CN107287198A - Phenylalanine attenuator mutants and phenylalanine operons addressing feedback repression and their uses - Google Patents

Phenylalanine attenuator mutants and phenylalanine operons addressing feedback repression and their uses Download PDF

Info

Publication number
CN107287198A
CN107287198A CN201710403515.XA CN201710403515A CN107287198A CN 107287198 A CN107287198 A CN 107287198A CN 201710403515 A CN201710403515 A CN 201710403515A CN 107287198 A CN107287198 A CN 107287198A
Authority
CN
China
Prior art keywords
phenylalanine
sequence
attenuator
leu
dna molecular
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710403515.XA
Other languages
Chinese (zh)
Other versions
CN107287198B (en
Inventor
刘树文
温廷益
孙建建
肖海涵
张芸
商秀玲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Microbiology of CAS
Original Assignee
Institute of Microbiology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Microbiology of CAS filed Critical Institute of Microbiology of CAS
Priority to CN201710403515.XA priority Critical patent/CN107287198B/en
Priority to PCT/CN2017/107453 priority patent/WO2018077159A1/en
Priority to US16/345,669 priority patent/US11492616B2/en
Priority to CN201780003425.XA priority patent/CN108473990A/en
Priority to EP17864640.2A priority patent/EP3533872A4/en
Publication of CN107287198A publication Critical patent/CN107287198A/en
Application granted granted Critical
Publication of CN107287198B publication Critical patent/CN107287198B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/22—Tryptophan; Tyrosine; Phenylalanine; 3,4-Dihydroxyphenylalanine
    • C12P13/222—Phenylalanine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/01—Hydro-lyases (4.2.1)
    • C12Y402/01051—Prephenate dehydratase (4.2.1.51)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y504/00—Intramolecular transferases (5.4)
    • C12Y504/99—Intramolecular transferases (5.4) transferring other groups (5.4.99)
    • C12Y504/99005—Chorismate mutase (5.4.99.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses phenylalanine attenuator mutants, phenylalanine operons for solving feedback repression and application thereof. The phenylalanine attenuator mutant provided by the invention is a DNA molecule shown by n1-n2 th nucleotides in a sequence 2; 105 is more than or equal to n1 is more than or equal to 118, 123 is more than or equal to n2 is more than or equal to 176. The phenylalanine operon gene for releasing attenuation regulation is obtained by removing nucleotides 1 to n3 of a phenylalanine attenuator in the phenylalanine operon gene; 104 is less than or equal to n3 is less than or equal to 117. The method for protecting and relieving feedback repression of phenylalanine operon in microorganism comprises the following steps: deletion of the phenylalanine operon gene of the microorganism from position 1 to position n3 of the phenylalanine attenuator. By adopting the scheme provided by the invention, the yield of the phenylalanine and the derivative thereof can be obviously improved, and the method has great application and popularization values in the production field of the phenylalanine and the derivative thereof.

Description

Phenylalanine attenuator mutant and solve feedback repression phenylalanine operator with And their application
Technical field
The invention belongs to biological technical field, and in particular to phenylalanine attenuator mutant and the benzene for solving feedback repression Alanine operator and their application.
Background technology
L-phenylalanine (L-Phenylalanine) is one of 8 kinds of essential amino acids of humans and animals, is mainly used in Gao Tian The raw material of degree novel sweetener Aspartame low in calories, is also widely used for food, feed addictive and medicine and other fields. The main method of industrialized production L-phenylalanine is microbe fermentation method both at home and abroad at present.In addition, L-phenylalanine can be with By the further derivative synthesis D-phenylalanine of microbial metabolism approach, phenylpyruvic acid, mandelic acid, phenylacetate, phenylethanol, The compound of the significant application values such as phenyl ethylamine, styrene and cinnamic acid.However, in microorganism L-phenylalanine route of synthesis It is the critical limiting factor of high-efficiency fermenting production L-phenylalanine and its derivative and control methods are more complicated.
Microbe synthesis amino acid (such as L-Histidine, L-threonine, L-phenylalanine, L-Leu, ILE and L-Trp etc.) the transcriptional expression of operon gene there is Attenuation adjustable mechanism.When intracellular specific amino acid concentration is higher, The premature transcription termination of amino acid operator.On the contrary, when acid heat for intracellular specific amino, RNA polymerase transcription amino acid Operator.
During producing L-phenylalanine by microorganism fermentation or derivatives thereof, intracellular L-phenylalanine is progressively accumulated, and is led to The expression of above-mentioned decay regulatory mechanism feedback repression phenylalanine operator is crossed, is unfavorable for the life of L-phenylalanine or derivatives thereof Thing is synthesized.Therefore, in order to build the efficient engineering bacteria for producing phenylalanine or derivatives thereof, exploitation phenylalanine attenuator is needed badly The method of transformation, to improve phenylalanine operator expression and phenylalanine yield.
The content of the invention
It is an object of the invention to provide the phenylalanine operator of phenylalanine attenuator mutant and solution feedback repression And their application.
Present invention protection DNA molecular first (phenylalanine attenuator mutant) first, be following (a1), (a2), (a3), Or (a5) (a4)：
(a1) DNA molecular shown in 1-n2 nucleotides of sequence 2 n-th of sequence table；N1 is oneself of less than more than 105 118 So number (n1 is preferably 117), n2 for less than more than 123 176 natural number (n2 concretely less than more than 123 146 natural number Or less than more than 147 176 natural number, can be more specifically 123,146 or 176)；
(a2) DNA molecular obtained after the 1st to n3 nucleotides of phenylalanine attenuator is removed, n3 is more than 104 Less than 117 natural number (n3 is preferably 116)；
(a3) will phenylalanine attenuator correlated series the 1st to n3 nucleotides remove after obtained DNA molecular, n3 is Less than more than 104 117 natural number (n3 is preferably 116)；
(a4) DNA molecular obtained in (a1) or (a2) or (a3) end connection sequence label；
(a5) DNA molecular obtained in (a1) or (a2) or (a3) end connection catenation sequence.
Phenylalanine attenuator mutant is phenylalanine attenuator truncate or phenylalanine attenuator variant.Phenylpropyl alcohol ammonia Sour attenuator truncate is as shown in 1-123 nucleotides of sequence 2 n-th of sequence table.Such as sequence table of phenylalanine attenuator variant The 1-n4 nucleotides of sequence 2 n-th shown in, n4 for less than more than 124 176 natural number (n4 concretely more than 124 146 with Under natural number or less than more than 147 176 natural number, can be more specifically 146 or 176).
The present invention also protects application of the DNA molecular first in downstream destination gene expression is promoted.In the application, institute DNA molecular first is stated as controlling element.In the application, the DNA molecular first is located at promoter and the institute of the target gene Between the initiation codon for stating target gene.In the application, the promoter concretely sequence table 1 shown in promoter Pthr-trc.In the application, the gfp genes of the target gene concretely shown in the sequence 3 of sequence table.
The present invention also protects DNA molecular second, includes successively from upstream to downstream：The DNA molecular first and target gene.Institute State gfp gene of the target gene concretely shown in the sequence 3 of sequence table.
The present invention also protects DNA molecular third, includes successively from upstream to downstream：Promoter, the DNA molecular first, purpose Gene and terminator.The promoter concretely sequence table 1 shown in promoter Pthr-trc.The target gene specifically may be used For the gfp genes shown in the sequence 3 of sequence table.The terminator is concretely “CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG”。
In the DNA molecular first or the DNA molecular second or the DNA molecular third, without phenylalanine attenuator the 1st To n3 nucleotides, n3 is less than more than 104 117 natural number (n3 is preferably 116).
The DNA molecular second is made up of following element successively from upstream to downstream：The sequence 2 of sequence table the 117th to 176 Nucleotides, catenation sequence " GGTTCTGGTTCTGGTTCT ", the gfp genes shown in the sequence 3 of sequence table
The DNA molecular third is made up of following element successively from upstream to downstream：Promoter shown in the 1 of sequence table Pthr-trc, restriction enzyme Hind III restriction endonuclease recognition sequence, the 117th to 176 nucleotides of sequence 2 of sequence table, even Connect sequence " GGTTCTGGTTCTGGTTCT ", the gfp genes shown in the sequence 3 of sequence table, terminator sequence “CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG”。
The present invention also protection DNA molecular fourth (releases the phenylalanine operon gene of decay regulation and control, also known as phenylalanine is grasped Indulge sub- gene mutation body), it is after the 1st to n3 nucleotides of phenylalanine attenuator in phenylalanine operon gene is removed Obtained DNA molecular；N3 is less than more than 104 117 natural number (n3 is preferably 116).
The present invention also protects DNA molecular penta, is obtained after phenylalanine operon gene is carried out into following two transformations DNA molecular：(1) the 1st to n3 nucleotides of phenylalanine attenuator is removed；N3 is less than more than 104 117 natural number (n3 Preferably 116)；(2) by the gene of encoding chorismate mutase-prephenate dehydratase bifunctional enzyme from the base for encoding wild albumen Cause sports the gene of the mutain of Coded Discharge feedback repression.
The mutain for relieving feedback repression concretely PheA* albumen.
The wild albumen concretely PheA albumen.
The DNA molecular of the DNA molecular penta concretely shown in the 117th to 1307 nucleotides of sequence 2 of sequence table.
The DNA molecular of the DNA molecular penta concretely shown in the 117th to 1413 nucleotides of sequence 2 of sequence table.
Recombinant vector containing the DNA molecular fourth or the DNA molecular penta falls within protection scope of the present invention.
Recombinant bacterium containing the DNA molecular fourth or the DNA molecular penta falls within protection scope of the present invention.
The recombinant bacterium can be overexpressed for the DNA molecular fourth or the DNA molecular penta are imported out into bacterium germination Recombinant bacterium.It is described go out bacterium germination be Escherichia bacteria or corynebacterium genus bacteria.The Escherichia bacteria is concretely Escherichia coli, such as e. coli k-12 or its derivative strain.The corynebacterium genus bacteria concretely Corynebacterium glutamicum, example Such as Corynebacterium glutamicum 13032.It is described go out bacterium germination can be will the Arabic ketoheptose -7- phosphate synthases of coding 3- deoxidations-D- The recombinant bacterium that the initial bacterium of channel genes of (AroF albumen) obtains.The initial bacterium is that Escherichia bacteria or Corynebacterium are thin Bacterium.The Escherichia bacteria concretely Escherichia coli, such as e. coli k-12 or its derivative strain.The bar bacterium Belong to bacterium concretely Corynebacterium glutamicum, such as Corynebacterium glutamicum 13032.Encode AroF albumen gene also can with it is described DNA molecular fourth goes out bacterium germination described in importing together.The gene of coding AroF albumen can also import described together with the DNA molecular penta Go out bacterium germination.
AroF albumen is following (b1) or (b2)：
(b1) protein being made up of the amino acid sequence shown in sequence in sequence table 8；
(b2) by the amino acid sequence of sequence 8 is by the substitution of one or several amino acid residues and/or missing and/or adds Plus and with the protein as derived from sequence 8 of the Arabic ketoheptose -7- phosphate synthase functions of 3- deoxidations-D-.
Encode AroF albumen gene ORFs can as sequence table sequence 7 in the 195th to 1265 nucleotides It is shown.
The gene for encoding AroF albumen can be as shown in the sequence 7 of sequence table.
The present invention also application of the recombinant bacterium in phenylalanine is prepared described in protection any of the above.
When producing phenylalanine using the recombinant bacterium, using recombinant bacterium described in fermentation medium culture.
The fermentation medium can be rich medium or minimal medium.Culture medium includes carbon source, nitrogen Source, inorganic ions, antibiotic and other trophic factors.As carbon source, the carbohydrates such as glucose, lactose, galactolipin can be used； Can also be the alcohols such as glycerine, mannitol；The organic acids such as gluconic acid, citric acid, succinic acid can also be used.It is used as nitrogen Source, can use ammoniacal liquor, ammonium sulfate, ammonium phosphate, ammonium chloride etc. inorganic nitrogen-sourced；Corn steep liquor, soybean meal hydrolysate, hair can also be used The organic nitrogen sources such as hair powder, yeast extract, peptone.Inorganic ions is included in iron, calcium, magnesium, manganese, molybdenum, cobalt, copper, potassium plasma One or more.Other trophic factors also include the vitamins such as biotin, vitamin B1, pyridoxal.
Carbon source in the fermentation medium is glucose.
The fermentation medium is concretely：Glucose 20.0g/L, ammonium sulfate 15.0g/L, potassium dihydrogen phosphate 2.0g/L, Epsom salt 2.0g/L, dusty yeast 2.0g/L, calcium carbonate 15.0g/L, micro-mixed liquor 5mL/L, surplus is water.
Micro-mixed liquor：FeSO4·7H2O 10g/L、CaCl2 1.35g/L、ZnSO4·7H2O 2.25g/L、 MnSO4·4H2O 0.5g/L、CuSO4·5H2O 1g/L、(NH4)6Mo7O24·4H2O 0.106g/L、Na2B4O7·10H2O 0.23g/L、CoCl2·6H2O 0.48g/L, 35%HCl 10mL/L, surplus are water.
The condition of the culture is concretely：37 DEG C, 220rpm concussion and cultivates 36h.
The condition of the culture is concretely：Seed liquor is seeded in fermentation medium with 3% inoculum concentration, 37 DEG C, 220rpm concussion and cultivates 36h.The preparation method of seed liquor is as follows：Recombinant bacterium is seeded in LB liquid medium, 37 DEG C, 220rpm shaken cultivation 8h, obtain seed liquor.The OD of the seed liquor600nmValue concretely 5.0.
Following process control is carried out during the culture：In incubation, the pH value of reaction system is adjusted with ammoniacal liquor It is set to maintain 6.8-7.0；In incubation, every 3-4h samplings once, glucose content is detected, when the glucose in system When content is less than 5g/L, adds glucose and the concentration of glucose in system is reached 10g/L.
The present invention also protects a kind of method for the ability for improving micro-organisms phenylalanine, comprises the following steps：Delete The the 1st to the n3 nucleotides started counting up in the phenylalanine operon gene of microorganism from phenylalanine attenuator the 1st；n3 For less than more than 104 117 natural number (n3 is preferably 116).The microorganism is the microorganism with phenylalanine operator. The microorganism concretely Escherichia microorganism belonging to genus.The Escherichia microorganism belonging to genus concretely Escherichia coli, more Body can be e. coli k-12 or its derivative strain.
The present invention also protects a kind of method for releasing phenylalanine operator feedback repression in microorganism, including following step Suddenly：Delete the 1st to the n3 core started counting up in the phenylalanine operon gene of microorganism from phenylalanine attenuator the 1st Thuja acid；N3 is less than more than 104 117 natural number (n3 is preferably 116).The microorganism is with phenylalanine operator Microorganism.The microorganism concretely Escherichia microorganism belonging to genus.The Escherichia microorganism belonging to genus concretely large intestine bar Bacterium, more specifically can be e. coli k-12 or its derivative strain.
Phenylalanine operon gene described in any of the above includes phenylalanine attenuator and encoding chorismate mutase-pre- The gene of benzoic acid dehydratase bifunctional enzyme (PheA* albumen or PheA albumen).
PheA* albumen is following (c1) or (c2)：
(c1) protein being made up of the amino acid sequence shown in sequence in sequence table 6；
(c2) by the amino acid sequence of sequence 6 is by the substitution of one or several amino acid residues and/or missing and/or adds Plus and the protein as derived from sequence 6 with chorismate mutase-prephenate dehydratase bifunctional enzyme function.
PheA albumen is following (d1) or (d2)：
(d1) protein being made up of the amino acid sequence shown in sequence in sequence table 5；
(d2) by the amino acid sequence of sequence 5 is by the substitution of one or several amino acid residues and/or missing and/or adds Plus and the protein as derived from sequence 5 with chorismate mutase-prephenate dehydratase bifunctional enzyme function.
The phenylalanine attenuator is specific as shown in the 1st to 123 nucleotides of sequence 2 of sequence table.
The phenylalanine attenuator correlated series is specific as shown in the 1st to 176 nucleotides of sequence 2 of sequence table.
The gene for encoding PheA* albumen is specific as shown in the 147th to 1307 nucleotides of sequence 2 of sequence table.
The phenylalanine operon gene is specific as shown in the 1st to 1307 nucleotides of sequence 2 of sequence table.
The phenylalanine operon gene is specific as shown in the 1st to 1413 nucleotides of sequence 2 of sequence table.
The concretely L-phenylalanine of phenylalanine described in any of the above.
The invention discloses a kind of method for transforming phenylalanine attenuator, this method is encoding leader in deletion attenuator Leading portion reverse complemental palindromic sequence in the gene pheL and terminator loop-stem structure of peptide, and remain terminator back segment reverse complemental Palindromic sequence.The present inventor is by removing the particular sequence of phenylalanine attenuator, and unexpectedly obtaining can be notable Improve the phenylalanine attenuator mutant of gene expression dose.It is clear that according to the result of the test of the present invention, this area skill Art personnel inference can obtain easily, remove the portion of leading portion reverse complemental palindromic sequence in the terminator loop-stem structure of above-mentioned attenuator Sub-sequence, destroys two grades of complementary structures of terminator to a certain extent, it is equally possible to obtain the phenylalanine decay of similar performance Sub- mutant and phenylalanine operator mutation body.Therefore, the method for this similar transformation phenylalanine attenuator is also at this Among the protection domain of invention.It is clear that the method that the present invention releases the phenylalanine attenuator of Escherichia coli, can equally be answered Phenylalanine attenuator for other Pseudomonas.
The invention also discloses a kind of phenylalanine operon gene for releasing decay regulation and control, encoding leader is specially removed Leading portion reverse complemental palindromic sequence in the gene pheL and terminator loop-stem structure of peptide and retain terminator back segment reverse mutual and refill The phenylalanine operon gene of literary sequence.
The phenylalanine attenuator remodeling method provided using the present invention, significantly improves the phenylalanine fermentation of engineering bacteria Performance.The present invention can be used for bacterial fermentation to produce phenylalanine in practice.It is clear that the present invention can be additionally used in phenylalanine Metabolic pathway downstream compound such as D-phenylalanine, phenylpyruvic acid, mandelic acid, phenylacetate, phenylethanol, phenyl ethylamine, benzene second The biosynthesis of alkene and cinnamic acid etc..
In addition to phenylalanine operon gene in situ on transformation chromosome, other sides of gene overexpression are used as Method, the phenylalanine operon gene that the above-mentioned releasing decay regulation and control of >=1 copy are such as integrated on chromosome is same in this patent Protection domain within；In addition, being overexpressed the phenylalanine operon gene of above-mentioned releasing decay regulation and control equally by plasmid Within the protection domain of this patent.
The phenylalanine attenuator remodeling method provided using the present invention, significantly improves phenylalanine operator or other The expression of gene, so as to improve the phenylalanine of engineering bacteria and its fermenting property of derivative.The present invention obtains efficiently solution Except the nucleotide sequence of feedback repression, the bacterial strain of efficiently production phenylalanine is constructed, is provided to improve phenylalanine fermenting and producing New method.The scheme provided using the present invention, can significantly improve phenylalanine and its derivative yield, for phenylalanine And its production field of derivative has extremely important application and popularization value.
Embodiment
Following embodiment facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments Method, is conventional method unless otherwise specified.Test material used in following embodiments, is certainly unless otherwise specified What routine biochemistry reagent shop was commercially available.Quantitative test in following examples, is respectively provided with three repetition experiments, as a result makes even Average.As do not specialized in following embodiments, technological means used is well known to those skilled in the art in embodiment Conventional meanses and commercially available common instrument, reagent, reference can be made to《Molecular Cloning:A Laboratory guide (the 3rd edition)》(Science Press),《It is micro- Biological experiment (the 4th edition)》Manufacturers instruction of (Higher Education Publishing House) and corresponding instrument and reagent etc. is referred to.ATCC：https://www.atcc.org/。
E. coli k12 MG1655：ATCC numberings are 700926.PACYC184 plasmids：NEB companies, catalog number E4152S.PGFPuv carriers：Clontech Laboratories, Inc., Catalog No.632312.Escherichia coli EC135： It is recorded in following document：Zhang et al, Plos Genetics, 2012,8 (9):e1002987.
Embodiment 1, attenuator mutant regulate and control the expression of gfp genes
First, construction recombination plasmid pACYC184-Pthr-trc
1st, double chain DNA molecule (the promoter P shown in the sequence 1 of composition sequence tablethr-trc)。
2nd, using e. coli k12 MG1655 genomic DNA as template, the primer pair constituted using WY1947 and WY1948 Enter performing PCR amplification, obtain pcr amplification product.
WY1947：CTAGTCTAGAGCTTTTCATTCTGACTGCAAC；
WY1948：CCCAAGCTT ACATTATACGAGCCGGATGATTAATTGTCAACTGTCTGTGCGCTATGCCT。
3rd, the pcr amplification product that step 2 is obtained is taken, double digestion is carried out with restriction enzyme Xba I and Hind III, is returned Receive digestion products.
4th, pACYC184 plasmids are taken, double digestion is carried out with restriction enzyme Xba I and Hind III, carrier framework is reclaimed (about 4.1kb).
5th, the digestion products of step 3 and the carrier framework of step 4 are connected, obtains recombinant plasmid pACYC184-Pthr-trc。
2nd, each recombinant plasmid is built
1st, recombinant bacterium GFP3248 is built
(1) using e. coli k12 MG1655 genomic DNA as template, the primer constituted using WY3248 and WY3258 To entering performing PCR amplification, pcr amplification product A1 is obtained；Using pGFPuv carriers as template, using drawing that WY3105 and WY1859 is constituted Thing obtains pcr amplification product A2 to entering performing PCR amplification；Mould is used as after pcr amplification product A1 and pcr amplification product A2 is mixed Plate, enters performing PCR amplification using the WY3248 and WY1859 primer pairs constituted, obtains pcr amplification product A3.
WY3248：CCCAAGCTTAGTCACTTAAGGAAACAAAC atgA；
WY3258：AGTTCTTCTCCTTTACTCAT AGAACCAGAACCAGAACC CAGCGCCAGTAACGGGTTTTC；
WY3105：GGTTCTGGTTCTGGTTCT ATGAGTAAAGGAGAAGAACTTTTCA；
WY1859：ACATGCATGC CAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTTA TTTGTAGAGCTCATCCATGCCA。
(2) the pcr amplification product A3 for taking step (1) to obtain, with restriction enzyme Hind III and Sph I double digestions, Reclaim digestion products.
(3) recombinant plasmid pACYC184-P is takenthr-trc, with restriction enzyme Hind III and Sph I double digestions, reclaim Carrier framework.
(4) digestion products of step (2) and the carrier framework of step (3) are connected, change goes to Escherichia coli EC135, and Plasmid is extracted from transformant, recombinant plasmid pACYC184-P is obtainedthr-trc-pheLA-gfp3248.It is right according to sequencing result Recombinant plasmid pACYC184-Pthr-trc- pheLA-gfp3248 carries out structure and is described as follows：PACYC184 plasmids Xba I and Specific DNA molecular is inserted between Sph I restriction enzyme sites；Specific DNA molecular is made up of following element successively from upstream to downstream： Promoter P shown in the 1 of sequence tablethr-trc, restriction enzyme Hind III restriction endonuclease recognition sequence, RBS sequences " AGTCACTTAAGGAAACAAAC ", the 1st to 176 nucleotides of sequence 2 of sequence table (includes complete phenylalanine attenuator With the sequence that preceding 10 amino acid residues are encoded in the ORFs of pheA genes), catenation sequence " GGTTCTGGTTCTGGTTCT ", the gfp genes shown in the sequence 3 of sequence table, terminator sequence “CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG”。
Contain recombinant plasmid pACYC184-Pthr-trc- pheLA-gfp3248 Escherichia coli EC135 is named as recombinant bacterium GFP3248。
2nd, recombinant bacterium GFP3250 is built
(1) using e. coli k12 MG1655 genomic DNA as template, the primer constituted using WY3250 and WY3258 To entering performing PCR amplification, pcr amplification product A1 is obtained；Using pGFPuv carriers as template, using drawing that WY3105 and WY1859 is constituted Thing obtains pcr amplification product A2 to entering performing PCR amplification；Mould is used as after pcr amplification product A1 and pcr amplification product A2 is mixed Plate, enters performing PCR amplification using the WY3250 and WY1859 primer pairs constituted, obtains pcr amplification product A3.
WY3250：CCCAAGCTT CTTTTTTATTGATAACAAAAAGGCAACACT。
(2) the pcr amplification product A3 for taking step (1) to obtain, with restriction enzyme Hind III and Sph I double digestions, Reclaim digestion products.
(3) recombinant plasmid pACYC184-P is takenthr-trc, with restriction enzyme Hind III and Sph I double digestions, reclaim Carrier framework.
(4) digestion products of step (2) and the carrier framework of step (3) are connected, change goes to Escherichia coli EC135, and Plasmid is extracted from transformant, recombinant plasmid pACYC184-P is obtainedthr-trc-pheLA-gfp3250.It is right according to sequencing result Recombinant plasmid pACYC184-Pthr- trc-pheLA-gfp3250 carries out structure and is described as follows：In the Xba I of pACYC184 plasmids Specific DNA molecular is inserted between Sph I restriction enzyme sites；Specific DNA molecular is from upstream to downstream successively by following element group Into：Promoter P shown in the 1 of sequence tablethr-trc, restriction enzyme Hind III restriction endonuclease recognition sequence, the sequence of sequence table The 117th to 176 nucleotides of row 2 (including before being encoded in the ORFs of phenylalanine attenuator truncate and pheA genes The sequence of 10 amino acid residues), catenation sequence " GGTTCTGGTTCTGGTTCT ", the gfp bases shown in the sequence 3 of sequence table Cause, terminator sequence " CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG ".
Contain recombinant plasmid pACYC184-Pthr-trc- pheLA-gfp3250 Escherichia coli EC135 is named as recombinant bacterium GFP3250。
3rd, recombinant bacterium GFP3251 is built
(1) using e. coli k12 MG1655 genomic DNA as template, the primer constituted using WY3251 and WY3258 To entering performing PCR amplification, pcr amplification product A1 is obtained；Using pGFPuv carriers as template, using drawing that WY3105 and WY1859 is constituted Thing obtains pcr amplification product A2 to entering performing PCR amplification；Mould is used as after pcr amplification product A1 and pcr amplification product A2 is mixed Plate, enters performing PCR amplification using the WY3251 and WY1859 primer pairs constituted, obtains pcr amplification product A3.
WY3251：CCCAAGCTT GATAACAAAAAGGCAACACTATGA。
(2) the pcr amplification product A3 for taking step (1) to obtain, with restriction enzyme Hind III and Sph I double digestions, Reclaim digestion products.
(3) recombinant plasmid pACYC184-P is takenthr-trc, with restriction enzyme Hind III and Sph I double digestions, reclaim Carrier framework.
(4) digestion products of step (2) and the carrier framework of step (3) are connected, change goes to Escherichia coli EC135, and Plasmid is extracted from transformant, recombinant plasmid pACYC184-P is obtainedthr-trc-pheLA-gfp3251.It is right according to sequencing result Recombinant plasmid pACYC184-Pthr-trc- pheLA-gfp3251 carries out structure and is described as follows：PACYC184 plasmids Xba I and Specific DNA molecular is inserted between Sph I restriction enzyme sites；Specific DNA molecular is made up of following element successively from upstream to downstream： Promoter P shown in the 1 of sequence tablethr-trc, restriction enzyme Hind III restriction endonuclease recognition sequence, the sequence 2 of sequence table 127th to 176 nucleotides (sequence of preceding 10 amino acid residues of coding in the ORFs comprising pheA genes, and it is complete Eliminate phenylalanine attenuator entirely), catenation sequence " GGTTCTGGTTCTGGTTCT ", the gfp bases shown in the sequence 3 of sequence table Cause, terminator sequence " CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG ".
Contain recombinant plasmid pACYC184-Pthr-trc- pheLA-gfp3251 Escherichia coli EC135 is named as recombinant bacterium GFP3251。
4th, GFP controls are built
By recombinant plasmid pACYC184-Pthr-trcEscherichia coli EC135 is imported, obtained recombinant bacterium is named as GFP controls.
3rd, GFP Fluorescence Intensity Assays
Test strain is：Recombinant bacterium GFP3248, recombinant bacterium GFP3250 or recombinant bacterium GFP3251.
Set GFP to compare and be used as control strain.
1st, test strain or control strain are seeded in the LB liquid medium of the chloramphenicol containing 34mg/L, 37 DEG C, 220rpm shaken cultivations are stayed overnight.
2nd, the bacterium solution that step 1 is obtained is taken, the LB liquid medium of the chloramphenicol containing 34mg/L is inoculated according to 1% inoculum concentration In, 37 DEG C, 220rpm shaken cultivations 12 hours.
3rd, the bacterium solution for taking 150 μ L steps 2 to obtain, adds in 96 orifice plates that black surround is revealed the exact details, uses high flux multifunctional enzyme mark Instrument (INFINITE 200PRO types, Switzerland TECAN) is while detect cell density and GFP fluorescence signals.Detect the phase of cell density Related parameter sets and is shown in Table 1.The relative parameters setting of detection GFP fluorescence signals is shown in Table 2.
Table 1
Absorbance (Absorbance)
Wavelength (Wavelength) 600nm
Bandwidth (Bandwidth) 9nm
Guide number (Number of Flashes) 25
Setup time (Settle Time) 0ms
Table 2
Read (Fluorescence Top Reading) in fluorescence top
Excitation wavelength (Excitation Wavelength) 400nm
Launch wavelength (Emission Wavelength) 510nm
Excite bandwidth (Excitation Bandwidth) 9nm
Transmitted bandwidth (Emission Bandwidth) 20nm
Collect (Gain) 100 (manually, Manual)
Guide number (Number of Flashes) 15
The time of integration (Integration Time) 20μs
Lag time (LagTime) 0μs
Setup time (Settle Time) 0ms
Z location (Z-Position) 20000 μm (manually, Manual)
The actual measurement fluorescent value ÷ of the fluorescence intensity level of each test strain=actual measurement fluorescent value ÷ cell densities-control strain The cell density of control strain.Three repetitions are set to test, corresponding average value and standard deviation the results are shown in Table 3.
Compared with recombinant bacterium GFP3248 (phenylalanine attenuator is fully retained), recombinant bacterium GFP3250 fluorescence intensity is carried It is high 5.2 times.Compared with recombinant bacterium GFP3251 (removing phenylalanine attenuator completely), recombinant bacterium GFP3250 fluorescence intensity Improve 3.7 times.As a result show, the phenylalanine attenuator truncate between promoter and target gene can be used as tune Element is controlled, promotes the expression of target gene.
Phenylalanine attenuator mutant is as shown in 1-n2 nucleotides of sequence 2 n-th of sequence table, and n1 is more than 105 118 Following natural number (n1 is preferably 117), n2 for less than more than 123 176 natural number (n2 concretely less than more than 123 146 Natural number or less than more than 147 176 natural number, can be more specifically 123,146 or 176).Phenylalanine attenuator mutant Including phenylalanine attenuator truncate and phenylalanine attenuator variant, (full name is in phenylalanine attenuator truncate downstream Connect the variant of other nucleotides).1-123 nucleotides institutes of sequence 2 n-th of phenylalanine attenuator truncate such as sequence table Show.Phenylalanine attenuator variant is as shown in 1-n4 nucleotides of sequence 2 n-th of sequence table, and n4 is less than more than 124 176 (n4 concretely less than more than 124 146 natural number or less than more than 147 176 natural number more specifically can be 146 to natural number Or 176).
Table 3
Fluorescence intensity
Recombinant bacterium GFP3248 770.4±65.2
Recombinant bacterium GFP3250 4778.4±463.2
Recombinant bacterium GFP3251 1010.9±128.6
Embodiment 2, prepare phenylalanine
First, construction recombination plasmid pACYC184-PJJ
1st, double chain DNA molecule (the promoter P shown in the sequence 4 of composition sequence tableJJ)。
2nd, the double chain DNA molecule using step 1 preparation enters performing PCR as template using the WY843 and WY842 primer pairs constituted Amplification, obtains pcr amplification product.
WY843：TGCTCTAGACAATTCCGACGTCTAAGAAA；
WY842：CCCAAGCTT GGTCAGTGCGTCCTGCTGAT。
3rd, the pcr amplification product that step 2 is obtained is taken, double digestion is carried out with restriction enzyme Xba I and Hind III, is returned Receive digestion products.
4th, pACYC184 plasmids are taken, double digestion is carried out with restriction enzyme Xba I and Hind III, carrier framework is reclaimed (about 4.1kb).
5th, the digestion products of step 3 and the carrier framework of step 4 are connected, obtains recombinant plasmid pACYC184-PJJ。
2nd, the structure of three recombinant plasmids
1st, using e. coli k12 MG1655 genomic DNA as template, the primer pair constituted using WY3248 and WY4020 Enter performing PCR amplification, obtain pcr amplification product A1；Using e. coli k12 MG1655 genomic DNA as template, using WY3250 Enter performing PCR amplification with the WY4020 primer pairs constituted, obtain pcr amplification product A2；With e. coli k12 MG1655 genome DNA is template, enters performing PCR amplification using the WY3251 and WY4020 primer pairs constituted, obtains pcr amplification product A3；With large intestine Bacillus K12MG1655 genomic DNA is template, enters performing PCR amplification using the WY4021 and WY4022 primer pairs constituted, obtains Pcr amplification product A4.
WY3248：CCCAAGCTTAGTCACTTAAGGAAACAAAC atgA；
WY3250：CCCAAGCTTCTTTTTTATTGATAACAAAAAGGCAACACT；
WY3251：CCCAAGCTTGATAACAAAAAGGCAACACTATGA；
WY4020：CTTCAACCAGCGCACAGGCTTGTTGCCC；
WY4021：GGGCAACAAGCCTGTGCGCTGGTTGAAG
WY4022：CGCGGATCC CGCACAGCGTTTTCAGAGT
WY4020 and WY4021 is used to introduce in the gene of encoding chorismate mutase-prephenate dehydratase bifunctional enzyme One point mutation (the 1071st nucleotides of sequence 2 of point mutation correspondence sequence table, the mutation for being G → T).By Escherichia coli Chorismate mutase-prephenate dehydratase of the coding of the corresponding gene before above-mentioned point mutation is introduced in K12MG1655 genome Bifunctional enzyme is named as PheA albumen (as shown in the sequence 5 of sequence table).It is introduced into the coding of the corresponding gene after above-mentioned point mutation Chorismate mutase-prephenate dehydratase bifunctional enzyme be named as PheA* albumen (as shown in the sequence 6 of sequence table).With PheA albumen is compared, the difference of PheA* albumen be only that by the amino acids residue of PheA albumen the 309th by glycine mutation in order to Cysteine, so as to relieve feedback repression.
2nd, as template after pcr amplification product A1 and pcr amplification product the A4 mixing obtained step 1, using WY3248 Enter performing PCR amplification with the WY4022 primer pairs constituted, obtain pcr amplification product B1；The pcr amplification product A2 that step 1 is obtained As template after being mixed with pcr amplification product A4, performing PCR amplification is entered using the WY3250 and WY4022 primer pairs constituted, obtained Pcr amplification product B2；As template after pcr amplification product A3 and pcr amplification product the A4 mixing that step 1 is obtained, use The primer pair of WY3251 and WY4022 compositions enters performing PCR amplification, obtains pcr amplification product B3.
3rd, recombinant plasmid pACYC184-P is takenJJ, with restriction enzyme Hind III and BamH I double digestions, reclaim carrier Skeleton.
4th, the pcr amplification product B1 that step 2 is obtained is taken, with restriction enzyme Hind III and BamH I double digestions, is returned Receive digestion products.
5th, the carrier framework of step 3 and the digestion products of step 4 are connected, obtains recombinant plasmid pACYC184-PJJ- pheL3248A*.According to sequencing result, to recombinant plasmid pACYC184-PJJ-pheL3248A* carries out structure and is described as follows： Specific DNA molecular is inserted between Xba I and BamH the I restriction enzyme sites of pACYC184 plasmids；Specific DNA molecular from upstream extremely Downstream is made up of following element successively：Promoter P shown in the sequence 4 of sequence tableJJ, restriction enzyme Hind III digestion Recognition sequence, RBS sequences " AGTCACTTAAGGAAACAAAC ", the DNA molecular shown in the sequence 2 of sequence table.
6th, the pcr amplification product B2 that step 2 is obtained is taken, with restriction enzyme Hind III and BamH I double digestions, is returned Receive digestion products.
7th, the carrier framework of step 3 and the digestion products of step 6 are connected, obtains recombinant plasmid pACYC184-PJJ- pheL3250A*.According to sequencing result, to recombinant plasmid pACYC184-PJJ-pheL3250A* carries out structure and is described as follows： Specific DNA molecular is inserted between Xba I and BamH the I restriction enzyme sites of pACYC184 plasmids；Specific DNA molecular from upstream extremely Downstream is made up of following element successively：Promoter P shown in the sequence 4 of sequence tableJJ, restriction enzyme Hind III digestion Recognition sequence, the DNA molecular shown in the 117th to 1413 nucleotides of sequence 2 of sequence table.
8th, the pcr amplification product B3 that step 2 is obtained is taken, with restriction enzyme Hind III and BamH I double digestions, is returned Receive digestion products.
9th, the carrier framework of step 3 and the digestion products of step 8 are connected, obtains recombinant plasmid pACYC184-PJJ- pheL3251A*.According to sequencing result, to recombinant plasmid pACYC184-PJJ-pheL3251A* carries out structure and is described as follows： Specific DNA molecular is inserted between Xba I and BamH the I restriction enzyme sites of pACYC184 plasmids；Specific DNA molecular from upstream extremely Downstream is made up of following element successively：Promoter P shown in the sequence 4 of sequence tableJJ, restriction enzyme Hind III digestion Recognition sequence, the DNA molecular shown in the 127th to 1413 nucleotides of sequence 2 of sequence table.
3rd, three recombinant plasmids are built
1st, using e. coli k12 MG1655 genome as template, entered using the WY4023 and WY4024 primer pairs constituted Performing PCR is expanded, and obtains pcr amplification product.
WY4023：ACATGCATGC CAAAGCATAGCGGATTGTTTTC
WY4024：CGCGGATCC TTAAGCCACGCGAGCCGTCA
Through being sequenced, in pcr amplification product, the nucleotide sequence between Sph I and BamH I restriction enzyme sites is such as sequence table Shown in sequence 7, the protein shown in the sequence 8 of polynucleotide.Protein shown in sequence 8 is 3- deoxidations-D- Arabic heptan Ketose -7- phosphate synthases (AroF albumen).In the sequence 7 of sequence table, ORFs is the 195th to 1265 nucleotides.
2nd, the pcr amplification product that step 1 is obtained is taken, with restriction enzyme Sph I and BamH I double digestions, digestion is reclaimed Product.
3rd, recombinant plasmid pACYC184-P is takenJJ-pheL3248A*, with restriction enzyme Sph I and BamH I double digestions, Reclaim carrier framework.
4th, the digestion products of step 2 and the carrier framework of step 3 are connected, obtains recombinant plasmid pACYC184-PJJ- pheL3248A*-aroF.According to sequencing result, to recombinant plasmid pACYC184-PJJ-pheL3248A*-aroF carries out structure description It is as follows：The specific DNA described in the 5 of step 2 is inserted between Xba I and BamH the I restriction enzyme sites of pACYC184 plasmids Molecule, inserted between Sph I and BamH I restriction enzyme sites shown in the sequence 7 of sequence table aroF genes (in recombinant plasmid, Specific DNA molecular reversely exists with aroF genes).
5th, recombinant plasmid pACYC184-P is takenJJ-pheL3250A*, with restriction enzyme Sph I and BamH I double digestions, Reclaim carrier framework.
6th, the digestion products of step 2 and the carrier framework of step 5 are connected, obtains recombinant plasmid pACYC184-PJJ- pheL3250A*-aroF.According to sequencing result, to recombinant plasmid pACYC184-PJJ-pheL3250A*-aroF carries out structure description It is as follows：The specific DNA described in the 7 of step 2 is inserted between Xba I and BamH the I restriction enzyme sites of pACYC184 plasmids Molecule, inserted between Sph I and BamH I restriction enzyme sites shown in the sequence 7 of sequence table aroF genes (in recombinant plasmid, Specific DNA molecular reversely exists with aroF genes).
7th, recombinant plasmid pACYC184-P is takenJJ-pheL3251A*, with restriction enzyme Sph I and BamH I double digestions, Reclaim carrier framework.
8th, the digestion products of step 2 and the carrier framework of step 7 are connected, obtains recombinant plasmid pACYC184-PJJ- pheL3251A*-aroF.According to sequencing result, to recombinant plasmid pACYC184-PJJ-pheL3251A*-aroF carries out structure description It is as follows：The specific DNA described in the 9 of step 2 is inserted between Xba I and BamH the I restriction enzyme sites of pACYC184 plasmids Molecule, inserted between Sph I and BamH I restriction enzyme sites shown in the sequence 7 of sequence table aroF genes (in recombinant plasmid, Specific DNA molecular reversely exists with aroF genes).
4th, recombinant bacterium is built
By recombinant plasmid pACYC184-PJJ-pheL3248A*-aroF imports e. coli k12 MG1655, obtains recombinant bacterium, It is named as engineering bacteria Phe3248.
By recombinant plasmid pACYC184-PJJ-pheL3250A*-aroF imports e. coli k12 MG1655, obtains recombinant bacterium, It is named as engineering bacteria Phe3250.
By recombinant plasmid pACYC184-PJJ-pheL3251A*-aroF imports e. coli k12 MG1655, obtains recombinant bacterium, It is named as engineering bacteria Phe3251.
3rd, the shake flask fermentation experiment of phenylalanine engineering bacteria
Test strain is：Engineering bacteria Phe3248, engineering bacteria Phe3250 or engineering bacteria Phe3251.
1st, test strain is taken, streak inoculation is in solid LB media flat board, 37 DEG C of quiescent cultures 12 hours.
2nd, complete after step 1, the lawn on picking flat board is seeded in LB liquid medium, 37 DEG C, 220rpm vibration trainings 8h is supported, seed liquor (OD is obtained600nmValue=5.0).
3rd, complete after step 2, seed liquor is seeded in fermentation medium according to 3% inoculum concentration, 37 DEG C, 220rpm shakes Swing culture.
Fermentation medium：Glucose 20.0g/L, ammonium sulfate 15.0g/L, potassium dihydrogen phosphate 2.0g/L, epsom salt 2.0g/L, dusty yeast 2.0g/L, calcium carbonate 15.0g/L, micro-mixed liquor 5mL/L, surplus is water.
Micro-mixed liquor：FeSO4·7H2O 10g/L、CaCl2 1.35g/L、ZnSO4·7H2O 2.25g/L、 MnSO4·4H2O 0.5g/L、CuSO4·5H2O 1g/L、(NH4)6Mo7O24·4H2O 0.106g/L、Na2B4O7·10H2O 0.23g/L、CoCl2·6H2O 0.48g/L, 35%HCl 10mL/L, surplus are water.
In incubation, the pH value for adjusting reaction system with ammoniacal liquor makes it maintain 6.8-7.0.
In incubation, every 3-4h samplings once, glucose content is detected using bio-sensing analyzer SBA-40D, When the glucose content in system is less than 5g/L, adds glucose and the concentration of glucose in system is reached 10g/L.
Cultivate and sampled after 36h, 12000g is centrifuged 2 minutes, take supernatant (i.e. fermentation supernatant), detection L-phenylalanine is dense Degree.
It the results are shown in Table 4 (mean+SDs of three repetition experiments).With engineering bacteria Phe3248 and engineering bacteria Phe3251 is compared, and the yield of engineering bacteria Phe3250 fermenting and producing L-phenylalanines is significantly improved.
Table 4
L-phenylalanine content (g/L) in fermentation supernatant
Engineering bacteria Phe3248 0.82±0.07
Engineering bacteria Phe3250 1.55±0.25
Engineering bacteria Phe3251 0.77±0.15
The detection method of L-phenylalanine concentration：High-efficient liquid phase technique, bibliography (amino acid and living resources, 2000, 22,59-60) optimized on the basis of amino acid detection method, following (DNF (FDBN) post of specific method Preceding derivative high-efficient liquid phase technique)：
10 μ L of supernatant liquid are taken in 2mL centrifuge tubes, 200 μ L 0.5M NaHCO are added3The aqueous solution and the (volumes of 100 μ L 1% Than) FDBN- acetonitrile solutions, the dark place heated at constant temperature 60min in 60 DEG C of water-baths is subsequently cooled to room temperature, then adds 700 μ L 0.04mol/L KH2PO4The aqueous solution (pH=7.2 ± 0.05 adjusts pH with the 40g/L KOH aqueous solution) simultaneously shakes up, and stands 15min, Then filter and collect filtrate.Filtrate is used for loading, and sample size is 15 μ L.
Chromatographic column is C18 posts (ZORBAX Eclipse XDB-C18,4.6*150mm, Agilent, USA)；Column temperature：40 ℃；Ultraviolet detection wavelength：360nm；Mobile phase A is 0.04mol/L KH2PO4(40g/ is used in pH=7.2 ± 0.05 to the aqueous solution The 100mL KOH aqueous solution adjusts pH), Mobile phase B is 55% (volume ratio) acetonitrile solution, and mobile phase total flow is 1mL/min.
Elution process：It is 86%, flowing that elution initial time (0min) mobile phase A, which accounts for the volume parts of mobile phase total flow, The volume parts that phase B accounts for mobile phase total flow are 14%；Elution process is divided into mobile phase A and flowing in 4 stages, each stage The volume parts that phase B accounts for mobile phase total flow are linear change；1st stage (the common carry out 2min since initial time) terminates When mobile phase A to account for the volume parts of mobile phase total flow be that the volume parts that 88%, Mobile phase B accounts for mobile phase total flow are 12%, mobile phase A accounts for the body of mobile phase total flow at the end of the 2nd stage (the common carry out 2min since the 1st finish time in stage) Product number is that the volume parts that 86%, Mobile phase B accounts for mobile phase total flow are 14%, and the 3rd stage is (from the 2nd finish time in stage Start common carry out 6min) at the end of mobile phase A account for the volume parts of mobile phase total flow for 70%, that Mobile phase B accounts for mobile phase is total The volume parts of flow are 30%, and mobile phase A is accounted at the end of the 4th stage (the common carry out 10min since the 3rd finish time in stage) The volume parts of mobile phase total flow are that the volume parts that 30%, Mobile phase B accounts for mobile phase total flow are 70%.
Standard curve is made by standard items of commercially available L-phenylalanine, the concentration of phenylalanine of sample is calculated.
Finally it should be noted that：Obviously, above-described embodiment is only intended to clearly illustrate example of the present invention, and simultaneously The non-restriction to embodiment.For those of ordinary skill in the field, it can also do on the basis of the above description Go out other various forms of changes or variation.There is no necessity and possibility to exhaust all the enbodiments.And thus drawn Among the obvious changes or variations that Shen goes out is still in protection scope of the present invention.
SEQUENCE LISTING
<110>Institute of Microorganism, Academia Sinica
<120>Phenylalanine attenuator mutant and phenylalanine operator and their application for solving feedback repression
<130> GNCYX171071
<160> 8
<170> PatentIn version 3.5
<210> 1
<211> 192
<212> DNA
<213>Artificial sequence
<400> 1
gcttttcatt ctgactgcaa cgggcaatat gtctctgtgt ggattaaaaa aagagtgtct 60
gatagcagct tctgaactgg ttacctgccg tgagtaaatt aaaattttat tgacttaggt 120
cactaaatac tttaaccaat ataggcatag cgcacagaca gttgacaatt aatcatccgg 180
ctcgtataat gt 192
<210> 2
<211> 1413
<212> DNA
<213>Artificial sequence
<400> 2
atgaaacaca taccgttttt cttcgcattc ttttttacct tcccctgaat gggaggcgtt 60
tcgtcgtgtg aaacagaatg cgaagacgaa caataaggcc tcccaaatcg gggggccttt 120
tttattgata acaaaaaggc aacactatga catcggaaaa cccgttactg gcgctgcgag 180
agaaaatcag cgcgctggat gaaaaattat tagcgttact ggcagaacgg cgcgaactgg 240
ccgtcgaggt gggaaaagcc aaactgctct cgcatcgccc ggtacgtgat attgatcgtg 300
aacgcgattt gctggaaaga ttaattacgc tcggtaaagc gcaccatctg gacgcccatt 360
acattactcg cctgttccag ctcatcattg aagattccgt attaactcag caggctttgc 420
tccaacaaca tctcaataaa attaatccgc actcagcacg catcgctttt ctcggcccca 480
aaggttctta ttcccatctt gcggcgcgcc agtatgctgc ccgtcacttt gagcaattca 540
ttgaaagtgg ctgcgccaaa tttgccgata tttttaatca ggtggaaacc ggccaggccg 600
actatgccgt cgtaccgatt gaaaatacca gctccggtgc cataaacgac gtttacgatc 660
tgctgcaaca taccagcttg tcgattgttg gcgagatgac gttaactatc gaccattgtt 720
tgttggtctc cggcactact gatttatcca ccatcaatac ggtctacagc catccgcagc 780
cattccagca atgcagcaaa ttccttaatc gttatccgca ctggaagatt gaatataccg 840
aaagtacgtc tgcggcaatg gaaaaggttg cacaggcaaa atcaccgcat gttgctgcgt 900
tgggaagcga agctggcggc actttgtacg gtttgcaggt actggagcgt attgaagcaa 960
atcagcgaca aaacttcacc cgatttgtgg tgttggcgcg taaagccatt aacgtgtctg 1020
atcaggttcc ggcgaaaacc acgttgttaa tggcgaccgg gcaacaagcc tgtgcgctgg 1080
ttgaagcgtt gctggtactg cgcaaccaca atctgattat gacccgtctg gaatcacgcc 1140
cgattcacgg taatccatgg gaagagatgt tctatctgga tattcaggcc aatcttgaat 1200
cagcggaaat gcaaaaagca ttgaaagagt taggggaaat cacccgttca atgaaggtat 1260
tgggctgtta cccaagtgag aacgtagtgc ctgttgatcc aacctgatga aaaggtgccg 1320
gatgatgtga atcatccggc actggattat tactggcgat tgtcattcgc ctgacgcaat 1380
aacacgcggc tttcactctg aaaacgctgt gcg 1413
<210> 3
<211> 717
<212> DNA
<213>Artificial sequence
<400> 3
atgagtaaag gagaagaact tttcactgga gttgtcccaa ttcttgttga attagatggt 60
gatgttaatg ggcacaaatt ttctgtcagt ggagagggtg aaggtgatgc aacatacgga 120
aaacttaccc ttaaatttat ttgcactact ggaaaactac ctgttccatg gccaacactt 180
gtcactactt tctcttatgg tgttcaatgc ttttcccgtt atccggatca tatgaaacgg 240
catgactttt tcaagagtgc catgcccgaa ggttatgtac aggaacgcac tatatctttc 300
aaagatgacg ggaactacaa gacgcgtgct gaagtcaagt ttgaaggtga tacccttgtt 360
aatcgtatcg agttaaaagg tattgatttt aaagaagatg gaaacattct cggacacaaa 420
ctcgagtaca actataactc acacaatgta tacatcacgg cagacaaaca aaagaatgga 480
atcaaagcta acttcaaaat tcgccacaac attgaagatg gatccgttca actagcagac 540
cattatcaac aaaatactcc aattggcgat ggccctgtcc ttttaccaga caaccattac 600
ctgtcgacac aatctgccct ttcgaaagat cccaacgaaa agcgtgacca catggtcctt 660
cttgagtttg taactgctgc tgggattaca catggcatgg atgagctcta caaataa 717
<210> 4
<211> 162
<212> DNA
<213>Artificial sequence
<400> 4
caattccgac gtctaagaaa ccattattat catgacatta acctataaaa ataggcgtat 60
cacgaggccc tttcgtcttc acctcgagtc cctatcagtg atagagattg acctccctat 120
cagtgataga gatactgagc acatcagcag gacgcactga cc 162
<210> 5
<211> 386
<212> PRT
<213>Escherichia coli
<400> 5
Met Thr Ser Glu Asn Pro Leu Leu Ala Leu Arg Glu Lys Ile Ser Ala
1 5 10 15
Leu Asp Glu Lys Leu Leu Ala Leu Leu Ala Glu Arg Arg Glu Leu Ala
20 25 30
Val Glu Val Gly Lys Ala Lys Leu Leu Ser His Arg Pro Val Arg Asp
35 40 45
Ile Asp Arg Glu Arg Asp Leu Leu Glu Arg Leu Ile Thr Leu Gly Lys
50 55 60
Ala His His Leu Asp Ala His Tyr Ile Thr Arg Leu Phe Gln Leu Ile
65 70 75 80
Ile Glu Asp Ser Val Leu Thr Gln Gln Ala Leu Leu Gln Gln His Leu
85 90 95
Asn Lys Ile Asn Pro His Ser Ala Arg Ile Ala Phe Leu Gly Pro Lys
100 105 110
Gly Ser Tyr Ser His Leu Ala Ala Arg Gln Tyr Ala Ala Arg His Phe
115 120 125
Glu Gln Phe Ile Glu Ser Gly Cys Ala Lys Phe Ala Asp Ile Phe Asn
130 135 140
Gln Val Glu Thr Gly Gln Ala Asp Tyr Ala Val Val Pro Ile Glu Asn
145 150 155 160
Thr Ser Ser Gly Ala Ile Asn Asp Val Tyr Asp Leu Leu Gln His Thr
165 170 175
Ser Leu Ser Ile Val Gly Glu Met Thr Leu Thr Ile Asp His Cys Leu
180 185 190
Leu Val Ser Gly Thr Thr Asp Leu Ser Thr Ile Asn Thr Val Tyr Ser
195 200 205
His Pro Gln Pro Phe Gln Gln Cys Ser Lys Phe Leu Asn Arg Tyr Pro
210 215 220
His Trp Lys Ile Glu Tyr Thr Glu Ser Thr Ser Ala Ala Met Glu Lys
225 230 235 240
Val Ala Gln Ala Lys Ser Pro His Val Ala Ala Leu Gly Ser Glu Ala
245 250 255
Gly Gly Thr Leu Tyr Gly Leu Gln Val Leu Glu Arg Ile Glu Ala Asn
260 265 270
Gln Arg Gln Asn Phe Thr Arg Phe Val Val Leu Ala Arg Lys Ala Ile
275 280 285
Asn Val Ser Asp Gln Val Pro Ala Lys Thr Thr Leu Leu Met Ala Thr
290 295 300
Gly Gln Gln Ala Gly Ala Leu Val Glu Ala Leu Leu Val Leu Arg Asn
305 310 315 320
His Asn Leu Ile Met Thr Arg Leu Glu Ser Arg Pro Ile His Gly Asn
325 330 335
Pro Trp Glu Glu Met Phe Tyr Leu Asp Ile Gln Ala Asn Leu Glu Ser
340 345 350
Ala Glu Met Gln Lys Ala Leu Lys Glu Leu Gly Glu Ile Thr Arg Ser
355 360 365
Met Lys Val Leu Gly Cys Tyr Pro Ser Glu Asn Val Val Pro Val Asp
370 375 380
Pro Thr
385
<210> 6
<211> 386
<212> PRT
<213>Artificial sequence
<400> 6
Met Thr Ser Glu Asn Pro Leu Leu Ala Leu Arg Glu Lys Ile Ser Ala
1 5 10 15
Leu Asp Glu Lys Leu Leu Ala Leu Leu Ala Glu Arg Arg Glu Leu Ala
20 25 30
Val Glu Val Gly Lys Ala Lys Leu Leu Ser His Arg Pro Val Arg Asp
35 40 45
Ile Asp Arg Glu Arg Asp Leu Leu Glu Arg Leu Ile Thr Leu Gly Lys
50 55 60
Ala His His Leu Asp Ala His Tyr Ile Thr Arg Leu Phe Gln Leu Ile
65 70 75 80
Ile Glu Asp Ser Val Leu Thr Gln Gln Ala Leu Leu Gln Gln His Leu
85 90 95
Asn Lys Ile Asn Pro His Ser Ala Arg Ile Ala Phe Leu Gly Pro Lys
100 105 110
Gly Ser Tyr Ser His Leu Ala Ala Arg Gln Tyr Ala Ala Arg His Phe
115 120 125
Glu Gln Phe Ile Glu Ser Gly Cys Ala Lys Phe Ala Asp Ile Phe Asn
130 135 140
Gln Val Glu Thr Gly Gln Ala Asp Tyr Ala Val Val Pro Ile Glu Asn
145 150 155 160
Thr Ser Ser Gly Ala Ile Asn Asp Val Tyr Asp Leu Leu Gln His Thr
165 170 175
Ser Leu Ser Ile Val Gly Glu Met Thr Leu Thr Ile Asp His Cys Leu
180 185 190
Leu Val Ser Gly Thr Thr Asp Leu Ser Thr Ile Asn Thr Val Tyr Ser
195 200 205
His Pro Gln Pro Phe Gln Gln Cys Ser Lys Phe Leu Asn Arg Tyr Pro
210 215 220
His Trp Lys Ile Glu Tyr Thr Glu Ser Thr Ser Ala Ala Met Glu Lys
225 230 235 240
Val Ala Gln Ala Lys Ser Pro His Val Ala Ala Leu Gly Ser Glu Ala
245 250 255
Gly Gly Thr Leu Tyr Gly Leu Gln Val Leu Glu Arg Ile Glu Ala Asn
260 265 270
Gln Arg Gln Asn Phe Thr Arg Phe Val Val Leu Ala Arg Lys Ala Ile
275 280 285
Asn Val Ser Asp Gln Val Pro Ala Lys Thr Thr Leu Leu Met Ala Thr
290 295 300
Gly Gln Gln Ala Cys Ala Leu Val Glu Ala Leu Leu Val Leu Arg Asn
305 310 315 320
His Asn Leu Ile Met Thr Arg Leu Glu Ser Arg Pro Ile His Gly Asn
325 330 335
Pro Trp Glu Glu Met Phe Tyr Leu Asp Ile Gln Ala Asn Leu Glu Ser
340 345 350
Ala Glu Met Gln Lys Ala Leu Lys Glu Leu Gly Glu Ile Thr Arg Ser
355 360 365
Met Lys Val Leu Gly Cys Tyr Pro Ser Glu Asn Val Val Pro Val Asp
370 375 380
Pro Thr
385
<210> 7
<211> 1265
<212> DNA
<213>Escherichia coli
<400> 7
caaagcatag cggattgttt tcaaagggag tgtaaattta tctatacaga ggtaagggtt 60
gaaagcgcga ctaaattgcc tgtgtaaata aaaatgtacg aaatatggat tgaaaacttt 120
actttatgtg ttatcgttac gtcatcctcg ctgaggatca actatcgcaa acgagcataa 180
acaggatcgc catcatgcaa aaagacgcgc tgaataacgt acatattacc gacgaacagg 240
ttttaatgac tccggaacaa ctgaaggccg cttttccatt gagcctgcaa caagaagccc 300
agattgctga ctcgcgtaaa agcatttcag atattatcgc cgggcgcgat cctcgtctgc 360
tggtagtatg tggtccttgt tccattcatg atccggaaac tgctctggaa tatgctcgtc 420
gatttaaagc ccttgccgca gaggtcagcg atagcctcta tctggtaatg cgcgtctatt 480
ttgaaaaacc ccgtaccact gtcggctgga aagggttaat taacgatccc catatggatg 540
gctcttttga tgtagaagcc gggctgcaga tcgcgcgtaa attgctgctt gagctggtga 600
atatgggact gccactggcg acggaagcgt tagatccgaa tagcccgcaa tacctgggcg 660
atctgtttag ctggtcagca attggtgctc gtacaacgga atcgcaaact caccgtgaaa 720
tggcctccgg gctttccatg ccggttggtt ttaaaaacgg caccgacggc agtctggcaa 780
cagcaattaa cgctatgcgc gccgccgccc agccgcaccg ttttgttggc attaaccagg 840
cagggcaggt tgcgttgcta caaactcagg ggaatccgga cggccatgtg atcctgcgcg 900
gtggtaaagc gccgaactat agccctgcgg atgttgcgca atgtgaaaaa gagatggaac 960
aggcgggact gcgcccgtct ctgatggtag attgcagcca cggtaattcc aataaagatt 1020
atcgccgtca gcctgcggtg gcagaatccg tggttgctca aatcaaagat ggcaatcgct 1080
caattattgg tctgatgatc gaaagtaata tccacgaggg caatcagtct tccgagcaac 1140
cgcgcagtga aatgaaatac ggtgtatccg taaccgatgc ctgcattagc tgggaaatga 1200
ccgatgcctt gctgcgtgaa attcatcagg atctgaacgg gcagctgacg gctcgcgtgg 1260
cttaa 1265
<210> 8
<211> 356
<212> PRT
<213>Escherichia coli
<400> 8
Met Gln Lys Asp Ala Leu Asn Asn Val His Ile Thr Asp Glu Gln Val
1 5 10 15
Leu Met Thr Pro Glu Gln Leu Lys Ala Ala Phe Pro Leu Ser Leu Gln
20 25 30
Gln Glu Ala Gln Ile Ala Asp Ser Arg Lys Ser Ile Ser Asp Ile Ile
35 40 45
Ala Gly Arg Asp Pro Arg Leu Leu Val Val Cys Gly Pro Cys Ser Ile
50 55 60
His Asp Pro Glu Thr Ala Leu Glu Tyr Ala Arg Arg Phe Lys Ala Leu
65 70 75 80
Ala Ala Glu Val Ser Asp Ser Leu Tyr Leu Val Met Arg Val Tyr Phe
85 90 95
Glu Lys Pro Arg Thr Thr Val Gly Trp Lys Gly Leu Ile Asn Asp Pro
100 105 110
His Met Asp Gly Ser Phe Asp Val Glu Ala Gly Leu Gln Ile Ala Arg
115 120 125
Lys Leu Leu Leu Glu Leu Val Asn Met Gly Leu Pro Leu Ala Thr Glu
130 135 140
Ala Leu Asp Pro Asn Ser Pro Gln Tyr Leu Gly Asp Leu Phe Ser Trp
145 150 155 160
Ser Ala Ile Gly Ala Arg Thr Thr Glu Ser Gln Thr His Arg Glu Met
165 170 175
Ala Ser Gly Leu Ser Met Pro Val Gly Phe Lys Asn Gly Thr Asp Gly
180 185 190
Ser Leu Ala Thr Ala Ile Asn Ala Met Arg Ala Ala Ala Gln Pro His
195 200 205
Arg Phe Val Gly Ile Asn Gln Ala Gly Gln Val Ala Leu Leu Gln Thr
210 215 220
Gln Gly Asn Pro Asp Gly His Val Ile Leu Arg Gly Gly Lys Ala Pro
225 230 235 240
Asn Tyr Ser Pro Ala Asp Val Ala Gln Cys Glu Lys Glu Met Glu Gln
245 250 255
Ala Gly Leu Arg Pro Ser Leu Met Val Asp Cys Ser His Gly Asn Ser
260 265 270
Asn Lys Asp Tyr Arg Arg Gln Pro Ala Val Ala Glu Ser Val Val Ala
275 280 285
Gln Ile Lys Asp Gly Asn Arg Ser Ile Ile Gly Leu Met Ile Glu Ser
290 295 300
Asn Ile His Glu Gly Asn Gln Ser Ser Glu Gln Pro Arg Ser Glu Met
305 310 315 320
Lys Tyr Gly Val Ser Val Thr Asp Ala Cys Ile Ser Trp Glu Met Thr
325 330 335
Asp Ala Leu Leu Arg Glu Ile His Gln Asp Leu Asn Gly Gln Leu Thr
340 345 350
Ala Arg Val Ala
355

Claims (10)

1.DNA molecule first, is following (a1), (a2), (a3), (a4) or (a5)：
(a1) DNA molecular shown in 1-n2 nucleotides of sequence 2 n-th of sequence table；N1 is less than more than 105 118 natural number, N2 is less than more than 123 176 natural number；
(a2) will phenylalanine attenuator the 1st to n3 nucleotides remove after obtained DNA molecular, n3 be more than 104 117 with Under natural number；
(a3) DNA molecular obtained after the 1st to n3 nucleotides of phenylalanine attenuator correlated series is removed, n3 is 104 Natural number of the above below 117；
(a4) DNA molecular obtained in (a1) or (a2) or (a3) end connection sequence label；
(a5) DNA molecular obtained in (a1) or (a2) or (a3) end connection catenation sequence.
2. application of the DNA molecular first described in claim 1 in downstream destination gene expression is promoted.
3.DNA molecule second, includes successively from upstream to downstream：DNA molecular first and target gene described in claim 1.
4.DNA molecules third, include successively from upstream to downstream：DNA molecular first, target gene described in promoter, claim 1 and Terminator.
5.DNA molecule fourths, are after the 1st to n3 nucleotides of phenylalanine attenuator in phenylalanine operon gene is removed Obtained DNA molecular；N3 is less than more than 104 117 natural number.
6.DNA molecules penta, are that phenylalanine operon gene is carried out into following two DNA moleculars obtained after transforming：(1) by benzene The the 1st to n3 nucleotides of alanine attenuator is removed；N3 is less than more than 104 117 natural number；(2) encoding chorismate is become The gene of position enzyme-prephenate dehydratase bifunctional enzyme is from encoding the gene mutation of wild albumen feedback repression for Coded Discharge The gene of mutain.
7. recombinant vector or recombinant bacterium containing DNA molecular described in claim 5 or 6.
8. application of the recombinant bacterium described in claim 7 in phenylalanine is prepared.
9. a kind of method for the ability for improving micro-organisms phenylalanine, comprises the following steps：Delete the phenylpropyl alcohol ammonia of microorganism The the 1st to the n3 nucleotides started counting up in sour operon gene from phenylalanine attenuator the 1st；N3 be more than 104 117 with Under natural number.
10. a kind of method for releasing phenylalanine operator feedback repression in microorganism, comprises the following steps：Delete microorganism The the 1st to the n3 nucleotides started counting up in phenylalanine operon gene from phenylalanine attenuator the 1st；N3 be 104 with Upper less than 117 natural number.
CN201710403515.XA 2016-10-27 2017-06-01 Phenylalanine attenuator mutants and phenylalanine operons addressing feedback repression and their uses Active CN107287198B (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
CN201710403515.XA CN107287198B (en) 2017-06-01 2017-06-01 Phenylalanine attenuator mutants and phenylalanine operons addressing feedback repression and their uses
PCT/CN2017/107453 WO2018077159A1 (en) 2016-10-27 2017-10-24 Method for modifying amino acid attenuator and use of same in production
US16/345,669 US11492616B2 (en) 2016-10-27 2017-10-24 Method for modifying amino acid attenuator and use of same in production
CN201780003425.XA CN108473990A (en) 2016-10-27 2017-10-24 The remodeling method of amino acid attenuator and its application in production
EP17864640.2A EP3533872A4 (en) 2016-10-27 2017-10-24 Method for modifying amino acid attenuator and use of same in production

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710403515.XA CN107287198B (en) 2017-06-01 2017-06-01 Phenylalanine attenuator mutants and phenylalanine operons addressing feedback repression and their uses

Publications (2)

Publication Number Publication Date
CN107287198A true CN107287198A (en) 2017-10-24
CN107287198B CN107287198B (en) 2020-07-07

Family

ID=60094598

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710403515.XA Active CN107287198B (en) 2016-10-27 2017-06-01 Phenylalanine attenuator mutants and phenylalanine operons addressing feedback repression and their uses

Country Status (1)

Country Link
CN (1) CN107287198B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113801901A (en) * 2021-07-30 2021-12-17 新泰市佳禾生物科技有限公司 Method for producing L-phenylalanine by fermentation

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106520801A (en) * 2016-10-27 2017-03-22 中国科学院微生物研究所 Threonine attenuator mutant, application thereof and method for removing feedback repression of threonine operon

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106520801A (en) * 2016-10-27 2017-03-22 中国科学院微生物研究所 Threonine attenuator mutant, application thereof and method for removing feedback repression of threonine operon

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LIU DX ET AL.: "integration of E.coli aroG-pheA tandem genes into corynebacterium glutamicum tyrA locus and its effect on l-phenylalanine biosynthesis", 《WORLD J GASTROENTEROL》 *
严锦文等: "衰减子与基因表达的调控", 《生物学通报》 *
刘艳华: "大肠杆菌苯丙氨酸生物合成的调控研究", 《中国优秀硕士学位论文全文数据库 基础科学辑》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113801901A (en) * 2021-07-30 2021-12-17 新泰市佳禾生物科技有限公司 Method for producing L-phenylalanine by fermentation
CN113801901B (en) * 2021-07-30 2024-05-24 新泰市佳禾生物科技有限公司 Method for producing L-phenylalanine by fermentation

Also Published As

Publication number Publication date
CN107287198B (en) 2020-07-07

Similar Documents

Publication Publication Date Title
JP4963152B2 (en) Increased lysine production by gene amplification
CN108559746A (en) Novel promoter and its application
CN103492553A (en) Processes and recombinant microorganisms for the production of cadaverine
EP2931918A2 (en) Method of identifying a cell with an intracellular concentration of a specific metabolite, which intracellular concentration is increased in comparison with the cell&#39;s wildtype, where the modification of the cell is achieved by recombineering, and method of making a production cell with optimized production of a specific metabolite, which production cell is genetically modified in comparison with its wildtype, method of producing this metabolite, and nucleic acids which are suitable therefor
CN113549588A (en) Genetically engineered bacterium for producing 5-hydroxytryptophan and construction method and application thereof
CN106520801B (en) Threonine attenuator mutant, application thereof and method for relieving feedback repression of threonine operon
CN102604983B (en) Construction method of gene engineering strain without plasmid and antibiotic resistance screening marker
CN110591989A (en) High-yield L-tryptophan engineering strain and application thereof
CN105820991B (en) A kind of Recombinant organism
CN107058323A (en) Engineering bacterium based on ilv attenuator and application thereof in production of isoleucine
WO2023065725A1 (en) Bacterial genome multiplex editing method based on double-stranded dna recombination engineering and application thereof
EP3533872A1 (en) Method for modifying amino acid attenuator and use of same in production
CN109666617A (en) The production bacterial strain and its construction method of a kind of L- homoserine and application
CN109456987B (en) High-yield L-leucine related gene and engineering bacterium construction method and application
CN107287197A (en) Histidine attenuator mutant and histidine operon and their application for solving feedback repression
CN105400801B (en) Release thrA gene mutation bodies and its application of feedback inhibition
CN110904126B (en) Transcription regulation factor, mutant thereof and application thereof in preparing vitamin B12
CN107287198A (en) Phenylalanine attenuator mutants and phenylalanine operons addressing feedback repression and their uses
CN107236738A (en) Tryptophan attenuator mutant and its application and the method for releasing tryptophan attenuator feedback repression
WO2014092345A1 (en) Fusaricidin-producing strain, and method for mass producing fusaricidin using same
CN106480035A (en) A kind of 5 &#39; UTR elements and its application aborning
CN107287196A (en) Mutant of ilv attenuator, related engineering bacterium and application of mutant in producing valine
US11597958B2 (en) DNA assembly method and its application
CN107810269A (en) Novel promoter and application thereof
CN112251457B (en) Adaptive evolution method and application of 4-hydroxyisoleucine producing strain

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant