CN107312775B - Application of hsa _ circRNA _103096 in diagnosis, treatment and prognosis of liver cancer - Google Patents

Abstract

The invention discloses kinds of CircRNA, the sequence of which is shown as SEQ ID NO: 1, and steps of which disclose a primer for detecting RT-PCR of the CircRNA, wherein the CircRNA has obvious expression difference before and after liver cancer operation, the expression level of the CircRNA is remarkably up-regulated in 1 day before the liver cancer operation relative to a healthy control group, and the expression level of the CircRNA is remarkably down-regulated in 1 day, 3 days and 7 days after the liver transplantation.

Description

Application of hsa _ circRNA _103096 in diagnosis, treatment and prognosis of liver cancer

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of novel circular hsa _ circRNA _ 103096.

Background

Primary Liver Cancer (PLC) is malignant tumors occurring in the Liver, chronic Liver diseases or Liver cirrhosis caused by chemical carcinogens or environmental factors develops, but the pathogenesis is not clarified yet, and pathological diagnosis and treatment means have definite limitations.

In recent years, with the development of molecular biological gene chip technology, more and more researchers have explored the relationship between various biological small molecules and diseases by using the technology, and circular RNA (circular RNA) is a hotspot for researching the molecular mechanism of major diseases at present, circular RNA is -type endogenous non-coding RNA which has good conservation and high specificity and can play a role in regulating and controlling target genes, so that the circular RNA with differential expression is screened as a disease-related biomarker and is subjected to functional research, the molecular mechanism of disease occurrence can be better understood, and the prevention and diagnosis level of related diseases is further improved.

Disclosure of Invention

The invention aims to disclose novel circular RNA sequences and application thereof.

The technical scheme adopted by the invention is as follows:

circular RNAs, the sequence of which is shown as SEQ ID NO. 1.

Preferably, the circular RNA can be used as a target for liver cancer detection, treatment and prognosis.

liver cancer detection reagent kit, which contains reagent capable of quantitatively detecting circular RNA with sequence as SEQ ID NO. 1.

Preferably, the kit contains a real-time fluorescent quantitative detection sequence of SEQ ID NO: 1, or a primer sequence of the circular RNA.

preferably, the circular RNA primer sequence is:

F：5’-GGCTACGGGAGGAGAACAAG-3’(SEQ ID NO：4)；

R：5’-TGCTGGCAATTCAAACACACAT-3’(SEQ ID NO：5)。

liver function index detection kits, which contains a reagent capable of quantitatively detecting the circular RNA with sequence as SEQ ID NO. 1.

Preferably, the kit contains a real-time fluorescent quantitative detection sequence of SEQ ID NO: 1, or a primer sequence of the circular RNA.

preferably, the circular RNA primer sequence is:

F：5’-GGCTACGGGAGGAGAACAAG-3’(SEQ ID NO：4)；

R：5’-TGCTGGCAATTCAAACACACAT-3’(SEQ ID NO：5)。

preferably, the liver function index is at least of glutamic-oxalacetic transaminase and glutamic-pyruvic transaminase.

The invention has the beneficial effects that: the CircRNA disclosed by the application of the invention has obvious expression difference before and after liver cancer surgery, and the current clinical auxiliary diagnosis technology for liver cancer is not complete, so the CircRNA has the potential of being used as a biomarker related to liver cancer.

Drawings

FIG. 1 shows the expression levels of hsa _ circRNA _103096 at 1 day before liver transplantation and at 1, 3, and 7 days after liver transplantation.

Detailed Description

The following specific examples are set forth in a further illustration of the invention and are not intended to be limiting thereof.

Example 1

During the course of the study on liver cancer, circular RNAs were found, whose sequences were:

TGGAAGGAGGCAAAACCGGAAGACCTTATGGATTCAAAACTTAGATGTGTGTTTGAATTGCCAGCAGAGAATGATAAACCACATGATGTAGAAATAAATAAAATTATATCCACAACTGCATCAAAGACAGAAACACCAATAGTGTCTAAGTCTCTGAGTTCTTCTTTGGATGACACCGAAGTTAAGAAGGTTATGGAAGAATGTAAGAGGCTGCAAGGTGAAGTTCAGAGGCTACGGGAGGAGAACAAGCAGTTCAAG (SEQ ID NO: 1), which was named hsa _ circRNA _ 103096. Experimental example 2 materials and treatments:

1) collection of peripheral blood specimens

The samples were collected from patients 1 day before, 1 day after, 3 days after and 7 days after the PLC liver transplantation operation in the nephrology of the eight Hospital of the people's Release military, and peripheral blood of healthy volunteers who were examined normally in the department of the eight Hospital of the people's Release military, 0.5ml of each sample was collected in a 0.5ml cryovial and stored in a-80 ℃ refrigerator for later use.

2) Preparation and evaluation of samples

RNA sample preparation

The experiment is divided into a group before liver transplantation for 1 day, a group after liver transplantation for 3 days, a group after liver transplantation for 7 days and a healthy control group.

2mL of whole mixed blood was taken per group and the cells were pipetted several times with 1mL TRIzol reagent, whereas the suspended cells were lysed by adding TRIzol reagent to the centrifuged pellet and repeatedly pipetting with a pipette without washing the cells before adding TRIzol reagent in order to avoid increasing the possibility of mRNA degradation.

To completely dissociate the nucleic acid protein complex, the TRIzol-added sample was left at 15 to 30 ℃ for 5 min; adding 0.2mL of chloroform into each 1mL of sample homogenized by the TRIzol reagent, and tightly covering a tube cover; manually and violently oscillating the tube body for 15s, and incubating for 2-3min at 15-30 ℃; centrifugation at 12,000 Xg for 15mim at 4 ℃; after centrifugation, the mixed liquid is divided into a lower red phenol chloroform phase and an upper colorless water phase; the RNA was totally partitioned in the aqueous phase; the volume of the aqueous phase was about 60% of the TRIzol reagent added during homogenization.

Transferring the aqueous phase to a new centrifuge tube; mixing the aqueous phase with isopropanol to precipitate the RNA therein (the amount of isopropanol added is 0.5mL of isopropanol added when 1mL of TRIzol reagent is added to each sample homogenate); mixing, incubating at 15-30 deg.C for 10min, and centrifuging at 4 deg.C for 10min at 12,000 Xg; RNA precipitation will form a gel-like pellet on the bottom and side walls of the tube.

Removing the supernatant and washing the RNA pellet with at least 1mL of 75% ethanol per 1mL of TRIzol reagent homogenized sample; after shaking, the mixture was centrifuged at 7,500 Xg for 5min at 4 ℃.

Finally, the RNA pellet was not completely dried in air for 5-10min in order not to decrease the solubility of RNA. When dissolving RNA, adding RNase-free water, repeatedly blowing with a gun for several times, and incubating at 55-60 deg.C for 10 min. The RNA solution obtained was stored at-70 ℃.

Total RNA purification and quality control

RNA quality and quality was assessed using a NanoDrop ND-1000, where absorbance was measured at 260 and 280mn, the A260/A280 ratio required to be close to 2.0 (both 1.8-2.1), and the A260/A230 ratio was greater than 1.8. RNA integrity and purity were assessed by standard denaturing gel electrophoresis. The specific experimental procedure is as follows.

Adding redissolved RNA less than or equal to 85 μ L, 10 × reaction buffer solution 10 μ L, Baseline-ZERO DNase 5 μ L and RNase-free water to 100 μ L respectively in a microcentrifuge tube, incubating for 30min at 37 ℃, adding 350 μ L buffer solution RLT, mixing well, adding 250 μ L ethanol (96-100%), sucking and mixing well, adding 700 μ L of the sample into RNeasy mini-column mounted on a 2mL collecting tube, covering the sample with a cover carefully, centrifuging for 15s on a centrifuge larger than or equal to 8000 × g, discarding the fluid, adding 500 μ L buffer solution RPE into the RNeasy mini-column (adding 96-100% ethanol in 4 times volume to prepare working solution before RPE buffer solution is used times), covering the cover carefully to clean 15s on a centrifuge bottle, washing RNeasy membrane, discarding the fluid, adding 500 μ L buffer solution, covering the cover again, covering the centrifuge tube with a centrifuge bottle, cleaning RNeasy membrane, placing the new RNeasy-column into the centrifuge tube , removing RNA in a whole centrifuge tube, removing RNA in a proper amount, and washing RNeasy-column, and finally, and adding RNA in a centrifuge tube, and washing the RNeasy-collecting tube, and removing RNA in a proper amount, and finally, and centrifuging the RNeasy-5 mL collecting tube, and adding RNA in a centrifuge tube, and adding a centrifuge for controlling the RNeasy-1.

Experimental example 3 real-time fluorescent quantitative PCR detection

Primer design

And randomly selecting and verifying circRNA for fluorescence quantitative verification according to a screening principle that a preoperative group (preoperative 1-day group) is up-regulated and a postoperative group (postoperative 1-day, 3-day and 7-day groups) is down-regulated compared with the preoperative group, or the preoperative group is down-regulated and the postoperative group is up-regulated compared with the healthy control group. And calculating the difference multiple by using a 2-delta Ct method, and detecting by using RT-PCR. The PCR primer sequences were as follows:

TABLE 1 RT-PCR primer List

Validation by RT-PCR

The method comprises the steps of establishing an 8 mu L system, adding 2 XMaster Mix 5 mu L, positive and negative primers of 0.5 mu L respectively, distilled water of 2 mu L, adding 8 mu L of mixed liquor into each hole corresponding to a 384-PCR plate, adding corresponding 2 mu L of cDNA, carefully adhering a Sealing membrane of Sealing, and carrying out short-time centrifugal mixing, placing the 384-PCR plate on a Realtime PCR instrument to carry out PCR reaction, wherein the reaction procedure comprises the steps of 95 ℃, 10min, 40 PCR cycles (95 ℃, 10s, 60 ℃ and 60s collecting fluorescence), after the amplification reaction is finished, slowly heating the 384-PCR plate to 99 ℃ (the temperature is automatically controlled by the instrument, wherein the Rate is 0.05 ℃/s), and the content of the cDNA in the volume of 2 mu L of each sample is not completely the same, the difference is used as the difference of the gene expression ratio of a reference gene, and the final internal gene expression ratio of the sample is obtained by taking the relative gene expression ratio of the sample of the constant gene expression ratio (β) as the relative gene expression ratio.

Amplification curves can be seen in 5 groups of peripheral blood samples of patients 1 day before, 1 day after, 3 days after and 7 days after liver transplantation and healthy controls, the amplification efficiency of the primers is high, the melting curve meets the standard, and the specificity of the primers is good (table 2).

TABLE 2 values of cricRNA related to amplification in the Standard Curve

Experimental example 4 analysis of RT-PCR detection results

In order to detect whether differential expression exists between hsa _ circRNA _103096 and healthy control groups before 1 day (liver cancer patient), after 1 day, after 3 days, after 7 days and after liver transplantation, the inventor uses the △ Ct value obtained by correcting the Ct value of circRNA by the Ct value of β -actin internal reference gene in the relative expression ratio between two groups, 2^-△△CtAnd p-value calculations of whether there was a significant difference between the two groups (table 3, table 4). As is clear from FIG. 1, the expression level of hsa _ circRNA _103096 was significantly increased 1 day before liver transplantation (p) compared to that of healthy control group<0.01) and has a tendency to be significantly down-regulated 1 day, 3 days, 7 days after liver transplantation.

TABLE 3 △ Ct values for circRNA in liver transplant and healthy control groups

TABLE 4 between liver transplant group and healthy control group cP-value and 2 for ircRNA expression^-△△CtValue of

Note: p <0.05 indicates significant differential expression between the two groups; p <0.01 indicates that there was very significant differential expression between the two groups.

Experimental example 5 perioperative period experimental group of liver transplantation patients

4 patients who are diagnosed with PLC and have liver transplantation operation in Ba Hospital of the people's liberation force of China from 1 st 2014 to 31 st 2015 8 th 31 st are collected, 4 patients are all male, the average age is 40.25 +/-6.40 years, the median age is 42.5 years, all patients have long-term heavy drinking history, and the diagnosis before treatment is that alcoholic cirrhosis develops into PLC, and no other tumor history or hepatitis infection history exists.

Clinical characteristics of patients and healthy individuals were extracted from the database at hospital 181 and summarized in table 2-1. Aspartate transaminase (AST) and alanine Aminotransferase (ALT) are common indicators for assessing liver function, and are normal reference values between 0-50IU/L, and table 5 shows that the liver function of PLC patients gradually returns to normal after transplantation.

TABLE 5 clinical characteristics of liver transplant patients and healthy control groups

SEQUENCE LISTING

<110> Dongyi health services Limited, Shenzhen City

<120> use of hsa _ circRNA _103096 in diagnosis, treatment and prognosis of liver cancer

<130>

<160>5

<170>PatentIn version 3.5

<210>1

<211>258

<212>DNA

<213>hsa_circRNA_103096

<400>1

tggaaggagg caaaaccgga agaccttatg gattcaaaac ttagatgtgt gtttgaattg 60

ccagcagaga atgataaacc acatgatgta gaaataaata aaattatatc cacaactgca 120

tcaaagacag aaacaccaat agtgtctaag tctctgagtt cttctttgga tgacaccgaa 180

gttaagaagg ttatggaaga atgtaagagg ctgcaaggtg aagttcagag gctacgggag 240

gagaacaagc agttcaag 258

<210>2

<211>20

<212>DNA

<213> Artificial sequence

<400>2

gtggccgagg actttgattg 20

<210>3

<211>23

<212>DNA

<213> Artificial sequence

<400>3

cctgtaacaa cgcatctcat att 23

<210>4

<211>20

<212>DNA

<213> Artificial sequence

<400>4

ggctacggga ggagaacaag 20

<210>5

<211>22

<212>DNA

<213> Artificial sequence

<400>5

tgctggcaat tcaaacacac at 22

Claims (5)

1, circular RNAs, whose sequence is:

TGGAAGGAGGCAAAACCGGAAGACCTTATGGATTCAAAACTTAGATGTGTGTTTGAATTGCCAGCAGAGAATGATAAACCACATGATGTAGAAATAAATAAAATTATATCCACAACTGCATCAAAGACAGAAACACCAATAGTGTCTAAGTCTCTGAGTTCTTCTTTGGATGACACCGAAGTTAAGAAGGTTATGGAAGAATGTAAGAGGCTGCAAGGTGAAGTTCAGAGGCTACGGGAGGAGAACAAGCAGTTCAAG(SEQ ID NO：1)。

a kit for detecting liver cancer, comprising a reagent capable of quantitatively detecting the circular RNA of claim 1.

3. The kit for detecting liver cancer according to claim 2, wherein the kit comprises a primer sequence for real-time quantitative fluorescence detection of the circular RNA according to claim 1.

4. The kit for detecting liver cancer according to claim 3, wherein the circular RNA primer sequence is:

F：5’-GGCTACGGGAGGAGAACAAG-3’(SEQ ID NO：4)；

R：5’-TGCTGGCAATTCAAACACACAT-3’(SEQ ID NO：5)。

5. use of a reagent for quantitatively detecting the circular RNA of claim 1 in the preparation of a liver cancer detection reagent.

Images