CN107312775A - Applications of the hsa_circRNA_103096 in the diagnosis, treatment and prognosis of liver cancer - Google Patents

Abstract

The invention discloses a kind of CircRNA, its sequence such as SEQ ID NO：Shown in 1；And further disclose the primer for the RT PCR for detecting the CircRNA.The CircRNA has obvious differential expression before and after operation of liver cancer：The expression quantity of 1 day is extremely significantly raised relative to healthy control group before operation of liver cancer, and has within 1 day, 3 days, 7 days the trend significantly lowered in after liver transplantation.Because the clinical assistant diagnosis technology currently used for liver cancer is not perfect, therefore the CircRNA has the potential as the related biomarker of liver cancer.

Description

Applications of the hsa_circRNA_103096 in the diagnosis, treatment and prognosis of liver cancer

Technical field

The invention belongs to biological technical field, more particularly to a kind of new ring-type hsa_circRNA_103096 application.

Background technology

Liver is extremely important metabolic organ in body, the imbalance of its function can influence the normal metabolism of body and The change of interior environment.Primary carcinoma of liver (Primary Liver Cancer, PLC) is the malignant tumour that a class betides liver, The general chronic liver disease or cirrhosis progress triggered by chemical carcinogen or environmental factor, but pathogenesis is also not at present Illustrate, pathological diagnosis and treatment means have certain limitation.Managements of Liver Transplantation is that current treatment PLC is most thorough, effective Method, but how to improve for liver utilization rate and receptor's survival rate is also medical profession problem encountered always.Therefore, compel to be essential It was found that the neoformation label assessed for PLC early diagnosis and therapeutic action.

In recent years, with the development of molecular biology biochip technology, increasing researcher is visited using the technology The rope relation of different kind organism small molecule and disease, and circular rna (circular RNA, circRNA) is to study great at present The focus of disease molecules mechanism.CircRNA is that a class conservative is good, specific height, and target gene can be played in regulating and controlling effect Source property non-coding RNA.Therefore the circRNA with differential expression is filtered out as the related biomarker of disease, and to it Functional study is carried out, the pathogenetic molecular mechanism of disease can be best understood from, and then improve prevention and the diagnosis water of relevant disease It is flat.

The content of the invention

It is an object of the invention to disclose sequence and its application of a kind of new circular rna.

The technical solution used in the present invention is：

A kind of circular rna, its sequence is such as SEQ ID NO：Shown in 1.

It is preferred that, the circular rna can be detected as liver cancer, treated, prognosis target spot is applied.

Detection sequence can be quantified for SEQ ID NO by containing in a kind of liver cancer detection kit, the kit：1 ring-type RNA reagent.

It is preferred that, it is SEQ ID NO that real time fluorescent quantitative detection sequence is contained in the kit：The primer of 1 circular rna Sequence.

It is further preferred that circular rna primer sequence is：

F：5’-GGCTACGGGAGGAGAACAAG-3’(SEQ ID NO：4)；

R：5’-TGCTGGCAATTCAAACACACAT-3’(SEQ ID NO：5).

Detection sequence can be quantified for SEQ ID NO by containing in a kind of liver function index detection kit, the kit：1 Circular rna reagent.

It is preferred that, it is SEQ ID NO that real time fluorescent quantitative detection sequence is contained in the kit：The primer of 1 circular rna Sequence.

It is further preferred that circular rna primer sequence is：

F：5’-GGCTACGGGAGGAGAACAAG-3’(SEQ ID NO：4)；

R：5’-TGCTGGCAATTCAAACACACAT-3’(SEQ ID NO：5).

It is preferred that, liver function index is at least one of glutamic-oxalacetic transaminease, glutamic-pyruvic transaminase.

The beneficial effects of the invention are as follows：CircRNA disclosed in the present patent application has obvious before and after operation of liver cancer Differential expression, the clinical assistant diagnosis technology currently used for liver cancer is not perfect, therefore the CircRNA has and is used as liver cancer phase The potential of the biomarker of pass.

Brief description of the drawings

Fig. 1 be hsa_circRNA_103096 1 day before transplantation of liver, after liver transplantation 1 day, 3 days, the expression quantity of 7 days.

Embodiment

The present invention is further elaborated for specific examples below, but not as a limitation of the invention.

Embodiment 1

During studying liver cancer, it was found that a circular rna.Its sequence is：

TGGAAGGAGGCAAAACCGGAAGACCTTATGGATTCAAAACTTAGATGTGTGTTTGAATTGCCAGCAGAGAATGATAA ACCACATGATGTAGAAATAAATAAAATTATATCCACAACTGCATCAAAGACAGAAACACCAATAGTGTCTAAGTCTC TGAGTTCTTCTTTGGATGACACCGAAGTTAAGAAGGTTATGGAAGAATGTAAGAGGCTGCAAGGTGAAGTTCAGAGG CTACGGGAGGAGAACAAGCAGTTCAAG(SEQ ID NO：1), it is named as hsa_circRNA_103096.Experimental example 2 Material and processing：

1) collection of periphery blood specimen

Sample collect in nephrology of No.181 Hospital, PLA carry out PLC orthotopic liver transplantations before 1 day, it is postoperative 1 day, postoperative 3 days, postoperative 7 days patients, and it is normal strong in the door body inspection of clinic of No.181 Hospital, PLA The peripheral blood of health volunteer, each specimen collection 0.5ml is placed in -80 DEG C of refrigerator preservations in 0.5ml cryopreservation tube, stores standby With.This experiment is participated in all equal informed consents of research object, and the process is through Hospital Ethical Committee's examination and approval.

2) preparation and assessment of sample

It is prepared by RNA sample

Experiment is divided into before hepatocarcinoma patient transplantation of liver 1 day group, postoperative 1 day, postoperative 3 days, postoperative 7 days groups and normal healthy controls Group.

Every group takes 2ml sample mixing whole bloods, with 1mL TRIzol reagents and pipette by cell pressure-vaccum lysate several times, and suspend Cell is then that TRIzol reagents and pressure-vaccum is with cell lysis repeatedly with pipette are added in the precipitation of centrifugation, in TRIzol reagents Cell should not be washed before addition in order to avoid increasing the possibility of mRNA degradeds.

In order to which nucleic acid-protein complex will be completely dissociated, 5min is placed TRIzol sample has been added in 15-30 DEG C；Often 0.2mL chloroform is added in the sample of 1mL TRIzol reagents homogenate, lid is covered tightly；Manually acutely after vibration body 15s, 15- 30 DEG C of incubation 2-3min；12,000 × g centrifuges 15mim at 4 DEG C；Mixing liquid is classified into the red phenol chloroform of lower floor after centrifugation Phase, the colourless aqueous phase on intermediate layer core upper strata；RNA is all distributed in aqueous phase；The volume of aqueous phase about makes to add during homogenate TRIzol reagents 60%.

Aqueous phase is transferred in new centrifuge tube；Aqueous phase is mixed with isopropanol makes RNA precipitate therein (add the amount of isopropanol Add 0.5mL isopropanol when adding 1mL TRIzol reagents for each sample homogenization)；15-30 DEG C is incubated after 10min after mixing, In 4 DEG C of 12,000 × g centrifugations 10min；RNA precipitate will form gelatinous precipitate block in bottom of the tube and side wall.

Supernatant is removed, at least 75% ethanol 1mL is added in the sample per the homogenate of 1mL TRIzol reagents to be used to clean RNA precipitate；After vibration, 4 DEG C 7,500 × g centrifugations 5min.

Finally, in order to not reduce RNA solubility, endless white drying RNA precipitate 5-10min in atmosphere.Dissolve RNA When, the water for first adding no RNase is blown and beaten several times repeatedly with rifle, then 55-60 DEG C of incubation 10min.The RNA solution of acquisition is preserved In -70 DEG C.

Total serum IgE is purified and quality inspection

RNA amounts and quality are assessed using NanoDrop ND-1000, absorbance is determined at 260 and 280mn, A260/ A280 ratio needs access to 2.0 (between 1.8-2.1), and A260/A230 ratios are greater than 1.8.RNA integralities and Purity is estimated by standard denaturating gel electrophoresis.Specific experiment process is as follows.

Be separately added into microcentrifugal tube the μ L of the RNA that dissolves again≤85, the μ L of 10 × reaction buffer 10, The μ L of Baseline-ZERO DNA enzymatics 5, the water without RNase are to 100 μ L；37 DEG C of incubation 30min；350 μ L buffer solution RLT are added, are mixed It is even；250 μ L ethanol (96-100%) are added, mixing is played in suction；Above-mentioned 700 μ L sample is added on 2mL collecting pipes The small-sized centrifugal columns of RNeasy in, carefully close the lid, centrifuge 15s on >=8000 × g centrifuge, discard fluid； 500 μ L buffer solutions RPE are added in RNeasy pillars, and (RPE buffer solutions are for the first time before use, by described 4 times of volumes of addition on bottle 96-100% ethanol is made into working solution), >=8000 × g that carefully closes the lid centrifugation 15s wash RNeasy films, discard stream Body；500 μ L buffer solution RPE are added again, are closed the lid, and >=8000 × g centrifugation 2min wash RNeasy films；RNeasy posts In the collecting pipe for being placed on a new 2mL, old collecting pipe is removed with filtration method, at full speed centrifugation 1min；RNeasy posts are transferred to one In new 1.5mL centrifuge tube, draw the appropriate water without RNase and be added directly into RNeasy films；Lid is covered, >=8000 × G centrifuges 1min, elution；RNA is finally carried out to quantify and quality control.

The real-time fluorescence quantitative PCR of experimental example 3 is detected

Design of primers

Up-regulation and postoperative group (postoperative 1 day, 3 days, 7 days groups) are compared with healthy control group according to preoperative group (preoperative 1 day group) Compared downward with preoperative group, or preoperative group is compared downward with healthy control group and screening that postoperative group is compared up-regulation with preoperative group The circRNA that principle selects checking at random carries out fluorescent quantitation checking.Fold differences are calculated with 2- Δ Δ Ct methods, pass through RT-PCR Detection.PCR primer sequence is as follows：

The RT-PCR primer list of table 1

RT-PCR is verified

Verified using RT-PCR.8 μ L systems are set up, the μ L of 2 × Master Mix 5, forward and reverse primer each 0.5 is added μ L, the μ L of distilled water 2.8 μ L mixed liquors are added in the corresponding each hole of 384-PCR plates, corresponding 2 μ L cDNA are added, it is careful viscous Upper Sealing Film sealed membranes, and of short duration centrifugation mixing.Above-mentioned 384-PCR plates are placed in Realtime PCR instruments and carried out PCR reacts.Response procedures are as follows：95 DEG C, 10min；40 PCR cycles (95 DEG C, 10s；60 DEG C, 60s collects fluorescence).In order to build The melting curve of vertical PCR primer, after amplified reaction terminates, by (95 DEG C, 10s；60 DEG C, 60s；95 DEG C, 15s)；And it is slow from 60 DEG C It is slow to be heated to 99 DEG C (instrument carries out-Ramp Rate for 0.05 DEG C/s automatically).Due to by RNA concentration quantitatives error and RNA reverses The influence of efficiency error etc. is recorded, its content of the cDNA of 2 μ L volumes of each sample is not fully identical, to correct this difference, I Use house-keeping gene β-actin (different sample room expression quantity substantially constants) as internal reference, removed with the value of sample testing gene With the value of this sample internal reference, the ratio finally given is the testing gene relative amount of sample.

1 day before transplantation of liver, postoperative 1 day, postoperative 3 days, 5 groups of periphery blood specimens of postoperative 7 days and normal healthy controls person See amplification curve, the amplification efficiency of primer is higher, melting curve meets standard, and the specificity of primer is preferably (table 2).

Numerical value related to amplification in standard curve the cricRNA of table 2

Experimental example 4RT-PCR Analysis of test results

In order to detect hsa_circRNA_103096 before transplantation of liver 1 day (liver cancer patient), postoperative 1 day, postoperative 3 days, It whether there is differential expression between postoperative 7 days and healthy control group, inventor is by circRNA Ct values through β-actin internal references The △ Ct values obtained after the Ct corrections of gene are for relative expression's ratio between two groups：2^-△△Ct, and with the presence or absence of notable between two groups The p value of difference calculates (table 3, table 4).From fig. 1, it can be seen that hsa_circRNA_103096 expression quantity phases of 1 day before transplantation of liver (p is extremely significantly raised for healthy control group<0.01), and in after liver transplantation have what is significantly lowered within 1 day, 3 days, 7 days Trend.

The △ Ct values of the liver transfer operation group of table 3 and healthy control group circRNA

The p value and 2 that circRNA is expressed between the liver transfer operation group of table 4 and healthy control group^-△△CtValue

Note：*p<0.05 represent two groups between there is significant difference expression；**p<0.01 represent two groups between exist extremely show Write differential expression.

The liver transplantation in peri-operation experimental group of experimental example 5

Collect 41 day to 2015 December in 2014 on August be diagnosed as in No.181 Hospital, PLA within 31 PLC and the patient for carrying out orthotopic liver transplantation.4 patients are male, average age 40.25 ± 6.40 years old, the median age 42.5 Year.All patients have long-term heavy drinking medical history, and alcoholic cirrhosis is diagnosed as before treatment and develops into PLC, and without other tumours Medical history and virus infection medical history.

The Clinical symptoms of patient and healthy individuals is extracted and is summarised in table 2-1 from the database of the 181st hospital.Millet straw Transaminase (aspartate transaminase, AST) and glutamic-pyruvic transaminase (alanine aminotransferase, ALT) It is the common counter for assessing liver function, is normal reference value between 0-50IU/L, table 5 is shown, is suffered from through post-transplantation PLC The liver function of person gradually recovers normal.

The Clinical symptoms of the liver-transplantation patients of table 5 and healthy control group

SEQUENCE LISTING

<110>Hundred million health service Co., Ltds of Shenzhen east

<120>Applications of the hsa_circRNA_103096 in the diagnosis, treatment and prognosis of liver cancer

<130>

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 258

<212> DNA

<213> hsa_circRNA_103096

<400> 1

tggaaggagg caaaaccgga agaccttatg gattcaaaac ttagatgtgt gtttgaattg 60

ccagcagaga atgataaacc acatgatgta gaaataaata aaattatatc cacaactgca 120

tcaaagacag aaacaccaat agtgtctaag tctctgagtt cttctttgga tgacaccgaa 180

gttaagaagg ttatggaaga atgtaagagg ctgcaaggtg aagttcagag gctacgggag 240

gagaacaagc agttcaag 258

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence

<400> 2

gtggccgagg actttgattg 20

<210> 3

<211> 23

<212> DNA

<213>Artificial sequence

<400> 3

cctgtaacaa cgcatctcat att 23

<210> 4

<211> 20

<212> DNA

<213>Artificial sequence

<400> 4

ggctacggga ggagaacaag 20

<210> 5

<211> 22

<212> DNA

<213>Artificial sequence

<400> 5

tgctggcaat tcaaacacac at 22

Claims (10)

1. a kind of circular rna, its sequence is：

TGGAAGGAGGCAAAACCGGAAGACCTTATGGATTCAAAACTTAGATGTGTGTTTGAATTGCCAGCAGAGAATG ATAAACCACATGATGTAGAAATAAATAAAATTATATCCACAACTGCATCAAAGACAGAAACACCAATAGTGTCTAAG TCTCTGAGTTCTTCTTTGGATGACACCGAAGTTAAGAAGGTTATGGAAGAATGTAAGAGGCTGCAAGGTGAAGTTCA GAGGCTACGGGAGGAGAACAAGCAGTTCAAG(SEQ ID NO：1).

2. the circular rna described in claim 1 is detected as liver cancer, treated, the application of prognosis target spot.

3. a kind of liver cancer detection kit, it is characterised in that containing in the kit can quantify described in test right requirement 1 The reagent of circular rna.

4. liver cancer detection kit according to claim 3, it is characterised in that contain real time fluorescent quantitative in the kit The primer sequence of circular rna described in test right requirement 1.

5. liver cancer detection kit according to claim 4, it is characterised in that the circular rna primer sequence is：

F：5’-GGCTACGGGAGGAGAACAAG-3’(SEQ ID NO：4)；

R：5’-TGCTGGCAATTCAAACACACAT-3’(SEQ ID NO：5).

6. application of the reagent of circular rna in liver cancer detection reagent is prepared described in quantitative test right requirement 1.

7. a kind of liver function index detection kit, it is characterised in that test right requirement 1 can be quantified by containing in the kit The reagent of described circular rna；The liver function index is at least one of glutamic-oxalacetic transaminease, glutamic-pyruvic transaminase.

8. liver function index detection kit according to claim 7, it is characterised in that containing glimmering in real time in the kit The primer sequence of circular rna described in the quantitative test right requirement 1 of light.

9. liver function index detection kit according to claim 8, it is characterised in that the circular rna primer sequence It is：

F：5’-GGCTACGGGAGGAGAACAAG-3’(SEQ ID NO：4)；

R：5’-TGCTGGCAATTCAAACACACAT-3’(SEQ ID NO：5).

10. application of the reagent of circular rna in liver function index detection reagent is prepared described in quantitative test right requirement 1.