CN107287198B - Phenylalanine attenuator mutants and phenylalanine operons addressing feedback repression and their uses - Google Patents

Phenylalanine attenuator mutants and phenylalanine operons addressing feedback repression and their uses Download PDF

Info

Publication number
CN107287198B
CN107287198B CN201710403515.XA CN201710403515A CN107287198B CN 107287198 B CN107287198 B CN 107287198B CN 201710403515 A CN201710403515 A CN 201710403515A CN 107287198 B CN107287198 B CN 107287198B
Authority
CN
China
Prior art keywords
phenylalanine
sequence
dna molecule
leu
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201710403515.XA
Other languages
Chinese (zh)
Other versions
CN107287198A (en
Inventor
刘树文
温廷益
孙建建
肖海涵
张芸
商秀玲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Microbiology of CAS
Original Assignee
Institute of Microbiology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Microbiology of CAS filed Critical Institute of Microbiology of CAS
Priority to CN201710403515.XA priority Critical patent/CN107287198B/en
Priority to EP17864640.2A priority patent/EP3533872A4/en
Priority to CN201780003425.XA priority patent/CN108473990A/en
Priority to PCT/CN2017/107453 priority patent/WO2018077159A1/en
Priority to US16/345,669 priority patent/US11492616B2/en
Publication of CN107287198A publication Critical patent/CN107287198A/en
Application granted granted Critical
Publication of CN107287198B publication Critical patent/CN107287198B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
    • C12P13/222—Phenylalanine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/01—Hydro-lyases (4.2.1)
    • C12Y402/01051—Prephenate dehydratase (4.2.1.51)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y504/00—Intramolecular transferases (5.4)
    • C12Y504/99—Intramolecular transferases (5.4) transferring other groups (5.4.99)
    • C12Y504/99005—Chorismate mutase (5.4.99.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses phenylalanine attenuator mutants, phenylalanine operons for solving feedback repression and application thereof. The phenylalanine attenuator mutant provided by the invention is a DNA molecule shown by n1-n2 th nucleotides in a sequence 2; 105 is more than or equal to n1 is more than or equal to 118, 123 is more than or equal to n2 is more than or equal to 176. The phenylalanine operon gene for releasing attenuation regulation is obtained by removing nucleotides 1 to n3 of a phenylalanine attenuator in the phenylalanine operon gene; 104 is less than or equal to n3 is less than or equal to 117. The method for protecting and relieving feedback repression of phenylalanine operon in microorganism comprises the following steps: deletion of the phenylalanine operon gene of the microorganism from position 1 to position n3 of the phenylalanine attenuator. By adopting the scheme provided by the invention, the yield of the phenylalanine and the derivative thereof can be obviously improved, and the method has great application and popularization values in the production field of the phenylalanine and the derivative thereof.

Description

Phenylalanine attenuator mutants and phenylalanine operons addressing feedback repression and their uses
Technical Field
The invention belongs to the field of biotechnology, and particularly relates to phenylalanine attenuator mutants, phenylalanine operons for solving feedback repression and application of the phenylalanine attenuator mutants and the phenylalanine operons.
Background
L-Phenylalanine (L-Phenylalanine) is one of 8 essential amino acids of human and animals, is mainly used as a raw material of a novel sweetening agent aspartame with high sweetness and low calorie, and is also widely applied to the fields of food, feed additives, medicines and the like. At present, the main method for industrially producing L-phenylalanine at home and abroad is a microbial fermentation method. In addition, the L-phenylalanine can be further derived and synthesized into compounds with important application values such as D-phenylalanine, phenylpyruvic acid, mandelic acid, phenyl acetate, phenyl ethanol, phenylethylamine, styrene, cinnamic acid and the like through a microbial metabolic pathway. However, the synthesis pathway and the regulation and control mode of L-phenylalanine in microorganisms are complex and are key limiting factors for efficient fermentation production of L-phenylalanine and derivatives thereof.
There is an attenuation regulation mechanism in the transcriptional expression of operon genes for microbial synthesis of amino acids, such as L-histidine, L-threonine, L-phenylalanine, L-leucine, L-isoleucine, and L-tryptophan, etc. Transcription of the amino acid operon terminates prematurely when the concentration of a specific amino acid in the cell is high. Conversely, when a particular amino acid is lacking in a cell, the RNA polymerase transcribes the amino acid operon.
In the process of producing L-phenylalanine or its derivatives by microbial fermentation, intracellular L-phenylalanine is gradually accumulated, and the expression of phenylalanine operon is repressed through the feedback of the attenuation regulation mechanism, which is not favorable for the biosynthesis of L-phenylalanine or its derivatives. Therefore, in order to construct engineering bacteria for efficiently producing phenylalanine or a derivative thereof, it is highly desirable to develop a method for modifying phenylalanine attenuator to improve the expression level of phenylalanine operon and the yield of phenylalanine.
Disclosure of Invention
The object of the present invention is to provide phenylalanine attenuator mutants and phenylalanine operons that solve feedback repression and their uses.
The invention firstly protects a DNA molecule A (phenylalanine attenuator mutant) as the following (a1), (a2), (a3), (a4) or (a 5):
(a1) DNA molecules shown by n1-n2 th nucleotides in a sequence 2 of a sequence table; n1 is a natural number of 105 to 118 (n1 is preferably 117), n2 is a natural number of 123 to 176 (n2 may specifically be a natural number of 123 to 146 or 147 to 176, and may specifically be 123, 146 or 176);
(a2) the DNA molecule obtained by removing nucleotides 1 to n3 of the phenylalanine attenuator, wherein n3 is a natural number of 104 to 117 (n3 is preferably 116);
(a3) the DNA molecule obtained by removing nucleotides 1 to n3 of the phenylalanine attenuator related sequence, wherein n3 is a natural number of 104-117 (n3 is preferably 116);
(a4) a DNA molecule obtained by connecting a tag sequence to the end of (a1), (a2) or (a 3);
(a5) and (b) a DNA molecule obtained by connecting a connecting sequence to the end of (a1), (a2) or (a 3).
The phenylalanine attenuator mutant is a phenylalanine attenuator truncation or phenylalanine attenuator variant. The phenylalanine attenuator truncation is shown as the n1-123 th nucleotide of the sequence 2 in the sequence table. The phenylalanine attenuator variant is shown as n1-n4 th nucleotides in the sequence 2 of the sequence table, wherein n4 is a natural number of more than 124 and less than 176 (n4 specifically can be a natural number of more than 124 and less than 146 or a natural number of more than 147 and less than 176, and more specifically can be 146 or 176).
The invention also protects the application of the DNA molecule A in promoting the expression of downstream target genes. In the application, the DNA molecule A is used as a regulatory element. In the application, the DNA molecule A is positioned between a promoter of the target gene and an initiation codon of the target gene. Said applicationThe promoter can be a promoter P shown in 1 of a sequence tablethr-trc. In the application, the target gene can be a gfp gene shown in a sequence 3 of a sequence table.
The invention also protects a DNA molecule B, which comprises the following components in sequence from upstream to downstream: the DNA molecule A and a target gene. The target gene can be a gfp gene shown in a sequence 3 of a sequence table.
The invention also protects a DNA molecule C, which comprises the following components from upstream to downstream in sequence: a promoter, the DNA molecule A, a target gene and a terminator. The promoter can be a promoter P shown in 1 of a sequence tablethr-trc. The target gene can be a gfp gene shown in a sequence 3 of a sequence table. The terminator may specifically be "CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG".
The DNA molecule A, the DNA molecule B or the DNA molecule C does not have nucleotides 1 to n3 of a phenylalanine attenuator, and n3 is a natural number of 104 to 117 (n3 is preferably 116).
The DNA molecule B sequentially consists of the following elements from upstream to downstream: nucleotide 117 to 176 of sequence 2 of the sequence table, connecting sequence GGTTCTGGTTCTGGTTCT, gfp gene shown by sequence 3 of the sequence table
The DNA molecule C sequentially consists of the following elements from upstream to downstream: promoter P shown in 1 of sequence listingthr-trcThe restriction enzyme HindIII, the 117 th to 176 th nucleotides of the sequence 2 of the sequence table, the connecting sequence "GGTTCTGGTTCTGGTTCT", the gfp gene shown in the sequence 3 of the sequence table, and the terminator sequence "CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG".
The invention also protects DNA molecule D (phenylalanine operon gene for releasing attenuation regulation, also called phenylalanine operon gene mutant) which is obtained by removing nucleotides from 1 st to n3 th of phenylalanine attenuator in phenylalanine operon gene; n3 is a natural number of 104 to 117 (n3 is preferably 116).
The invention also protects the DNA molecule E, which is obtained by modifying the phenylalanine operon gene as follows: (1) removing nucleotides 1 to n3 of the phenylalanine attenuator; n3 is a natural number of 104 to 117 (n3 is preferably 116); (2) the gene encoding chorismate mutase-prephenate dehydratase bifunctional enzyme is mutated from the gene encoding the wild protein to the gene encoding the mutant protein from which the feedback repression is removed.
The mutant protein with relieved feedback repression can be specifically PheA protein.
The wild protein may in particular be a PheA protein.
The DNA molecule E can be specifically a DNA molecule shown by nucleotides 117 to 1307 of a sequence 2 in a sequence table.
The DNA molecule E can be specifically a DNA molecule shown as nucleotides 117 to 1413 of a sequence 2 in a sequence table.
Recombinant vectors containing said DNA molecule D or said DNA molecule E also belong to the scope of protection of the present invention.
Recombinant bacteria containing said DNA molecule D or said DNA molecule E also belong to the scope of protection of the present invention.
The recombinant bacterium can be obtained by introducing the DNA molecule D or the DNA molecule E into a starting bacterium and performing over-expression. The outbreak is an Escherichia bacterium or a Corynebacterium bacterium. The Escherichia bacterium may be specifically Escherichia coli, for example, Escherichia coli K-12 or a derivative strain thereof. The corynebacterium genus bacterium may be specifically corynebacterium glutamicum, such as corynebacterium glutamicum 13032. The outbreak bacteria can be recombinant bacteria obtained by introducing genes for coding 3-deoxy-D-arabinoheptulose-7-phosphate synthase (AroF protein) into initial bacteria. The starting bacterium is an Escherichia bacterium or a Corynebacterium bacterium. The Escherichia bacterium may be specifically Escherichia coli, for example, Escherichia coli K-12 or a derivative strain thereof. The corynebacterium genus bacterium may be specifically corynebacterium glutamicum, such as corynebacterium glutamicum 13032. The gene coding for the AroF protein can also be introduced into the starter bacterium together with the DNA molecule. The gene coding for the AroF protein can also be introduced into the starter bacterium together with the DNA molecule.
The AroF protein is (b1) or (b2) as follows:
(b1) a protein consisting of an amino acid sequence shown in a sequence 8 in a sequence table;
(b2) and (b) a protein derived from the sequence 8, wherein the amino acid sequence of the sequence 8 is subjected to substitution and/or deletion and/or addition of one or more amino acid residues, and has the function of 3-deoxy-D-arabinoheptulose-7-phosphate synthase.
The open reading frame of the gene encoding the AroF protein may be represented by nucleotides 195 to 1265 of sequence 7 of the sequence listing.
The gene for coding the AroF protein can be shown as a sequence 7 in a sequence table.
The invention also protects the application of any recombinant bacterium in the preparation of phenylalanine.
When the recombinant bacterium is applied to producing phenylalanine, the recombinant bacterium is cultured by adopting a fermentation medium.
The fermentation culture medium can be a rich culture medium or an inorganic salt culture medium. The medium contains a carbon source, a nitrogen source, inorganic ions, antibiotics, and other nutritional factors. As the carbon source, sugars such as glucose, lactose, and galactose; alcohols such as glycerin and mannitol; organic acids such as gluconic acid, citric acid, succinic acid, and the like may also be used. As the nitrogen source, inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium phosphate, and ammonium chloride; organic nitrogen sources such as corn steep liquor, soybean meal hydrolysate, hair meal, yeast extract, peptone, and the like can also be used. The inorganic ions comprise one or more of iron, calcium, magnesium, manganese, molybdenum, cobalt, copper, potassium, and the like. Other nutritional factors also include vitamins such as biotin, vitamin B1, pyridoxal, etc.
The carbon source in the fermentation medium is glucose.
The fermentation medium may specifically be: 20.0g/L of glucose, 15.0g/L of ammonium sulfate, 2.0g/L of potassium dihydrogen phosphate, 2.0g/L of magnesium sulfate heptahydrate, 2.0g/L of yeast powder, 15.0g/L of calcium carbonate, 5mL/L of trace element mixed solution and the balance of water.
And (3) mixing trace element liquid: FeSO4·7H2O 10g/L、CaCl21.35g/L、ZnSO4·7H2O 2.25g/L、MnSO4·4H2O 0.5g/L、CuSO4·5H2O 1g/L、(NH4)6Mo7O24·4H2O 0.106g/L、Na2B4O7·10H2O0.23g/L、CoCl2·6H2O0.48 g/L, 35% HCl 10mL/L, and the balance water.
The culture conditions may specifically be: culturing at 37 deg.C and 220rpm with shaking for 36 h.
The culture conditions may specifically be: inoculating the seed liquid into a fermentation culture medium at an inoculation amount of 3%, and performing shake culture at 37 ℃ and 220rpm for 36 h. The preparation method of the seed liquid comprises the following steps: inoculating the recombinant bacteria into a liquid LB culture medium, and carrying out shaking culture at 37 ℃ and 220rpm for 8h to obtain a seed solution. OD of the seed liquid600nmThe value may specifically be 5.0.
The culture process is controlled as follows: in the culture process, ammonia water is used for adjusting the pH value of the reaction system to maintain the pH value at 6.8-7.0; sampling every 3-4h in the culture process, detecting the glucose content, and supplementing glucose and enabling the glucose concentration in the system to reach 10g/L when the glucose content in the system is lower than 5 g/L.
The invention also provides a method for improving the ability of the microorganism to produce phenylalanine, which comprises the following steps: deleting nucleotides 1 to n3 counted from the 1 st position of the phenylalanine attenuator in the phenylalanine operon gene of the microorganism; n3 is a natural number of 104 to 117 (n3 is preferably 116). The microorganism is a microorganism having a phenylalanine operon. The microorganism may specifically be a microorganism belonging to the genus Escherichia. The microorganism belonging to the genus Escherichia may specifically be Escherichia coli, and more specifically, Escherichia coli K-12 or a strain derived therefrom.
The invention also provides a method for relieving feedback repression of a phenylalanine operon in a microorganism, which comprises the following steps: deleting nucleotides 1 to n3 counted from the 1 st position of the phenylalanine attenuator in the phenylalanine operon gene of the microorganism; n3 is a natural number of 104 to 117 (n3 is preferably 116). The microorganism is a microorganism having a phenylalanine operon. The microorganism may specifically be a microorganism belonging to the genus Escherichia. The microorganism belonging to the genus Escherichia may specifically be Escherichia coli, and more specifically, Escherichia coli K-12 or a strain derived therefrom.
Any of the above phenylalanine operon genes includes a phenylalanine attenuator and a gene encoding chorismate mutase-prephenate dehydratase bifunctional enzyme (PheA protein or PheA protein).
The PheA protein is (c1) or (c2) as follows:
(c1) a protein consisting of an amino acid sequence shown in a sequence 6 in a sequence table;
(c2) and (b) the protein which is derived from the sequence 6 and has the functions of chorismate mutase-prephenate dehydratase bifunctional enzyme, wherein the amino acid sequence of the sequence 6 is subjected to substitution and/or deletion and/or addition of one or more amino acid residues.
The PheA protein is as follows (d1) or (d 2):
(d1) a protein consisting of an amino acid sequence shown in a sequence 5 in a sequence table;
(d2) and (b) a protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 5, has the functions of chorismate mutase-prephenate dehydratase bifunctional enzyme and is derived from the sequence 5.
The phenylalanine attenuator is specifically shown as the 1 st to 123 th nucleotides in the sequence 2 of the sequence table.
The phenylalanine attenuator related sequence is specifically shown as the 1 st to 176 th nucleotides of the sequence 2 in the sequence table.
The gene for coding the PheA protein is specifically shown as nucleotides 147 to 1307 of a sequence 2 in a sequence table.
The phenylalanine operon gene is specifically shown as nucleotides 1 to 1307 in a sequence 2 of a sequence table.
The phenylalanine operon gene is specifically shown as nucleotides 1 to 1413 of a sequence 2 in a sequence table.
Any of the above phenylalanines may specifically be L-phenylalanine.
The invention discloses a method for modifying phenylalanine attenuator, which deletes the gene pheL coding leader peptide in the attenuator and the front reverse complementary palindromic sequence in the stem-loop structure of a terminator, and reserves the rear reverse complementary palindromic sequence of the terminator. The inventor of the invention unexpectedly obtains the phenylalanine attenuator mutant which can obviously improve the gene expression level by removing the specific sequence of the phenylalanine attenuator. It is obvious that, according to the experimental results of the present invention, those skilled in the art can easily deduce that partial sequence of the preceding reverse complementary palindrome sequence in the stem-loop structure of the terminator of the above-mentioned attenuator is removed to destroy the secondary complementary structure of the terminator to some extent, and it is also possible to obtain phenylalanine attenuator mutants and phenylalanine operon mutants having similar properties. Therefore, the similar method for modifying phenylalanine attenuators is also within the scope of the present invention. It is apparent that the method of the present invention for releasing phenylalanine attenuators of E.coli is equally applicable to phenylalanine attenuators of other genera.
The invention also discloses a phenylalanine operon gene for relieving attenuation regulation, in particular to the phenylalanine operon gene which removes the gene pheL for coding leader peptide and the reverse complementary palindromic sequence of the front section in the stem-loop structure of the terminator and reserves the reverse complementary palindromic sequence of the rear section of the terminator.
The phenylalanine attenuator transformation method provided by the invention obviously improves the phenylalanine fermentation performance of the engineering bacteria. The invention can be practically used for producing phenylalanine by bacterial fermentation. Obviously, the invention can also be used for the biosynthesis of compounds downstream of the phenylalanine metabolic pathway, such as D-phenylalanine, phenylpyruvic acid, mandelic acid, phenyl acetate, phenylethanol, phenylethylamine, styrene, cinnamic acid and the like.
Besides the modification of the phenylalanine operon gene in situ on the chromosome, other methods for gene overexpression such as integration of more than or equal to 1 copy of the above-mentioned attenuation-deregulated phenylalanine operon gene on the chromosome are also within the scope of the present patent; in addition, overexpression of the above-described attenuation-deregulated phenylalanine operon gene by a plasmid is also within the scope of the present patent.
The phenylalanine attenuator transformation method provided by the invention obviously improves the expression level of phenylalanine operon or other genes, thereby improving the fermentation performance of phenylalanine and derivatives thereof of engineering bacteria. The invention obtains the nucleic acid sequence for efficiently relieving feedback repression, constructs the strain for efficiently producing phenylalanine and provides a new method for improving the fermentation production of phenylalanine. By adopting the scheme provided by the invention, the yield of the phenylalanine and the derivative thereof can be obviously improved, and the method has great application and popularization values in the production field of the phenylalanine and the derivative thereof.
Detailed Description
The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged. In the following examples, unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art and commercially available instruments and reagents, and can be referred to in the specifications of manufacturers of molecular cloning guidelines (3 rd edition), scientific publishers, microbiological experiments (4 th edition), advanced education publishers, and the like. ATCC:https://www.atcc.org/。
coli K12MG 1655: ATCC number 700926. plasmid pACYC 184: NEB company, catalog No. E4152S. pGFPuv vector: clontech Laboratories, Inc., Catalog No. 632312. E.coli EC 135: the following documents are described: zhang et al, Plos Genetics, 2012,8(9): e 1002987.
Example 1 attenuator mutant regulates expression of gfp gene
Firstly, constructing a recombinant plasmid pACYC184-Pthr-trc
1. Synthesis of a double-stranded DNA molecule (promoter P) represented by sequence 1 of the sequence Listingthr-trc)。
2. And (3) carrying out PCR amplification by using the genome DNA of the escherichia coli K12MG1655 as a template and adopting a primer pair consisting of WY1947 and WY1948 to obtain a PCR amplification product.
WY1947：CTAGTCTAGAGCTTTTCATTCTGACTGCAAC；
WY1948：CCCAAGCTTACATTATACGAGCCGGATGATTAATTGTCAACTGTCTGTGCGCTATGCCT。
3. Taking the PCR amplification product obtained in the step 2, carrying out double enzyme digestion by using restriction enzymes Xba I and Hind III, and recovering the enzyme digestion product.
4. The vector backbone (about 4.1kb) was recovered by double digestion with restriction enzymes Xba I and Hind III from the pACYC184 plasmid.
5. Connecting the enzyme digestion product in the step 3 with the vector skeleton in the step 4 to obtain a recombinant plasmid pACYC184-Pthr-trc。
Second, construction of respective recombinant plasmids
1. Construction of recombinant bacterium GFP3248
(1) Taking the genome DNA of escherichia coli K12MG1655 as a template, and carrying out PCR amplification by adopting a primer pair consisting of WY3248 and WY3258 to obtain a PCR amplification product A1; taking the pGFPuv vector as a template, and carrying out PCR amplification by adopting a primer pair consisting of WY3105 and WY1859 to obtain a PCR amplification product A2; and mixing the PCR amplification product A1 with the PCR amplification product A2 as a template, and performing PCR amplification by adopting a primer pair consisting of WY3248 and WY1859 to obtain a PCR amplification product A3.
WY3248：CCCAAGCTTAGTCACTTAAGGAAACAAAC atgA；
WY3258：AGTTCTTCTCCTTTACTCAT AGAACCAGAACCAGAACC CAGCGCCAGTAACGGGTTTTC；
WY3105：GGTTCTGGTTCTGGTTCT ATGAGTAAAGGAGAAGAACTTTTCA；
WY1859：ACATGCATGCCAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTTATTTGTAGAGCTCATCCATGCCA。
(2) Taking the PCR amplification product A3 obtained in the step (1), carrying out double digestion by using restriction enzymes Hind III and Sph I, and recovering the digestion product.
(3) Taking recombinant plasmid pACYC184-Pthr-trcThe vector backbone was recovered by double restriction with restriction enzymes Hind III and Sph I.
(4) Subjecting the cleavage product of step (2) to step (a)3) The vector skeleton is connected and transformed into Escherichia coli EC135, and plasmids are extracted from the transformants to obtain recombinant plasmids pACYC184-Pthr-trc-pheLA-gfp 3248. According to the sequencing result, recombinant plasmid pACYC184-P is recombinedthr-trc-pheLA-gfp3248 for structural description as follows: a specific DNA molecule is inserted between Xba I and Sph I enzyme cutting sites of the pACYC184 plasmid; the specific DNA molecule sequentially consists of the following elements from upstream to downstream: promoter P shown in 1 of sequence listingthr-trcThe restriction recognition sequence of restriction enzyme Hind III, RBS sequence "AGTCACTTAAGGAAACAAAC", nucleotides 1 to 176 of sequence 2 of the sequence Listing (comprising the complete phenylalanine attenuator and the sequence encoding the first 10 amino acid residues in the open reading frame of the pheA gene), the linker sequence "GGTTCTGGTTCTGGTTCT", the gfp gene shown in sequence 3 of the sequence Listing, and the terminator sequence "CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG".
Contains recombinant plasmid pACYC184-Pthr-trcEscherichia coli EC135 from-pheLA-GFP 3248 was named recombinant strain GFP 3248.
2. Construction of recombinant bacterium GFP3250
(1) Taking the genome DNA of escherichia coli K12MG1655 as a template, and carrying out PCR amplification by adopting a primer pair consisting of WY3250 and WY3258 to obtain a PCR amplification product A1; taking the pGFPuv vector as a template, and carrying out PCR amplification by adopting a primer pair consisting of WY3105 and WY1859 to obtain a PCR amplification product A2; and mixing the PCR amplification product A1 with the PCR amplification product A2 as a template, and performing PCR amplification by adopting a primer pair consisting of WY3250 and WY1859 to obtain a PCR amplification product A3.
WY3250：CCCAAGCTTCTTTTTTATTGATAACAAAAAGGCAACACT。
(2) Taking the PCR amplification product A3 obtained in the step (1), carrying out double digestion by using restriction enzymes Hind III and Sph I, and recovering the digestion product.
(3) Taking recombinant plasmid pACYC184-Pthr-trcThe vector backbone was recovered by double restriction with restriction enzymes Hind III and Sph I.
(4) Connecting the enzyme digestion product in the step (2) with the vector skeleton in the step (3), transforming the enzyme digestion product into escherichia coli EC135, and extracting plasmids from the transformant to obtain the plasmidRecombinant plasmid pACYC184-Pthrtrc-pheLA-gfp 3250. According to the sequencing result, recombinant plasmid pACYC184-P is recombinedthr-trc-pheLA-gfp3250 is structurally described as follows: a specific DNA molecule is inserted between Xba I and Sph I enzyme cutting sites of the pACYC184 plasmid; the specific DNA molecule sequentially consists of the following elements from upstream to downstream: promoter P shown in 1 of sequence listingthr-trcThe restriction recognition sequence of restriction endonuclease Hind III, nucleotides 117 to 176 of sequence 2 of the sequence Listing (including the phenylalanine attenuator truncation and the sequence encoding the first 10 amino acid residues in the open reading frame of the pheA gene), the linker sequence "GGTTCTGGTTCTGGTTCT", the gfp gene shown in sequence 3 of the sequence Listing, and the terminator sequence "CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG".
Contains recombinant plasmid pACYC184-Pthr-trcEscherichia coli EC135 of-pheLA-GFP 3250 was named recombinant strain GFP 3250.
3. Construction of recombinant bacterium GFP3251
(1) Taking the genome DNA of escherichia coli K12MG1655 as a template, and carrying out PCR amplification by adopting a primer pair consisting of WY3251 and WY3258 to obtain a PCR amplification product A1; taking the pGFPuv vector as a template, and carrying out PCR amplification by adopting a primer pair consisting of WY3105 and WY1859 to obtain a PCR amplification product A2; and mixing the PCR amplification product A1 with the PCR amplification product A2 as a template, and performing PCR amplification by adopting a primer pair consisting of WY3251 and WY1859 to obtain a PCR amplification product A3.
WY3251：CCCAAGCTTGATAACAAAAAGGCAACACTATGA。
(2) Taking the PCR amplification product A3 obtained in the step (1), carrying out double digestion by using restriction enzymes Hind III and Sph I, and recovering the digestion product.
(3) Taking recombinant plasmid pACYC184-Pthr-trcThe vector backbone was recovered by double restriction with restriction enzymes Hind III and Sph I.
(4) Connecting the enzyme digestion product in the step (2) with the vector skeleton in the step (3), transforming the enzyme digestion product into escherichia coli EC135, and extracting plasmids from the transformant to obtain a recombinant plasmid pACYC184-Pthr-trc-pheLA-gfp 3251. According to the sequencing result, recombinant plasmid pACYC184-P is recombinedthr-trcpheLA-gfp3251 intoThe row structure is described as follows: a specific DNA molecule is inserted between Xba I and Sph I enzyme cutting sites of the pACYC184 plasmid; the specific DNA molecule sequentially consists of the following elements from upstream to downstream: promoter P shown in 1 of sequence listingthr-trcThe restriction recognition sequence of restriction enzyme Hind III, nucleotides 127 th to 176 th in sequence 2 of the sequence listing (comprising the sequence encoding the first 10 amino acid residues in the open reading frame of the pheA gene with the phenylalanine attenuator completely removed), the linker sequence "GGTTCTGGTTCTGGTTCT", the gfp gene shown in sequence 3 of the sequence listing, and the terminator sequence "CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG".
Contains recombinant plasmid pACYC184-Pthr-trcEscherichia coli EC135 of-pheLA-GFP 3251 was named recombinant strain GFP 3251.
4. Construction of GFP controls
Recombinant plasmid pACYC184-Pthr-trcThe recombinant strain obtained by introducing Escherichia coli EC135 was designated as GFP control.
Third, GFP fluorescence intensity analysis
The test strains were: recombinant strain GFP3248, recombinant strain GFP3250 or recombinant strain GFP 3251.
A GFP control was set as a control strain.
1. The test strain or the control strain was inoculated into a liquid LB medium containing 34mg/L of chloramphenicol and cultured overnight at 37 ℃ with shaking at 220 rpm.
2. The bacterial liquid obtained in step 1 is inoculated into a liquid LB culture medium containing 34mg/L chloramphenicol according to the inoculation amount of 1%, and the culture is carried out for 12 hours at 37 ℃ and 220rpm with shaking.
3. And (3) adding 150 mu L of the bacterial liquid obtained in the step (2) into a 96-well plate with black edge and transparent bottom, and simultaneously detecting the cell density and GFP fluorescence signals by using a high-flux multifunctional microplate reader (INFINITE 200PRO type, Switzerland TECAN). The relevant parameter settings for measuring cell density are shown in table 1. The relevant parameter settings for the detection of GFP fluorescence signals are shown in Table 2.
TABLE 1
Absorbance (Absorbance)
Wavelength (wavelet) 600nm
Bandwidth (Bandwidth) 9nm
Flash times (Number of Flashes) 25
Establishing Time (Settle Time) 0ms
TABLE 2
Fluorescent Top Reading (Fluorescence Top Reading)
Excitation Wavelength (Excitation wavelet) 400nm
Emission Wavelength (Emission Wavelength) 510nm
Excitation Bandwidth (Excitation Bandwidth) 9nm
Emission Bandwidth (Emission Bandwidth) 20nm
Collection (Gain) 100 (Manual)
Flash times (Number of Flashes) 15
Integration Time (Integration Time) 20μs
Lag time (LagTime) 0μs
Establishing Time (Settle Time) 0ms
Z Position (Z-Position) 20000 μm (Manual)
The fluorescence intensity value for each test strain is measured fluorescence value ÷ cell density-measured fluorescence value for the control strain ÷ cell density for the control strain. Three replicates were set up and the corresponding mean and standard deviation results are shown in table 3.
Compared with the recombinant strain GFP3248 (completely retaining phenylalanine attenuator), the fluorescence intensity of the recombinant strain GFP3250 is improved by 5.2 times. Compared with the recombinant strain GFP3251 (completely removing phenylalanine attenuator), the fluorescence intensity of the recombinant strain GFP3250 is improved by 3.7 times. The result shows that the phenylalanine attenuator truncation positioned between the promoter and the target gene can be used as a regulatory element to promote the expression of the target gene.
The phenylalanine attenuator mutant is shown as n1-n2 nucleotides in sequence 2 of the sequence table, n1 is a natural number of 105-118 (n1 is preferably 117), and n2 is a natural number of 123-176 (n2 can be a natural number of 123-146 or 147-176, more specifically 123, 146 or 176). Phenylalanine attenuator mutants include phenylalanine attenuator truncations and phenylalanine attenuator variants (all referred to as variants in which additional nucleotides are linked downstream of the phenylalanine attenuator truncations). The phenylalanine attenuator truncation is shown as the n1-123 th nucleotide of the sequence 2 in the sequence table. The phenylalanine attenuator variant is shown as n1-n4 th nucleotides in the sequence 2 of the sequence table, wherein n4 is a natural number of more than 124 and less than 176 (n4 specifically can be a natural number of more than 124 and less than 146 or a natural number of more than 147 and less than 176, and more specifically can be 146 or 176).
TABLE 3
Intensity of fluorescence
Recombinant bacterium GFP3248 770.4±65.2
Recombinant bacterium GFP3250 4778.4±463.2
Recombinant bacterium GFP3251 1010.9±128.6
Example 2 preparation of phenylalanine
Firstly, constructing a recombinant plasmid pACYC184-PJJ
1. Synthetic sequence listingThe double-stranded DNA molecule (promoter P) shown in SEQ ID No. 4 of (1)JJ)。
2. And (3) performing PCR amplification by using the double-stranded DNA molecule prepared in the step (1) as a template and adopting a primer pair consisting of WY843 and WY842 to obtain a PCR amplification product.
WY843：TGCTCTAGACAATTCCGACGTCTAAGAAA；
WY842：CCCAAGCTTGGTCAGTGCGTCCTGCTGAT。
3. Taking the PCR amplification product obtained in the step 2, carrying out double enzyme digestion by using restriction enzymes Xba I and Hind III, and recovering the enzyme digestion product.
4. The vector backbone (about 4.1kb) was recovered by double digestion with restriction enzymes Xba I and Hind III from the pACYC184 plasmid.
5. Connecting the enzyme digestion product in the step 3 with the vector skeleton in the step 4 to obtain a recombinant plasmid pACYC184-PJJ。
Construction of two and three recombinant plasmids
1. Taking the genome DNA of escherichia coli K12MG1655 as a template, and carrying out PCR amplification by adopting a primer pair consisting of WY3248 and WY4020 to obtain a PCR amplification product A1; taking the genome DNA of escherichia coli K12MG1655 as a template, and carrying out PCR amplification by adopting a primer pair consisting of WY3250 and WY4020 to obtain a PCR amplification product A2; taking the genome DNA of escherichia coli K12MG1655 as a template, and carrying out PCR amplification by adopting a primer pair consisting of WY3251 and WY4020 to obtain a PCR amplification product A3; and (3) carrying out PCR amplification by using genome DNA of escherichia coli K12MG1655 as a template and adopting a primer pair consisting of WY4021 and WY4022 to obtain a PCR amplification product A4.
WY3248：CCCAAGCTTAGTCACTTAAGGAAACAAAC atgA；
WY3250：CCCAAGCTTCTTTTTTATTGATAACAAAAAGGCAACACT；
WY3251：CCCAAGCTTGATAACAAAAAGGCAACACTATGA；
WY4020：CTTCAACCAGCGCACAGGCTTGTTGCCC；
WY4021：GGGCAACAAGCCTGTGCGCTGGTTGAAG
WY4022：CGCGGATCCCGCACAGCGTTTTCAGAGT
WY4020 and WY4021 are used to introduce a point mutation (corresponding to nucleotide 1071 of SEQ ID NO: 2 of the sequence Listing, mutation G → T) in the gene encoding chorismate mutase-prephenate dehydratase bifunctional enzyme. The chorismate mutase-prephenate dehydratase bifunctional enzyme which is introduced into the genome of escherichia coli K12MG1655 and is coded by the corresponding gene before the point mutation is named as PheA protein (shown as a sequence 5 in a sequence table). The chorismate mutase-prephenate dehydratase bifunctional enzyme which is introduced with the point mutation and is coded by the corresponding gene is named as PheA protein (shown as a sequence 6 in a sequence table). The PheA protein differs from the PheA protein only in that the amino acid residue 309 of the PheA protein is mutated from glycine to cysteine, thereby relieving the feedback repression.
2. Mixing the PCR amplification product A1 obtained in the step 1 with the PCR amplification product A4 to be used as a template, and carrying out PCR amplification by adopting a primer pair consisting of WY3248 and WY4022 to obtain a PCR amplification product B1; mixing the PCR amplification product A2 obtained in the step 1 with the PCR amplification product A4 to be used as a template, and carrying out PCR amplification by adopting a primer pair consisting of WY3250 and WY4022 to obtain a PCR amplification product B2; and (3) mixing the PCR amplification product A3 obtained in the step (1) with the PCR amplification product A4 to be used as a template, and carrying out PCR amplification by adopting a primer pair consisting of WY3251 and WY4022 to obtain a PCR amplification product B3.
3. Taking recombinant plasmid pACYC184-PJJThe vector skeleton is recovered by double enzyme digestion with restriction enzymes Hind III and BamH I.
4. Taking the PCR amplification product B1 obtained in the step 2, carrying out double enzyme digestion by using restriction enzymes Hind III and BamH I, and recovering the enzyme digestion product.
5. Connecting the vector skeleton in the step 3 with the enzyme digestion product in the step 4 to obtain a recombinant plasmid pACYC184-PJJ-pheL3248And A. According to the sequencing result, recombinant plasmid pACYC184-P is recombinedJJ-pheL3248A is described as follows: a specific DNA molecule is inserted between Xba I and BamH I enzyme cutting sites of the pACYC184 plasmid; the specific DNA molecule sequentially consists of the following elements from upstream to downstream: promoter P shown as sequence 4 in sequence tableJJRestriction recognition sequence of restriction enzyme Hind III, RBS sequence "AGTCACTTAAGGAAACAAAC", sequenceDNA molecules shown in sequence 2 of the list.
6. Taking the PCR amplification product B2 obtained in the step 2, carrying out double enzyme digestion by using restriction enzymes Hind III and BamH I, and recovering the enzyme digestion product.
7. Connecting the vector skeleton in the step 3 with the enzyme digestion product in the step 6 to obtain a recombinant plasmid pACYC184-PJJ-pheL3250And A. According to the sequencing result, recombinant plasmid pACYC184-P is recombinedJJ-pheL3250A is described as follows: a specific DNA molecule is inserted between Xba I and BamH I enzyme cutting sites of the pACYC184 plasmid; the specific DNA molecule sequentially consists of the following elements from upstream to downstream: promoter P shown as sequence 4 in sequence tableJJThe restriction recognition sequence of restriction enzyme Hind III, DNA molecule shown by 117 th to 1413 rd nucleotides of sequence 2 of the sequence table.
8. Taking the PCR amplification product B3 obtained in the step 2, carrying out double enzyme digestion by using restriction enzymes Hind III and BamH I, and recovering the enzyme digestion product.
9. Connecting the vector skeleton in the step 3 with the enzyme digestion product in the step 8 to obtain a recombinant plasmid pACYC184-PJJ-pheL3251And A. According to the sequencing result, recombinant plasmid pACYC184-P is recombinedJJ-pheL3251A is described as follows: a specific DNA molecule is inserted between Xba I and BamH I enzyme cutting sites of the pACYC184 plasmid; the specific DNA molecule sequentially consists of the following elements from upstream to downstream: promoter P shown as sequence 4 in sequence tableJJThe restriction recognition sequence of restriction enzyme Hind III, the DNA molecule shown by 127 th to 1413 rd nucleotides of sequence 2 of the sequence table.
Thirdly, constructing three recombinant plasmids
1. And (3) performing PCR amplification by using a genome of escherichia coli K12MG1655 as a template and adopting a primer pair consisting of WY4023 and WY4024 to obtain a PCR amplification product.
WY4023：ACATGCATGCCAAAGCATAGCGGATTGTTTTC
WY4024：CGCGGATCCTTAAGCCACGCGAGCCGTCA
And in the PCR amplification product after sequencing, the nucleotide sequence between the enzyme cutting sites of Sph I and BamH I is shown as a sequence 7 in the sequence table, and the protein shown as a sequence 8 in the coding sequence table. The protein shown in the sequence 8 is 3-deoxy-D-arabinoheptulose-7-phosphate synthase (AroF protein). In the sequence 7 of the sequence table, the open reading frame is nucleotides 195 to 1265.
2. Taking the PCR amplification product obtained in the step 1, carrying out double enzyme digestion by using restriction enzymes Sph I and BamH I, and recovering the enzyme digestion product.
3. Taking recombinant plasmid pACYC184-PJJ-pheL3248And A, double enzyme digestion is carried out by using restriction enzymes Sph I and BamH I, and the carrier framework is recovered.
4. Connecting the enzyme digestion product in the step 2 with the vector skeleton in the step 3 to obtain a recombinant plasmid pACYC184-PJJ-pheL3248a-aroF. According to the sequencing result, recombinant plasmid pACYC184-P is recombinedJJ-pheL3248A × aroF performs the structural description as follows: the specific DNA molecule described in step two 5 is inserted between the Xba I and BamH I enzyme cutting sites of the pACYC184 plasmid, and aroF gene shown in sequence 7 of the sequence table is inserted between the Sph I and BamH I enzyme cutting sites (in the recombinant plasmid, the specific DNA molecule and the aroF gene exist reversely).
5. Taking recombinant plasmid pACYC184-PJJ-pheL3250And A, double enzyme digestion is carried out by using restriction enzymes Sph I and BamH I, and the carrier framework is recovered.
6. Connecting the enzyme digestion product in the step 2 with the vector skeleton in the step 5 to obtain a recombinant plasmid pACYC184-PJJ-pheL3250a-aroF. According to the sequencing result, recombinant plasmid pACYC184-P is recombinedJJ-pheL3250A × aroF performs the structural description as follows: the specific DNA molecule described in 7 of the second step is inserted between the Xba I enzyme cutting sites and the BamH I enzyme cutting sites of the pACYC184 plasmid, and the aroF gene shown in the sequence 7 of the sequence table is inserted between the Sph I enzyme cutting sites and the BamH I enzyme cutting sites (in the recombinant plasmid, the specific DNA molecule and the aroF gene exist reversely).
7. Taking recombinant plasmid pACYC184-PJJ-pheL3251And A, double enzyme digestion is carried out by using restriction enzymes Sph I and BamH I, and the carrier framework is recovered.
8. Connecting the enzyme digestion product in the step 2 with the vector skeleton in the step 7 to obtain the recombinantPlasmid pACYC184-PJJ-pheL3251a-aroF. According to the sequencing result, recombinant plasmid pACYC184-P is recombinedJJ-pheL3251A × aroF performs the structural description as follows: the specific DNA molecule described in 9 of the second step is inserted between the Xba I enzyme cutting sites and the BamH I enzyme cutting sites of the pACYC184 plasmid, and the aroF gene shown in the sequence 7 of the sequence table is inserted between the Sph I enzyme cutting sites and the BamH I enzyme cutting sites (in the recombinant plasmid, the specific DNA molecule and the aroF gene exist reversely).
Fourthly, constructing recombinant bacteria
Recombinant plasmid pACYC184-PJJ-pheL3248And introducing A-aroF into Escherichia coli K12MG1655 to obtain a recombinant strain, and naming the recombinant strain as engineering strain Phe 3248.
Recombinant plasmid pACYC184-PJJ-pheL3250Introducing A-aroF into Escherichia coli K12MG1655 to obtain recombinant bacteria, and naming the recombinant bacteria as engineering bacteria Phe 3250.
Recombinant plasmid pACYC184-PJJ-pheL3251Introducing A-aroF into Escherichia coli K12MG1655 to obtain recombinant bacteria, and naming the recombinant bacteria as engineering bacteria Phe 3251.
Third, shake flask fermentation test of phenylalanine engineering bacteria
The test strains were: engineering bacteria Phe3248, engineering bacteria Phe3250 or engineering bacteria Phe 3251.
1. Taking a test strain, streaking the test strain on a solid LB medium plate, and statically culturing the test strain at 37 ℃ for 12 hours.
2. After completing step 1, selecting thallus Porphyrae on the plate, inoculating into liquid LB culture medium, performing shake culture at 37 deg.C and 220rpm for 8 hr to obtain seed solution (OD)600nmThe value is 5.0).
3. After the step 2 is completed, inoculating the seed liquid into a fermentation culture medium according to the inoculation amount of 3%, and performing shake culture at 37 ℃ and 220 rpm.
Fermentation medium: 20.0g/L of glucose, 15.0g/L of ammonium sulfate, 2.0g/L of potassium dihydrogen phosphate, 2.0g/L of magnesium sulfate heptahydrate, 2.0g/L of yeast powder, 15.0g/L of calcium carbonate, 5mL/L of trace element mixed solution and the balance of water.
And (3) mixing trace element liquid: FeSO4·7H2O 10g/L、CaCl21.35g/L、ZnSO4·7H2O 2.25g/L、MnSO4·4H2O 0.5g/L、CuSO4·5H2O 1g/L、(NH4)6Mo7O24·4H2O 0.106g/L、Na2B4O7·10H2O0.23g/L、CoCl2·6H2O0.48 g/L, 35% HCl 10mL/L, and the balance water.
During the culture process, ammonia water is used to regulate the pH value of the reaction system to be kept between 6.8 and 7.0.
In the culture process, sampling is carried out once every 3-4h, the content of glucose is detected by using a biosensor analyzer SBA-40D, and when the content of glucose in the system is lower than 5g/L, glucose is supplemented and the concentration of glucose in the system reaches 10 g/L.
After culturing for 36h, sampling, centrifuging at 12000g for 2min, taking supernatant (namely fermentation supernatant), and detecting the concentration of L-phenylalanine.
The results are shown in Table 4 (mean. + -. standard deviation of three replicates). Compared with the engineering bacteria Phe3248 and Phe3251, the yield of L-phenylalanine produced by fermentation of the engineering bacteria Phe3250 is obviously improved.
TABLE 4
L-phenylalanine content (g/L) in fermentation supernatant
Engineering bacterium Phe3248 0.82±0.07
Engineering bacterium Phe3250 1.55±0.25
Engineering bacterium Phe3251 0.77±0.15
The detection method of the concentration of the L-phenylalanine comprises the following steps: the high performance liquid phase method is optimized on the basis of the detection method of amino acid in a reference (amino acid and biological resources, 2000, 22, 59-60), and the specific method is as follows (2, 4-dinitrofluorobenzene (FDBN) pre-column derivatization high performance liquid phase method):
10 μ L of the supernatant was placed in a 2mL centrifuge tube and 200 μ L of 0.5M NaHCO was added3Mixing the aqueous solution with 100 μ L of 1% (volume ratio) FDBN-acetonitrile solution, heating in water bath at 60 deg.C in dark place for 60min, cooling to room temperature, and adding 700 μ L0.04mol/L KH2PO4Aqueous solution (pH 7.2 ± 0.05, adjusted with 40g/L aqueous KOH) and shaken well, left for 15min, then filtered and the filtrate collected. The filtrate was used for loading, and the sample size was 15. mu.L.
The column was a C18 column (ZORBAX Eclipse XDB-C18, 4.6 x 150mm, Agilent, USA); column temperature: 40 ℃; ultraviolet detection wavelength: 360 nm; the mobile phase A is 0.04mol/L KH2PO4Aqueous solution (pH 7.2 ± 0.05, adjusted with 40g/100mL aqueous KOH), mobile phase B was 55% (by volume) aqueous acetonitrile, and the total flow rate of the mobile phase was 1 mL/min.
And (3) an elution process: at the beginning of elution (0min), the volume fraction of the mobile phase A in the total flow of the mobile phase is 86%, and the volume fraction of the mobile phase B in the total flow of the mobile phase is 14%; the elution process is divided into 4 stages, and the volume parts of the mobile phase A and the mobile phase B in the total flow of the mobile phase in each stage are linearly changed; the total flow rate of mobile phase A was 88% by volume, the total flow rate of mobile phase B was 12% by volume, at the end of phase 1 (2 min from the start), the total flow rate of mobile phase A was 86% by volume, the total flow rate of mobile phase B was 14% by volume, at the end of phase 2 (2 min from the end of phase 1), and the total flow rate of mobile phase A was 70% by volume, at the end of phase 3 (6 min from the end of phase 2), the volume fraction of mobile phase B in the total flow of mobile phase was 30%, the volume fraction of mobile phase a in the total flow of mobile phase at the end of phase 4 (10 min from the end of phase 3) was 30%, and the volume fraction of mobile phase B in the total flow of mobile phase was 70%.
And (3) preparing a standard curve by taking the commercially available L-phenylalanine as a standard substance, and calculating the phenylalanine concentration of the sample.
Finally, it should be noted that: it should be understood that the above examples are only for clearly illustrating the present invention and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications of the invention may be made without departing from the scope of the invention.
SEQUENCE LISTING
<110> institute of microbiology of Chinese academy of sciences
<120> phenylalanine attenuator mutant and phenylalanine operon for resolving feedback repression and use thereof
<130>GNCYX171071
<160>8
<170>PatentIn version 3.5
<210>1
<211>192
<212>DNA
<213> Artificial sequence
<400>1
gcttttcatt ctgactgcaa cgggcaatat gtctctgtgt ggattaaaaa aagagtgtct 60
gatagcagct tctgaactgg ttacctgccg tgagtaaatt aaaattttat tgacttaggt 120
cactaaatac tttaaccaat ataggcatag cgcacagaca gttgacaatt aatcatccgg 180
ctcgtataat gt 192
<210>2
<211>1413
<212>DNA
<213> Artificial sequence
<400>2
atgaaacaca taccgttttt cttcgcattc ttttttacct tcccctgaat gggaggcgtt 60
tcgtcgtgtg aaacagaatg cgaagacgaa caataaggcc tcccaaatcg gggggccttt 120
tttattgata acaaaaaggc aacactatga catcggaaaa cccgttactg gcgctgcgag 180
agaaaatcag cgcgctggat gaaaaattat tagcgttact ggcagaacgg cgcgaactgg 240
ccgtcgaggt gggaaaagcc aaactgctct cgcatcgccc ggtacgtgat attgatcgtg 300
aacgcgattt gctggaaaga ttaattacgc tcggtaaagc gcaccatctg gacgcccatt 360
acattactcg cctgttccag ctcatcattg aagattccgt attaactcag caggctttgc 420
tccaacaaca tctcaataaa attaatccgc actcagcacg catcgctttt ctcggcccca 480
aaggttctta ttcccatctt gcggcgcgcc agtatgctgc ccgtcacttt gagcaattca 540
ttgaaagtgg ctgcgccaaa tttgccgata tttttaatca ggtggaaacc ggccaggccg 600
actatgccgt cgtaccgatt gaaaatacca gctccggtgc cataaacgac gtttacgatc 660
tgctgcaaca taccagcttg tcgattgttg gcgagatgac gttaactatc gaccattgtt 720
tgttggtctc cggcactact gatttatcca ccatcaatac ggtctacagc catccgcagc 780
cattccagca atgcagcaaa ttccttaatc gttatccgca ctggaagatt gaatataccg 840
aaagtacgtc tgcggcaatg gaaaaggttg cacaggcaaa atcaccgcat gttgctgcgt 900
tgggaagcga agctggcggc actttgtacg gtttgcaggt actggagcgt attgaagcaa 960
atcagcgaca aaacttcacc cgatttgtgg tgttggcgcg taaagccatt aacgtgtctg 1020
atcaggttcc ggcgaaaacc acgttgttaa tggcgaccgg gcaacaagcc tgtgcgctgg 1080
ttgaagcgtt gctggtactg cgcaaccaca atctgattat gacccgtctg gaatcacgcc 1140
cgattcacgg taatccatgg gaagagatgt tctatctgga tattcaggcc aatcttgaat 1200
cagcggaaat gcaaaaagca ttgaaagagt taggggaaat cacccgttca atgaaggtat 1260
tgggctgtta cccaagtgag aacgtagtgc ctgttgatcc aacctgatga aaaggtgccg 1320
gatgatgtga atcatccggc actggattat tactggcgat tgtcattcgc ctgacgcaat 1380
aacacgcggc tttcactctg aaaacgctgt gcg 1413
<210>3
<211>717
<212>DNA
<213> Artificial sequence
<400>3
atgagtaaag gagaagaact tttcactgga gttgtcccaa ttcttgttga attagatggt 60
gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg aaggtgatgc aacatacgga 120
aaacttaccc ttaaatttat ttgcactact ggaaaactac ctgttccatg gccaacactt 180
gtcactactt tctcttatgg tgttcaatgc ttttcccgtt atccggatca tatgaaacgg 240
catgactttt tcaagagtgc catgcccgaa ggttatgtac aggaacgcac tatatctttc 300
aaagatgacg ggaactacaa gacgcgtgct gaagtcaagt ttgaaggtga tacccttgtt 360
aatcgtatcg agttaaaagg tattgatttt aaagaagatg gaaacattct cggacacaaa 420
ctcgagtaca actataactc acacaatgta tacatcacgg cagacaaaca aaagaatgga 480
atcaaagcta acttcaaaat tcgccacaac attgaagatg gatccgttca actagcagac 540
cattatcaac aaaatactcc aattggcgat ggccctgtcc ttttaccaga caaccattac 600
ctgtcgacac aatctgccct ttcgaaagat cccaacgaaa agcgtgacca catggtcctt 660
cttgagtttg taactgctgc tgggattaca catggcatgg atgagctcta caaataa 717
<210>4
<211>162
<212>DNA
<213> Artificial sequence
<400>4
caattccgac gtctaagaaa ccattattat catgacatta acctataaaa ataggcgtat 60
cacgaggccc tttcgtcttc acctcgagtc cctatcagtg atagagattg acctccctat 120
cagtgataga gatactgagc acatcagcag gacgcactga cc 162
<210>5
<211>386
<212>PRT
<213> Escherichia coli
<400>5
Met Thr Ser Glu Asn Pro Leu Leu Ala Leu Arg Glu Lys Ile Ser Ala
1 5 10 15
Leu Asp Glu Lys Leu Leu Ala Leu Leu Ala Glu Arg Arg Glu Leu Ala
20 25 30
Val Glu Val Gly Lys Ala Lys Leu Leu Ser His Arg Pro Val Arg Asp
35 40 45
Ile Asp Arg Glu Arg Asp Leu Leu Glu Arg Leu Ile Thr Leu Gly Lys
50 55 60
Ala His His Leu Asp Ala His Tyr Ile Thr Arg Leu Phe Gln Leu Ile
65 70 75 80
Ile Glu Asp Ser Val Leu Thr Gln Gln Ala Leu Leu Gln Gln His Leu
85 90 95
Asn Lys Ile Asn Pro His Ser Ala Arg Ile Ala Phe Leu Gly Pro Lys
100 105 110
Gly Ser Tyr Ser His Leu Ala Ala Arg Gln Tyr Ala Ala Arg His Phe
115 120 125
Glu Gln Phe Ile Glu Ser Gly Cys Ala Lys Phe Ala Asp Ile Phe Asn
130 135 140
Gln Val Glu Thr Gly Gln Ala Asp Tyr Ala Val Val Pro Ile Glu Asn
145 150 155 160
Thr Ser Ser Gly Ala Ile Asn Asp Val Tyr Asp Leu Leu Gln His Thr
165 170 175
Ser Leu Ser Ile Val Gly Glu Met Thr Leu Thr Ile Asp His Cys Leu
180 185 190
Leu Val Ser Gly Thr Thr Asp Leu Ser Thr Ile Asn Thr Val Tyr Ser
195 200 205
His Pro Gln Pro Phe Gln Gln Cys Ser Lys Phe Leu Asn Arg Tyr Pro
210 215 220
His Trp Lys Ile Glu Tyr Thr Glu Ser Thr Ser Ala Ala Met Glu Lys
225 230 235 240
Val Ala Gln Ala Lys Ser Pro His Val Ala Ala Leu Gly Ser Glu Ala
245 250 255
Gly Gly Thr Leu Tyr Gly Leu Gln Val Leu Glu Arg Ile Glu Ala Asn
260 265 270
Gln Arg Gln Asn Phe Thr Arg Phe Val Val Leu Ala Arg Lys Ala Ile
275 280 285
Asn Val Ser Asp Gln Val Pro Ala Lys Thr Thr Leu Leu Met Ala Thr
290 295 300
Gly Gln Gln Ala Gly Ala Leu Val Glu Ala Leu Leu Val Leu Arg Asn
305 310 315 320
His Asn Leu Ile Met Thr Arg Leu Glu Ser Arg Pro Ile His Gly Asn
325 330 335
Pro Trp Glu Glu Met Phe Tyr Leu Asp Ile Gln Ala Asn Leu Glu Ser
340 345 350
Ala Glu Met Gln Lys Ala Leu Lys Glu Leu Gly Glu Ile Thr Arg Ser
355 360 365
Met Lys Val Leu Gly Cys Tyr Pro Ser Glu Asn Val Val Pro Val Asp
370 375 380
Pro Thr
385
<210>6
<211>386
<212>PRT
<213> Artificial sequence
<400>6
Met Thr Ser Glu Asn Pro Leu Leu Ala Leu Arg Glu Lys Ile Ser Ala
1 5 10 15
Leu Asp Glu Lys Leu Leu Ala Leu Leu Ala Glu Arg Arg Glu Leu Ala
20 25 30
Val Glu Val Gly Lys Ala Lys Leu Leu Ser His Arg Pro Val Arg Asp
35 40 45
Ile Asp Arg Glu Arg Asp Leu Leu Glu Arg Leu Ile Thr Leu Gly Lys
50 55 60
Ala His His Leu Asp Ala His Tyr Ile Thr Arg Leu Phe Gln Leu Ile
65 70 75 80
Ile Glu Asp Ser Val Leu Thr Gln Gln Ala Leu Leu Gln Gln His Leu
85 90 95
Asn Lys Ile Asn Pro His Ser Ala Arg Ile Ala Phe Leu Gly Pro Lys
100 105 110
Gly Ser Tyr Ser His Leu Ala Ala Arg Gln Tyr Ala Ala Arg His Phe
115 120 125
Glu Gln Phe Ile Glu Ser Gly Cys Ala Lys Phe Ala Asp Ile Phe Asn
130 135 140
Gln Val Glu Thr Gly Gln Ala Asp Tyr Ala Val Val Pro Ile Glu Asn
145 150 155 160
Thr Ser Ser Gly Ala Ile Asn Asp Val Tyr Asp Leu Leu Gln His Thr
165 170 175
Ser Leu Ser Ile Val Gly Glu Met Thr Leu Thr Ile Asp His Cys Leu
180 185 190
Leu Val Ser Gly Thr Thr Asp Leu Ser Thr Ile Asn Thr Val Tyr Ser
195 200 205
His Pro Gln Pro Phe Gln Gln Cys Ser Lys Phe Leu Asn Arg Tyr Pro
210 215 220
His Trp Lys Ile Glu Tyr Thr Glu Ser Thr Ser Ala Ala Met Glu Lys
225 230 235 240
Val Ala Gln Ala Lys Ser Pro His Val Ala Ala Leu Gly Ser Glu Ala
245 250 255
Gly Gly Thr Leu Tyr Gly Leu Gln Val Leu Glu Arg Ile Glu Ala Asn
260 265 270
Gln Arg Gln Asn Phe Thr Arg Phe Val Val Leu Ala Arg Lys Ala Ile
275 280 285
Asn Val Ser Asp Gln Val Pro Ala Lys Thr Thr Leu Leu Met Ala Thr
290 295 300
Gly Gln Gln Ala Cys Ala Leu Val Glu Ala Leu Leu Val Leu Arg Asn
305 310 315 320
His Asn Leu Ile Met Thr Arg Leu Glu Ser Arg Pro Ile His Gly Asn
325 330 335
Pro Trp Glu Glu Met Phe Tyr Leu Asp Ile Gln Ala Asn Leu Glu Ser
340 345 350
Ala Glu Met Gln Lys Ala Leu Lys Glu Leu Gly Glu Ile Thr Arg Ser
355 360 365
Met Lys Val Leu Gly Cys Tyr Pro Ser Glu Asn Val Val Pro Val Asp
370 375 380
Pro Thr
385
<210>7
<211>1265
<212>DNA
<213> Escherichia coli
<400>7
caaagcatag cggattgttt tcaaagggag tgtaaattta tctatacaga ggtaagggtt 60
gaaagcgcga ctaaattgcc tgtgtaaata aaaatgtacg aaatatggat tgaaaacttt 120
actttatgtg ttatcgttac gtcatcctcg ctgaggatca actatcgcaa acgagcataa 180
acaggatcgc catcatgcaa aaagacgcgc tgaataacgt acatattacc gacgaacagg 240
ttttaatgac tccggaacaa ctgaaggccg cttttccatt gagcctgcaa caagaagccc 300
agattgctga ctcgcgtaaa agcatttcag atattatcgc cgggcgcgat cctcgtctgc 360
tggtagtatg tggtccttgt tccattcatg atccggaaac tgctctggaa tatgctcgtc 420
gatttaaagc ccttgccgca gaggtcagcg atagcctcta tctggtaatg cgcgtctatt 480
ttgaaaaacc ccgtaccact gtcggctgga aagggttaat taacgatccc catatggatg 540
gctcttttga tgtagaagcc gggctgcaga tcgcgcgtaa attgctgctt gagctggtga 600
atatgggact gccactggcg acggaagcgt tagatccgaa tagcccgcaa tacctgggcg 660
atctgtttag ctggtcagca attggtgctc gtacaacgga atcgcaaact caccgtgaaa 720
tggcctccgg gctttccatg ccggttggtt ttaaaaacgg caccgacggc agtctggcaa 780
cagcaattaa cgctatgcgc gccgccgccc agccgcaccg ttttgttggc attaaccagg 840
cagggcaggt tgcgttgcta caaactcagg ggaatccgga cggccatgtg atcctgcgcg 900
gtggtaaagc gccgaactat agccctgcgg atgttgcgca atgtgaaaaa gagatggaac 960
aggcgggact gcgcccgtct ctgatggtag attgcagcca cggtaattcc aataaagatt 1020
atcgccgtca gcctgcggtg gcagaatccg tggttgctca aatcaaagat ggcaatcgct 1080
caattattgg tctgatgatc gaaagtaata tccacgaggg caatcagtct tccgagcaac 1140
cgcgcagtga aatgaaatac ggtgtatccg taaccgatgc ctgcattagc tgggaaatga 1200
ccgatgcctt gctgcgtgaa attcatcagg atctgaacgg gcagctgacg gctcgcgtgg 1260
cttaa 1265
<210>8
<211>356
<212>PRT
<213> Escherichia coli
<400>8
Met Gln Lys Asp Ala LeuAsn Asn Val His Ile Thr Asp Glu Gln Val
1 5 10 15
Leu Met Thr Pro Glu Gln Leu Lys Ala Ala Phe Pro Leu Ser Leu Gln
20 25 30
Gln Glu Ala Gln Ile Ala Asp Ser Arg Lys Ser Ile Ser Asp Ile Ile
35 40 45
Ala Gly Arg Asp Pro Arg Leu Leu Val Val Cys Gly Pro Cys Ser Ile
50 55 60
His Asp Pro Glu Thr Ala Leu Glu Tyr Ala Arg Arg Phe Lys Ala Leu
65 70 75 80
Ala Ala Glu Val Ser Asp Ser Leu Tyr Leu Val Met Arg Val Tyr Phe
85 90 95
Glu Lys Pro Arg Thr Thr Val Gly Trp Lys Gly Leu Ile Asn Asp Pro
100 105 110
His Met Asp Gly Ser Phe Asp Val Glu Ala Gly Leu Gln Ile Ala Arg
115 120 125
Lys Leu Leu Leu Glu Leu Val Asn Met Gly Leu Pro Leu Ala Thr Glu
130 135 140
Ala Leu Asp Pro Asn Ser Pro Gln Tyr Leu Gly Asp Leu Phe Ser Trp
145 150 155 160
Ser Ala Ile Gly Ala Arg Thr Thr Glu Ser Gln Thr His Arg Glu Met
165 170 175
Ala Ser Gly Leu Ser Met Pro Val Gly Phe Lys Asn Gly Thr Asp Gly
180 185 190
Ser Leu Ala Thr Ala Ile Asn Ala Met Arg Ala Ala Ala Gln Pro His
195 200 205
Arg Phe Val Gly Ile Asn Gln Ala Gly Gln Val Ala Leu Leu Gln Thr
210 215 220
Gln Gly Asn Pro Asp Gly His Val Ile Leu Arg Gly Gly Lys Ala Pro
225 230 235 240
Asn Tyr Ser Pro Ala Asp Val Ala Gln Cys Glu Lys Glu Met Glu Gln
245 250 255
Ala Gly Leu Arg Pro Ser Leu Met Val Asp Cys Ser His Gly Asn Ser
260 265 270
Asn Lys Asp Tyr Arg Arg Gln Pro Ala Val Ala Glu Ser Val Val Ala
275 280 285
Gln Ile Lys Asp Gly Asn Arg Ser Ile Ile Gly Leu Met Ile Glu Ser
290 295 300
Asn Ile His Glu Gly Asn Gln Ser Ser Glu Gln Pro Arg Ser Glu Met
305 310 315 320
Lys Tyr Gly Val Ser Val Thr Asp Ala Cys Ile Ser Trp Glu Met Thr
325 330 335
Asp Ala Leu Leu Arg Glu Ile His Gln Asp Leu Asn Gly Gln Leu Thr
340 345 350
Ala Arg Val Ala
355

Claims (10)

  1. The DNA molecule A is (a1), (a4) or (a 5):
    (a1) a DNA molecule shown as the 117 th-176 th nucleotide of the sequence 2 in the sequence table;
    (a4) a DNA molecule obtained by ligating a tag sequence to the terminus of (a 1);
    (a5) and (a1) connecting the linker to the terminus of the DNA molecule.
  2. 2. Use of the DNA molecule a of claim 1 for promoting expression of a gene of a downstream order.
  3. DNA molecule B comprising, in order from upstream to downstream: the DNA molecule A of claim 1 and a gene of interest.
  4. The DNA molecule C comprises the following components in sequence from upstream to downstream: a promoter, the DNA molecule A of claim 1, a gene of interest and a terminator.
  5. DNA molecule D, which is obtained by removing nucleotides 1 to 116 of phenylalanine attenuator in phenylalanine operon gene; the phenylalanine operon gene is shown as nucleotides 1 to 1307 of a sequence 2 in a sequence table or nucleotides 1 to 1413 of the sequence 2 in the sequence table.
  6. The DNA molecule E is obtained by modifying phenylalanine operon genes as follows: (1) removing nucleotides 1 to 116 of the phenylalanine attenuator; (2) mutating a gene encoding chorismate mutase-prephenate dehydratase bifunctional enzyme from a gene encoding a wild protein to a gene encoding a mutant protein from which feedback repression is removed; the phenylalanine operon gene is shown as nucleotides 1 to 1307 of a sequence 2 in a sequence table or nucleotides 1 to 1413 of the sequence 2 in the sequence table.
  7. 7. A recombinant vector or recombinant bacterium comprising the DNA molecule of claim 5 or 6.
  8. 8. Use of the recombinant bacterium of claim 7 for the preparation of phenylalanine.
  9. 9. A method for improving the ability of a microorganism to produce phenylalanine comprising the steps of: deleting nucleotides 1 to 116 counted from the 1 st position of the phenylalanine attenuator in the phenylalanine operon gene of the microorganism; the phenylalanine operon gene is shown as nucleotides 1 to 1307 of a sequence 2 in a sequence table or nucleotides 1 to 1413 of the sequence 2 in the sequence table.
  10. 10. A method for derepressing the feedback of a phenylalanine operon in a microorganism, comprising the steps of: deleting nucleotides 1 to 116 counted from the 1 st position of the phenylalanine attenuator in the phenylalanine operon gene of the microorganism; the phenylalanine operon gene is shown as nucleotides 1 to 1307 of a sequence 2 in a sequence table or nucleotides 1 to 1413 of the sequence 2 in the sequence table.
CN201710403515.XA 2016-10-27 2017-06-01 Phenylalanine attenuator mutants and phenylalanine operons addressing feedback repression and their uses Active CN107287198B (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CN201710403515.XA CN107287198B (en) 2017-06-01 2017-06-01 Phenylalanine attenuator mutants and phenylalanine operons addressing feedback repression and their uses
EP17864640.2A EP3533872A4 (en) 2016-10-27 2017-10-24 Method for modifying amino acid attenuator and use of same in production
CN201780003425.XA CN108473990A (en) 2016-10-27 2017-10-24 The remodeling method of amino acid attenuator and its application in production
PCT/CN2017/107453 WO2018077159A1 (en) 2016-10-27 2017-10-24 Method for modifying amino acid attenuator and use of same in production
US16/345,669 US11492616B2 (en) 2016-10-27 2017-10-24 Method for modifying amino acid attenuator and use of same in production

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710403515.XA CN107287198B (en) 2017-06-01 2017-06-01 Phenylalanine attenuator mutants and phenylalanine operons addressing feedback repression and their uses

Publications (2)

Publication Number Publication Date
CN107287198A CN107287198A (en) 2017-10-24
CN107287198B true CN107287198B (en) 2020-07-07

Family

ID=60094598

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710403515.XA Active CN107287198B (en) 2016-10-27 2017-06-01 Phenylalanine attenuator mutants and phenylalanine operons addressing feedback repression and their uses

Country Status (1)

Country Link
CN (1) CN107287198B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113801901B (en) * 2021-07-30 2024-05-24 新泰市佳禾生物科技有限公司 Method for producing L-phenylalanine by fermentation

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106520801A (en) * 2016-10-27 2017-03-22 中国科学院微生物研究所 Threonine attenuator mutant, application thereof and method for removing feedback repression of threonine operon

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106520801A (en) * 2016-10-27 2017-03-22 中国科学院微生物研究所 Threonine attenuator mutant, application thereof and method for removing feedback repression of threonine operon

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
integration of E.coli aroG-pheA tandem genes into corynebacterium glutamicum tyrA locus and its effect on l-phenylalanine biosynthesis;liu DX et al.;《world j gastroenterol》;20041231;第10卷(第24期);3683-3687 *
大肠杆菌苯丙氨酸生物合成的调控研究;刘艳华;《中国优秀硕士学位论文全文数据库 基础科学辑》;20110615;第2页前言,第3页最后一段-第41页第1段, *
衰减子与基因表达的调控;严锦文等;《生物学通报》;19921231;14-16 *

Also Published As

Publication number Publication date
CN107287198A (en) 2017-10-24

Similar Documents

Publication Publication Date Title
CN103492553B (en) For producing the method for cadaverine and recombinant microorganism
EP2811028B1 (en) Process for producing L-valine employing recombinant Corynebacteria comprising the propionate-inducible ilvBN operon
CN108559747A (en) Novel promoter and its application
CN106520801B (en) Threonine attenuator mutant, application thereof and method for relieving feedback repression of threonine operon
CN113201535B (en) Mutant of glutamate dehydrogenase gene promoter and application thereof
CN110423734A (en) The microorganism of L-lysine productivity with enhancing and for by using the microorganism generate L-lysine method
CN107287197B (en) Histidine attenuator mutants and histidine operons addressing feedback repression and their uses
CN107058323B (en) Engineering bacterium based on ilv attenuator and application thereof in production of isoleucine
CN110195087A (en) With the method for the bacterial fermentation production L-lysine for changing ppc gene
WO2024045620A1 (en) Recombinant strain for producing 2&#39;-fucosyllactose, construction method, and use
CN112592880A (en) Pseudouridine-producing engineering bacterium and application thereof
EP3533872A1 (en) Method for modifying amino acid attenuator and use of same in production
KR20200010285A (en) Genomic Engineering of Biosynthetic Pathways Inducing Increased NADPH
CN107236738B (en) Tryptophan attenuator mutant, application thereof and method for relieving feedback repression of tryptophan attenuator
CN107287198B (en) Phenylalanine attenuator mutants and phenylalanine operons addressing feedback repression and their uses
CN112375726B (en) Genetically engineered bacterium for producing L-homoserine and application thereof
CN112725254B (en) L-homoserine production strain and construction method and application thereof
CN111718936B (en) Ammonium salt inducible promoter and application thereof in regulating and controlling expression of target gene
CN107287196B (en) Mutant of ilv attenuator, related engineering bacterium and application of mutant in producing valine
WO2008020595A1 (en) Novel method for utilization of microbial mutant
CN112375771B (en) Homoserine biosensor and construction method and application thereof
CN112852764B (en) Mutant protein of ketonizing enzyme and application
CN107810269A (en) Novel promoter and application thereof
CN112251457B (en) Adaptive evolution method and application of 4-hydroxyisoleucine producing strain
CN110234767A (en) The method for producing the microorganism of the corynebacterium of L-arginine and producing L-arginine using it

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant