced marmot hepatitis B posttranscriptional regulatory element of sugared body binding sequence, eWPRE is stored in third generation slow virus skeleton matter On grain pLenti-3G basic；

B. will coding CD8 leader membrane receptors signal peptide, double antigen binding domains, CD8 Hinge Chimerical receptors hinge, CD8 Transmembrane Chimerical receptors transmembrane region, CD28 Chimerical receptors costimulating factor, CD134 Chimerical receptors costimulating factor, The gene of TCR Chimerical receptor t cell activation domains and coding PDL1 single-chain antibodies is cloned into by digestion, connection, recombining reaction In slow virus skeleton plasmid pLenti-3G basic, the recombinant slow virus plasmid that the third generation is designed based on OCTS is obtained；

C. recombinant slow virus plasmid step B obtained respectively with slow virus packaging plasmid pPac-GP, pPac-R and film Albumen plasmid pEnv-G transfects HEK293T/17 cells jointly, after carrying out gene transcript expression in HEK293T/17 cells, bag Dressing up work(recombined lentivirus vector can be discharged into cells and supernatant, collect the supernatant of the recombined lentivirus vector included；

D. obtained recombinant slow virus supernatant is purified using the post way of purification for filtering, adsorbing, eluting, respectively obtained CAR-T recombinant slow virus expression vectors.

9. a kind of OCTS-CAR-T cells, it is that the OCTS-CAR-T recombination expressions described in claim 3 or 4 are imported with genome Carrier or the T lymphocytes through the double targeting Chimeric antigen receptor modifications of CAR described in claim 1.

10. application of the OCTS-CAR-T cells in treating malignant tumor medicine is prepared described in claim 9.

11. application of the OCTS-CAR-T cells according to claim 10 in treating malignant tumor medicine is prepared, it is special Sign is that the treating malignant tumor medicine is treatment malignant plasma cell tumour, acute myeloid leukemia, melanoma, mammary gland Cancer, glioma, lymthoma, urological cancer, the medicine of tumor in digestive tract or genital system.