CN107267512B

CN107267512B - Application of nucleic acid molecule

Info

Publication number: CN107267512B
Application number: CN201710555691.5A
Authority: CN
Inventors: 孙航; 吴传新; 程静; 王云英; 王姣焦
Original assignee: Second Affiliated Hospital of Chongqing Medical University
Current assignee: Second Affiliated Hospital of Chongqing Medical University
Priority date: 2017-07-10
Filing date: 2017-07-10
Publication date: 2020-11-03
Anticipated expiration: 2037-07-10
Also published as: CN107267512A

Abstract

The invention relates to the technical field of biology, in particular to application of a nucleic acid molecule. The invention defines the change of miRNAs expression spectrum of primary abdominal cavity macrophages of mice infected by candida albicans, obtains miRNAs of a regulatory gene HMG1B, discusses the regulation and control effect of the miRNAs on HMGB1 during candida albicans infection and provides a new idea for the treatment of candida albicans infection.

Description

Application of nucleic acid molecule

Technical Field

The invention relates to the technical field of biology, in particular to application of a nucleic acid molecule.

Background

Deep Fungal Infection (DFI) is a serious infectious disease, which refers to a fungal infection caused by invasion of subcutaneous tissues, mucous membranes and internal organs by pathogenic fungi, and infected organs. Among them, candida albicans is one of the most common pathogenic bacteria of deep fungal infections in humans. In recent years, the incidence and mortality of candida albicans infection have been continuously increased due to the long-term abuse of broad-spectrum antibiotics, the increase of invasive operations such as medical devices and organ transplantation, and the treatment of DFI has become a difficult clinical problem due to serious toxic and side effects and the increase of fungal resistant strains despite the development of many antifungal drugs.

The high mobility group protein B1 (HMGB 1) is a non-histone binding protein with abundant content and a molecular weight of about 30 kd. In 1999, Wang et al discovered that HMGB1 is a central element in late inflammatory responses to sepsis, which is released extracellularly from intracellular active secretion by activated macrophages, and which mediates inflammatory responses. Clinical and animal experiments in the early stage of the subject group show that HMGB1 plays an important role in candida albicans sepsis, but the biological mechanism of the HMGB1 is not clear.

micrornas (mirnas) are highly conserved long non-coding small ribonucleic acids that silence or suppress the expression of target genes at the post-transcriptional level. At present, a large number of miRNAs are proved to be used as novel inflammatory response regulating molecules, and have important regulation and control on the expression and release of various inflammatory factors in sepsis. The inflammatory cytokine HMGB1 which is important in the late stage of sepsis is used, and the expression and the release of the inflammatory cytokine HMGB1 are necessarily regulated and controlled by related miRNAs.

At present, the research on the regulation effect of HMGB1 by a large number of miRNAs focuses on bacterial sepsis, but the research on Candida albicans sepsis is lacked. Therefore, the research on the miRNAs for regulating and controlling HMGB1 in the candida albicans sepsis is of great significance.

Disclosure of Invention

In view of the above, the present invention provides a nucleic acid molecule. The invention analyzes the expression spectrum change of miRNAs on primary abdominal macrophages of mice infected by candida albicans to obtain miRNAs for regulating and controlling HMGB1, so as to discuss the regulation and control effect of the miRNAs on HMGB1 when the candida albicans is infected and provide a new idea for the treatment of the candida albicans infection.

In order to achieve the above object, the present invention provides the following technical solutions:

after candida albicans stimulates primary abdominal cavity macrophages of a mouse, 222 miRNAs with differential expression are screened out by using a miRNA gene chip, and in 21 miRNAs with obvious differential expression (FC is more than or equal to 1.5, and p is less than 0.05), mmu-miR-146b-5p is finally selected for carrying out subsequent experiments:

there are 6 miRNAs bioinformatics software (miRWalk, micro 4, miRMap, miRNAMap, PITA and RNA22) that predicted HMGB1 to be one of the direct targets of mmu-miR-146b-5 p. The bioinformatics website miRbase finds that the sequences of mmu-miR-146b-5p (UGAGAACUGAAUUCCAUAGGCU) and hsa-miR-146b-5p are completely consistent, and has the value of clinical research. In addition, after primary abdominal cavity macrophages of mice are infected by candida albicans, miRNAs gene chips and qRT-PCR show that mmu-miR-146b-5p has obvious change and has statistical significance.

In some embodiments of the invention, the nucleic acid molecule is selected from an RNA, DNA or nucleic acid analogue molecule having:

(I) a nucleotide sequence shown as SEQ ID No. 1; or

(II) a complementary sequence of the nucleotide sequence shown as SEQ ID No. 1; or

(III) a sequence which encodes the same protein as the nucleotide sequence of (I) or (II) but which differs from the nucleotide sequence of (I) or (II) due to the degeneracy of the genetic code; or

(IV) a sequence which is at least 80% homologous to the sequence of (I) or (II) or (III).

In some embodiments of the invention, the nucleic acid molecule is selected from an RNA, DNA or nucleic acid analogue molecule.

In some embodiments of the invention, the nucleic acid molecule has a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences from the nucleotide sequence shown in (I) or (II) or (III) or (IV), and a nucleotide sequence functionally identical or similar to the nucleotide sequence shown in (I) or (II) or (III) or (IV), wherein the plurality is 2, 3, 4, 5, 6, 7, 8, 9 or 10.

In some embodiments of the invention, the nucleic acid molecule has a sequence which is at least 90% homologous to the sequence of (I) or (II) or (III).

The dual-luciferase reporter gene detection system simultaneously expresses firefly luciferase and renilla luciferase in the same cell, and the firefly luciferase and the renilla luciferase have no provenance homology and correspond to different reaction substrates, so that cross interference does not exist in the reaction. And because of the super strong optical signal and the super high signal-to-noise ratio, the system is widely used for the verification of the miRNAs target genes, and can accurately and sensitively detect whether the miRNAs directly act on the target genes. Since the miRNAs are specifically combined with the 3' -UTR region of the target gene and are completely or incompletely complementary with the target gene, a silencing complex is formed or the transcription of the target gene is inhibited, so that the miRNAs play an important negative regulation role in the expression of the target gene, and finally the activity of the firefly luciferase related to the target gene is reduced.

The invention uses bioinformatics software to predict the specific binding site of mmu-miR-146b-5p and a target gene HMGB13'-UTR region, and constructs a wt-HMGB13' -UTR region expression vector containing dual-luciferase; and carrying out point mutation on the binding site of the HMGB13'-UTR region to construct a mut-HMGB13' -UTR region mutation vector as a negative control. An empty vector, a wt-HMGB13'-UTR expression vector and a mut-HMGB13' -UTR region mutation vector are co-cultured with a mmu-miR-146b-5p mimic (mimic) and a mimic NC respectively in 293T cells, and the results show that the mmu-miR-146b-5p and the wt-HMGB13'-UTR region expression vector co-culture group has obviously reduced firefly luciferase activity compared with a control group, which shows that the mmu-miR-146b-5p can be specifically combined with an HMGB13' -UTR region and inhibit the expression of HMGB1, and the HMGB1 is a direct acting target of the mmu-miR-146b-5 p.

(I) a nucleotide sequence shown as SEQ ID No. 1; or

HMGB1 is a non-histone nucleoprotein in abundant amounts, with a molecular weight of about 30kD, and is known for its fast mobility in polyacrylamide gel electrophoresis. It is ubiquitous in mammals and is involved in DNA replication, transcription, modification, repair of damaged DNA, regulation of gene transcriptional activity, and the like. Recent studies have found that HMGB1, as a late-stage inflammatory cytokine, plays an important role in sepsis, septic shock and multi-organ injury. In bacterial sepsis, after endotoxin and various proinflammatory factors such as TNF-alpha, IL-1 beta and IL-6 activate monocytes/macrophages, NK cells and dendritic cells, HMGB1 is actively secreted from the cell nucleus to the outside of the cell. At the same time, the inflammatory response promotes a variety of apoptosis and necrosis, disrupting the integrity of the cell envelope, resulting in passive release of nuclear HMGB1 to the outside of the cell, exacerbating the inflammatory response. The activated mononuclear/macrophage can be further induced to generate a plurality of inflammatory mediators by the HMGB1 released outside the cell in an active and passive mode, and downstream inflammatory cytokines are further released, so that the inflammatory reaction cascade is amplified; furthermore, HMGB1 itself has an endotoxinlike lethal effect. Therefore, HMGB1 is a central link in the reactive network of proinflammatory cytokines in sepsis. DFI is a sepsis caused by pathogenic fungi. The preliminary study of a subject group discovers that the expression levels of HMGB1mRNA and protein in peripheral blood of a severe sepsis patient accompanied by candida albicans infection are obviously higher than those of a general sepsis patient; the expression level of HMGB1mRNA and protein in peripheral blood, liver, lung and kidney of mice infected by invasive Candida albicans is also significantly higher than that of normal mice, which indicates that HMGB1 also has an important role in sepsis caused by Candida albicans infection.

According to the invention, candida albicans is adopted to stimulate primary abdominal cavity macrophages of mice transfected by mmu-miR-146-5p for 36h, and qRT-PCR shows that the transfection effect of mmu-miR-146b-5p is good; qRT-PCR, Western blot and ELISA results show that after candida albicans is stimulated for 36 hours, the expression levels of HMGB1mRNA and protein in macrophages and supernatant are obviously increased compared with a normal group; the expression level of mRNA and protein in the cells and supernatant of the mmu-miR-146b-5p mimic group is obviously reduced compared with that of the mimic NC group; the result of the mmu-miR-146b-5p inhibitor group is opposite to that of the mmu-miR-146b-5p micom group, and the mmu-miR-146b-5p can effectively and negatively regulate the expression levels of HMGB1mRNA and protein in macrophages and supernatant induced by candida albicans.

(I) a nucleotide sequence shown as SEQ ID No. 1; or

HMGB1, unlike other nuclear proteins, has a low affinity for DNA and can shuttle between the nucleus and the cytoplasm through the nuclear pore in the cell. HMGB1 generally rests in the nucleus, and after LPS, inflammatory cytokines and extracellular HMGB1 stimulate monocytes/macrophages, acetylation and specifically secreted lysosomes allow HMGB1 to actively transit from the nucleus to the cytoplasm and subsequently secrete outside the cell in a vesicle-mediated manner to play the role of inflammatory cytokines. Therefore, the process of transferring HMGB1 from the nucleus to the outside of the cell is a key element in its development of pro-inflammatory responses.

According to the invention, candida albicans is adopted to stimulate primary abdominal cavity macrophages of mice transfected by miRNAs, and Western blot results show that the content of HMGB1 protein in cytoplasm of the macrophages before stimulation is less, and the content of HMGB1 protein in nucleus is more; after the candida albicans is stimulated for 36 hours, the HMGB1 protein content in cytoplasm is obviously increased, and the HMGB1 protein content in nucleus is reduced; the protein level of cytoplasmic HMGB1 in the mmu-miR-146b-5p micic group is obviously lower than that in the micic NC group, and the protein content of the nuclear HMGB1 is obviously higher than that in the micic NC group; the protein content of cytoplasmic HMGB1 in the mmu-miR-146b-5p inhibitor group is obviously higher than that in the inhibitor NC group, the protein content of nuclear HMGB1 is obviously lower than that in the inhibitor NC group, and experiments show that when the Candida albicans infects primary abdominal macrophages of mice, the mmu-miR-146b-5p has an important negative control effect on the translocation of HMGB1 protein in cells from nucleus to cytoplasm. As observed by a laser confocal microscope from physilogy, before the candida albicans is stimulated, green fluorescence is mainly concentrated in cell nucleuses, and the cytoplasm content is low; after the candida albicans is stimulated for 36 hours, strong green fluorescence can be seen in cytoplasm and cell nucleus; the green fluorescence of the mmu-miR-146b-5 pminic group is mainly concentrated in the nucleus, and the intracytoplasmic green fluorescence is obviously weaker than that of the mimic NC group; the result of the mmu-miR-146b-5p inhibitor group is opposite to that of the mmu-miR-146b-5p imimic group. The Western blot is consistent with the laser confocal result, and the results all indicate that mmu-miR-146b-5p can effectively and negatively regulate and control translocation of HMGB1 protein in primary mouse abdominal cavity macrophages induced by candida albicans from nucleus to cytoplasm, so that HMGB1 is inhibited from being secreted outside cells to play a role in inflammatory cytokines.

(I) a nucleotide sequence shown as SEQ ID No. 1; or

The present invention also provides the use of a nucleic acid molecule for the preparation of a medicament for the treatment of candida albicans infection, said nucleic acid molecule having:

(I) a nucleotide sequence shown as SEQ ID No. 1; or

In conclusion, the invention preliminarily verifies that the expression level of mmu-miR-146b-5 is obviously reduced during candida albicans infection; the mmu-miR-146b-5 can directly regulate and control a target gene HMGB1, and effectively inhibit the expression level and translocation condition of HMGB1, so that the negative regulation effect of the mmu-miR-146b-5 on the HMGB1 provides a new idea for researching a candida albicans infection mechanism, and provides a new target for treating candida albicans infection.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 shows the predicted binding site of mmu-miR-146b-5p in the HMGB13' -UTR region;

FIG. 2 shows sequencing results of HMGB13' -UTR expression vector and mutant vector; wherein FIG. 2(A) shows wt-HMGB13' -UTR; FIG. 2(B) shows mut-HMGB13' -UTR;

FIG. 3 shows the effect of mmu-miR-146b-5p on HMGB13' -UTR luciferase reporter activity;

FIG. 4 shows mmu-miR-146b-5p expression levels;

FIG. 5 shows the expression level of HMGB1mRNA in mouse primary peritoneal macrophages;

FIG. 6 shows the total protein expression level of HMGB1 in mouse primary peritoneal macrophages;

FIG. 7 shows HMGB1 content in mouse primary peritoneal macrophage supernatant;

FIG. 8 shows the expression level of HMGB1 protein in cytoplasmic nuclei of mouse primary abdominal macrophage cells;

fig. 9 shows laser confocal of HMGB1 in mouse primary peritoneal macrophages.

Detailed Description

The invention discloses the application of a nucleic acid molecule, and the method can be realized by appropriately modifying process parameters by taking the contents of the nucleic acid molecule as reference by a person skilled in the art. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

Statistical analysis: the software SPSS17.0 is used for analysis, data are expressed by mean +/-standard deviation, single-factor variance analysis is used for evaluating the difference between the data, and Newman-Keuls test is carried out, wherein P is less than 0.05, which shows that the difference has statistical significance.

The raw materials and reagents used in the application of the nucleic acid molecules provided by the invention are all available on the market.

TABLE 1 Main reagents for the experiment

DNA recovery kit	Tiangen Biochemical technology Ltd
		FITC-labeled Secondary antibody	Hangzhou Union Biotechnology Co., Ltd
Lipofectamine 3000	Invitrogen corporation of America
		OligoRNA sequence	Invitrogen corporation of America
Pfu DNA polymerase	Sammerfo USA SA
		qRT-PCR reaction kit	Beijing Baitaike Co Ltd
T4 DNA ligase	Sammerfo USA SA
		top10 competent cells	Beijing kang is a century science and technology Co., Ltd
Nuclear protein and cytoplasmic protein extraction kit	Jiangsu Kai Biotechnology Ltd
		anti-HMGB
1 rabbit polyclonal antibody	Abcam corporation of America
		Dual-luciferase reporter gene kit	Promega Corp USA
Plasmid extraction kit	Axygen Inc. USA
		Recombinant human high mobility group protein B1	Novoprotein, Inc. of USA

TABLE 2 Main Instrument of the experiment

Saxifrage glucose agar medium: dissolving 12.4g of the dried powder of the Sabouraud's dextrose agar culture medium in 200mL of double distilled water, and sterilizing for 15min in high-pressure steam at 121 ℃.

4% paraformaldehyde: weighing 4g of paraformaldehyde powder, adding the paraformaldehyde powder into 60mL of PBS (phosphate buffer solution) with pH of 7.4, uniformly mixing, heating to 60-80 ℃, dissolving and cooling, diluting with double distilled water to 100mL, and adjusting the pH value to 7.2-7.4.

0.1% Triton-X100: 100 μ L of Triton-X100 was added to 100mL of PBS, mixed well and stored at 4 ℃.

PBST: pipette 500. mu.L Tween 20 into 1000mL PBS, mix well, and store at 4 ℃.

Coating liquid: 1.59g of NaCO is weighed₃And 2.93g NaHCO₃And diluting the double distilled water to 1000mL, uniformly mixing, and storing at 4 ℃.

The invention is further illustrated below with reference to the examples:

example 1 mmu-miR-146b-5p directly regulates and controls target gene HMGB1

[ biological informatics prediction ]

The binding site of mmu-miR-146b-5p and HMGB13' -UTR region:

miRNAs that act on the 3' -UTR region of the HMGB1 gene were predicted according to the bioinformatics software miRWalk, DIANA-microT, miRanda, mirsys, miRDB, miRMap, mirrnamap, Pictar, PITA, RNA22, RNAhybrid and Targetscan.

(ii) plasmid construction

The sequence of the target gene HMGB13' -UTR region:

a mouse HMGB13'-UTR region sequence containing a predicted binding site (gttctc, 1327-and 1332-nucleotides) is obtained through a bioinformatics database NCBI, and synthesized cDNA is used as a template and named as wt-HMGB13' -UTR, and the sequence is shown as SEQ ID No. 13.

The sequence of the point mutation HMGB13' -UTR region:

the binding site (gttctc, nucleotide 1327-1332) of the HMGB13'-UTR region of the target gene predicted by mmu-miR-146b-5p is subjected to point mutation (gtAGAc) and named as mut-HMGB13' -UTR, and the mutation sequence is shown as SEQ ID No. 14.

Enzyme digestion:

and (3) digesting the purified product and the vector by using restriction enzymes Sac I and Sa 1I, and incubating for 2h at 37 ℃.

The reaction system is as follows:

ligation of the vector to the fragment of interest:

(1) reaction system:

(2) reaction conditions are as follows: the reaction was carried out at 16 ℃ for 30 min.

And (3) transformation:

(1) adding the ligation product to be transformed into TOP 10-containing competent cells (100. mu.L of competent cells required 50ng of DNA), mixing, and ice-cooling for 30 min;

(2) circulating water at 42 ℃, thermally shocking for 90s, and rapidly moving to an ice bath for 3 min;

(3) adding 200 μ L SOC liquid culture medium into each tube, and shake culturing (37 deg.C, 220rpm and 45 min);

(4) transferring the competent cells to LB culture medium (containing Amp);

(5) the plates were inverted and incubated for 15h at 37 ℃ in an incubator.

Extraction of plasmids

(1) Selecting 4 individual colonies, placing the colonies in an LB culture medium containing 5 mu L Amp, and performing shake culture for 20 hours;

(2) taking 1.5mL of bacterial liquid (OD value is 2-4), centrifuging at 4500rpm for 90s, and collecting about 3mL of precipitate;

(3) adding 250 mu L of the suspension into 3mL of the bacterial precipitation solution, and uniformly mixing by blowing;

(4) adding 250 mu L of lysis solution, reversing and mixing evenly;

(5) adding 350 μ L of binding solution, reversing and mixing;

(6) centrifuging at 14000g for 10min at room temperature, and collecting supernatant;

(7) adding 750 μ L of washing solution, centrifuging at room temperature and 14000g for 1min, removing supernatant, and collecting precipitate;

(8) adding 50 μ L of eluent, and standing for 2 min;

(9) centrifuge at 14000g for 1min at room temperature, remove supernatant and collect precipitate.

Sequencing and identifying:

the plasmid was sent to Shanghai Weijie Jie Co., Ltd for sequencing.

③ double-luciferase reporter gene detection

Plasmid transfection

(1) 24h before transfection, 293T cells in logarithmic growth phase were seeded in 48-well plates and cultured at 37 ℃ with 5% CO₂In an incubator, the cell density during transfection is 70-80%;

(2) diluting 1 mu L of Lipofectakmine 3000 into 25 mu L of Opti-MEM, diluting 0.2 mu g of plasmid into 25 mu L of Opti-MEM, diluting 7.5pmol of mmu-miR146b-5 micic or normal into 25 mu L of Opti-MEM, respectively standing for 5min at room temperature, mixing the diluted transfection reagent, OligoRNA and plasmid uniformly, and standing for 20min at room temperature;

(3) removing 50 μ L of culture medium from each well, adding 50 μ L of prepared transfection complex, setting 3 multiple wells for each group, and incubating at 37 deg.C for 6 h;

(4) replace 200. mu.L of fresh medium to each well and incubate at 37 ℃ for 48 h.

Luciferase assay

(1) Adding 200 μ L cell lysate into each well, and standing at room temperature for 10 min;

(2) centrifuging at 4 deg.C and 10000g for 5min, and collecting the cracked supernatant;

(3) adding 20 mu L of cracking supernatant into a 96-hole luminescent plate, adding 100 mu L of firefly luciferase working solution, mixing uniformly, and detecting a luminescent value by a computer;

(4) adding 100 μ L of renilla luciferase working solution, mixing, and detecting luminescence value on a computer.

As a result:

bioinformatics prediction

Bioinformatics prediction software miRWalk, Microt4, miRMap, miRNAMap, PITA and RNA22 analysis showed that nucleotide 1327 and 1332 of the 3' -UTR region of the HMGB1 gene was completely complementary to 6 nucleotides of the mmu-miR-146b-5p seed region (FIG. 1).

HMGB13' -UTR region expression vector and mutant vector sequencing:

since a DNA double strand is formed according to the base complementary pairing principle (a ═ T, C ═ G), the sequencing result can be shown as a complementary sequence of the synthesized sequence. Constructing a wt-HMGB13'-UTR expression vector containing a predicted binding site (gttctc)3' -UTR region of HMGB1, and sequencing to obtain a complementary sequence (gagagaac) of the binding site (gttctc) (FIG. 2A); the point mutation of the binding site (gttctc) of the HMGB13'-UTR region to (gtAGAc) constructed a mut-HMGB13' -UTR region mutation vector, and the sequencing result was the complementary sequence (gtctc) of the mutant sequence (gtAGAc) (FIG. 2B).

Dual luciferase reporter:

the results of qRT-PCR show that the luciferase signal values in the Empty (mimic NC, mmu-miR-146b-5p mimic), wt-HMGB13'-UTR (mimic NC, mmu-miR-146b-5p mimic) and mut-HMGB13' -UTR (mimic NC, mmu-miR-146b-5pmimic) groups are respectively as follows: (1.00 + -0.056, 0.97 + -0.086), (0.98 + -0.098, 0.59 + -0.073) and (0.99 + -0.096, 0.98 + -0.043). The dual-luciferase reporter gene result shows that mmu-miR-146b-5pmimic reduces the activity of wt-HMGB13' -UTR type plasmid by about 40%, and the difference has statistical significance (P is less than 0.05);

the activity of the mut-HMGB13' -UTR type plasmid is not obviously changed by mmu-miR-146b-5p mimic (figure 3), and an experimental result shows that the mmu-miR-146b-5p can directly regulate and control a target gene HMGB 1.

Example 2 expression level of mmu-miR-146b-5p inhibition target gene HMGB1

Transfection of mmu-miR-146b-5p

Preparing OligoRNA:

OligoRNA sequences were purchased from Shanghai Weiji Biotechnology, Inc., and the sequences are shown in Table 3:

TABLE 3

Cell processing and grouping:

candida albicans stimulates macrophages transfected with miconc, mmu-miR-146b-5p micom, inhibitor NC and mmu-miR-146b-5p inhibitor for 36h, and the macrophages are divided into normal, C.albicans, miconc, mmu-miR-146b-5 pminic, inhibitor NC and mmu-miR-146b-5p inhibitor groups, and samples are collected for subsequent experiments.

Transfection of mmu-miR-146b-5 p:

(1) extracting primary abdominal cavity macrophage of mouse at 3 × 10⁶Per well was inoculated into 6 well plates, 2mL complete medium was added per well, and the plates were placed in an incubator (37 ℃ C., 5% CO)₂) Incubating for 12 h;

(2) before transfection, PBS is washed for 2 times, and 1 mL/hole of Opti-MEM is added;

(3) preparing a reagent A: adding 15 mu L of Lipofectamine 3000 into 125 mu L of Opti-MEM in a super clean bench, uniformly mixing, and standing for 5 min;

(4) preparing a reagent B: adding 38 μ L of OligoRNA (20 pmol/. mu.L) into 125 μ L of Opti-MEM, mixing, and standing for 5min (away from light);

(5) mixing the reagent A and the reagent B uniformly, and standing for 5min (keeping out of the sun) at room temperature;

(6) adding the reagents obtained in the previous step into macrophages containing 1mL of Opti-MEM respectively, mixing uniformly, and putting the mixture into an incubator (37 ℃, 5% CO2) for incubation for 6h (keeping out of the light);

(7) discarding the supernatant, adding 2mL of complete culture medium, and incubating for 36 h;

(8) candida albicans was stimulated for 36h, samples were collected and transfection efficiency was verified by qRT-PCR.

Expression level of mmu-miR-146b-5p inhibition target gene HMGB1mRNA

qRT-PCR analysis

The sequence of HMGB1 is shown in SEQ ID No. 15.

Designing a primer: the sequence of the mmu-miR-146b-5p primer and the internal reference U6 is detailed in Table 4, the mouse primer HMGB1 and the internal reference GADPH are designed and synthesized by Huada Gene company, and the sequences are shown in Table 5:

TABLE 4

TABLE 5

Reverse transcription of cDNA

(1) Adding 2 μ L of random primer and 1 μ L of total RNA into 9 μ L of double distilled water, mixing, incubating in 70 deg.C water bath for 10min, and ice-cooling for 2 min;

(2) reverse transcription reaction system and reaction conditions:

reaction system:

reaction conditions are as follows:

30℃ 10min

42℃ 1h

70℃ 15min

qRT-PCR

(1) reaction system

(2) Reaction conditions

Expression level of mmu-miR-146b-5p inhibition target gene HMGB1 total protein

Western blot analysis

And (3) extracting total cell protein:

digesting and collecting a cell sample; adding 1.5 μ L100 mM PMSF into 150 μ L RIPA lysate to obtain lysate with final concentration of 1mM, fully lysing cells, centrifuging at 4 deg.C and 14,000rpm for 15min, and collecting supernatant as total protein; storing at-80 deg.C.

Western blot experiment procedure

(1) Preparing a lower layer of glue: preparation of 12% SDS-PAGE separation gel (8 mL):

after uniformly mixing, immediately pouring into a glass plate interlayer (reserving a space required by an upper layer adhesive), adding 1mL of isopropanol, and vertically standing for 30min at room temperature;

(2) preparing upper layer glue: the isopropanol was decanted and the residue was blotted with filter paper to prepare an SDS-PAGE supernatant (3 mL):

mixing, quickly pouring the upper layer glue, inserting a comb, and standing at room temperature for 30 min; taking out the comb after the upper layer gel is solidified, fixing the gel by using an electrophoresis device, and adding a proper amount of Tris-glycine electrophoresis buffer solution into an upper tank, an inner tank and an outer tank;

(3) loading: adding 20 mu L of sample (the total protein amount is 30 mu g) into each hole, and taking 5 mu L of prestained protein as a reference;

(4) glue running: the initial voltage of the electrophoresis apparatus is 80V, when the dye is separated to the lower layer gel, the voltage is adjusted to 120V, the prestained protein is taken as the reference, and the protein molecules are fully separated and can be stopped;

(5) film transfer: taking out the gel, and cutting the gel according to the molecular weight of the target protein and the internal reference protein; cutting the PVDF membrane and the filter paper, soaking the PVDF membrane in methanol, and placing the PVDF membrane and the filter paper in an electrotransfer buffer solution together for balancing for 10 min; overlapping foam, three pieces of filter paper, gel, PVDF (polyvinylidene fluoride) membrane, three pieces of filter paper and foam between plastic brackets from a negative electrode to a positive electrode, placing the plastic brackets in an electrophoresis tank filled with an electrotransfer buffer solution, and performing constant current electrophoresis for 35min (4 ℃, 360 mA);

(6) and (3) sealing: placing the PVDF membrane into TBST buffer solution containing 5% BSA, and slowly shaking at room temperature for 2 h;

(7) incubating primary antibody: transferring the PVDF membrane to a primary anti-working solution, and slowly shaking overnight at 4 ℃;

(8) hatching a secondary antibody: washing PVDF membrane with TBST buffer solution (10min × 3 times), adding into second antibody working solution, and slowly shaking at room temperature for 1 h; the PVDF membrane was removed and washed with TBST buffer (10 min. times.3 times);

(9) ECL development: and (4) preparing an ECL color developing agent and developing and imaging.

ELISA indirect method for detecting HMGB1 expression in supernatant

(1) Diluting the recombinant human HMGB1 protein to 100 mu g/mL with sterile double distilled water, subpackaging with 5 mu L/tube and storing at-70 ℃;

(2) diluting 5 mu L of recombinant human HMGB1 protein (the concentration is 1 mu g/mL) with 497 mu L of coating solution, adding 250 mu L of standard substance dilution solution into 250 mu L of protein standard substance each time, mixing uniformly and preparing the protein standard substance, wherein the concentration gradients are 0ng/mL, 15.625ng/mL, 31.25ng/mL, 62.5ng/mL, 125ng/mL, 250ng/mL, 500ng/mL and 1 mu g/mL in sequence;

(3) fixing an enzyme-labeled coated plate by using a frame, adding 100 mu L of coating solution into blank holes, respectively adding 100 mu L of protein standard substance and a sample to be detected (undiluted) into the rest holes, repeating the steps for 3 times for each sample, and standing overnight at 4 ℃ in a wet box;

(4) removing coating liquid, and washing with PBST liquid (1min × 3 times);

(5) adding 200 μ L PBST solution containing 3% BSA into each well, and incubating at 37 deg.C for 2 h;

(6) waste liquid is discarded, and PBST liquid is cleaned (1min multiplied by 3 times);

(7) diluting HMGB1 antibody (1: 1500) with PBST solution, adding 100 μ L of working solution containing HMGB1 antibody into each well, and incubating at 37 deg.C for 2 h;

(8) waste liquid is discarded, and PBST liquid is cleaned (1min multiplied by 3 times);

(9) diluting the secondary antibody (1: 10000) with PBST solution, adding 100 μ L of secondary antibody working solution into each well, and incubating at 37 ℃ for 1 h;

(10) waste liquid is discarded, and PBST liquid is cleaned (1min multiplied by 3 times);

(11) adding 100 mu L of TMB solution into each hole, and standing at room temperature for 10-20 min (in the dark);

(12) adding 100 μ L of stop solution into each well, and detecting absorbance of each well within 5min by using A450 wavelength of a microplate reader;

(13) and (4) making a standard curve according to the concentration of the protein standard substance and the OD value of the corresponding protein standard substance, and calculating the concentration of HMGB1 in the cell supernatant.

Results

Verifying the transfection efficiency of mmu-miR-146b-5 p:

the results of qRT-PCR show that the expression levels of mmu-miR-146b-5p in the normal, C.albicans, micmic NC, mmu-miR-146b-5p micic, inhibitor NC and mmu-miR-146b-5p inhibitor groups are respectively as follows: 1.00 +/-0.048, 0.75 +/-0.057, 0.78 +/-0.069, 66.54 +/-5.32, 0.73 +/-0.058 and 0.59 +/-0.61. The expression level of mmu-miR-146b-5P in cells of the albicans group is obviously reduced compared with that of the normal group (P is less than 0.05); the expression level of mmu-miR-146b-5P in the mmu-miR-146b-5 pminic group is obviously increased (P is less than 0.05) compared with that in the mimic NC group; compared with the inhibitor NC group, the expression level of the mmu-miR-146b-5pinhibitor is obviously reduced, the difference has statistical significance (P is less than 0.05), and experiments show that the mmu-miR-146b-5P mimic and the inhibitor have good transfection effects and obvious expression effects (figure 4).

The mmu-miR-146b-5p negatively regulates the expression level of HMGB1mRNA in macrophages:

the qRT-PCR result shows that the expression levels of HMGB1mRNA in cells of normal, C.albicans, mimic NC, mmu-miR-146b-5p mimic, inhibitor NC and mmu-miR-146b-5p inhibitor groups are respectively as follows: 1.00 +/-0.059, 1.5 +/-0.051, 1.58 +/-0.12, 1.25 +/-0.068, 1.54 +/-0.047 and 1.77 +/-0.11. The HMGB1mRNA level in the cells of the albicans group is obviously increased compared with the normal group (P < 0.05); compared with a mimic NC group, the mRNA level of HMGB1 in the mmu-miR-146b-5P mimic group is obviously reduced (P is less than 0.05); compared with the inhibitor NC group, the mmu-miR-146b-5P inhibitor group is obviously increased, and the differences have statistical significance (P is less than 0.05), and experiments show that after Candida albicans is infected, the mmu-miR-146b-5P can effectively and negatively regulate the expression level of HMGB1mRNA in primary abdominal macrophages of mice (figure 5).

mmu-miR-146b-5p can negatively regulate and control expression level of total protein of HMGB1 in macrophage

Western blot results show that the expression level of total protein of HMGB1 in cells of the C.albicans group is obviously increased compared with that of the normal group; the total protein expression level of the mmu-miR-146b-5p mimic group is obviously reduced compared with that of the mimic NC group;

the expression level of the total protein of the mmu-miR-146b-5p inhibitor group is obviously increased compared with that of the inhibitor NC group, and experiments show that the mmu-miR-146b-5p can effectively and negatively regulate the expression level of the total protein of HMGB1 in primary abdominal cavity macrophages of mice after candida albicans infection (figure 6).

The mmu-miR-146b-5p can negatively regulate the content of HMGB1 in the supernatant of the macrophage:

ELISA results show that the expression levels of HMGB1 in the supernatants of normal, C.albicans, micnc, mmu-miR-146b-5p micic, inhibitor NC and mmu-miR-146b-5p inhibitor groups are respectively as follows: 14.98 +/-1.63, 154.56 +/-5.95, 160.52 +/-7.75, 100.92 +/-4.13, 143.63 +/-7.08 and 180.71 +/-12.69. The HMGB1 content in the supernatant of the albicans group is obviously increased compared with that in the normal group (P is less than 0.05); compared with a mimic NC group, the HMGB1 content in the supernatant of the mmu-miR-146b-5P mimic transfection group is obviously reduced (P is less than 0.05); compared with an inhibitor NC group, the HMGB1 content in the supernatant of the mmu-miR-146b-5P inhibitor group is obviously increased, and the differences have statistical significance (P is less than 0.05), and experiments show that after Candida albicans is infected, the mmu-miR-146b-5P can effectively and negatively regulate the expression level of HMGB1 protein in the supernatant of primary abdominal cavity macrophages of a mouse (figure 7).

Example 3 mmu-miR-146b-5p can inhibit translocation of HMGB1 in macrophages

Extracting cytoplasmic protein and nuclear protein:

protein quantification is carried out by adopting a BCA method according to the instruction operation of the kit for extracting the Jiangsu Kaiyu cytoplasm and the nucleoprotein, and split charging and storing at-80 ℃.

Western blot procedure as in example 2.

Cell laser confocal microscope:

(1) pressing macrophage at 5 × 10⁵Perwell in 24-well plates containing slides, add 1mL complete medium, incubate (37 ℃, 5% CO)₂) Performing medium incubation for 12 h;

(2) transfecting OligoRNA into cells, culturing for 36h, and inactivating candida albicans and stimulating for 36 h;

(3) after the cell culture was completed, the cells were washed with PBS (1 min. times.3);

(4) adding 1mL of 4% paraformaldehyde into each well, and fixing at room temperature for 30 min;

(5) washing with PBS (1 min. times.3 times);

(6) adding 500 μ L of 0.3% TritonX-100 into each well, and breaking membranes at room temperature for 15 min;

(7) washing with PBS (1 min. times.3 times);

(8) adding goat blocking serum 500 μ L/well, and blocking for 90 min;

(9) recovering blocking solution, washing, adding 200 μ L primary antibody per well (HMGB1, 1: 1000; NF- κ B, 1: 30), and wet-packing at 4 deg.C overnight;

(10) primary antibody was recovered and washed with PBS solution (1min × 3 times);

(11) add 200. mu.L of green fluorescent secondary antibody to each well (1: 100, Dylight488 label) and incubate for 1h at room temperature (primary antibody is HMGB 1); wet box 4 ℃ overnight (primary antibody is NF-. kappa.B);

(12) recovering the secondary antibody, washing with PBS (1min × 3 times);

(13) add 200. mu.L of DAPI to each well (1: 40000) and incubate for 15min at room temperature;

(14) washing with PBS (1 min. times.3 times);

(15) mounting the wafer by using a mounting agent for preventing fluorescence quenching;

(16) and (5) observing and imaging by using a laser confocal microscope.

As a result:

expression level of macrophage cytoplasmic nucleus HMGB1 protein:

westernblot results show that prior to stimulation, macrophage cytoplasm contains less HMGB1 protein and nucleus contains more HMGB1 protein; after the candida albicans is stimulated for 36 hours, the HMGB1 protein content in cytoplasm is obviously increased, and the HMGB1 protein content in nucleus is reduced; the protein level of cytoplasmic HMGB1 in the mmu-miR-146b-5p micic group is obviously lower than that in the micic NC group, and the protein content of the nuclear HMGB1 is obviously higher than that in the micic NC group; the protein content of cytoplasmic HMGB1 in the mmu-miR-146b-5p inhibitor group is obviously higher than that in the inhibitor NC group, the protein content of nuclear HMGB1 is obviously lower than that in the inhibitor NC group, and experiments show that when the Candida albicans infects primary abdominal macrophages of mice, the mmu-miR-146b-5p has an important negative control effect on the translocation of HMGB1 protein in cells from the nucleus to the cytoplasm (figure 8).

Activity and distribution of macrophage intracellular HMGB 1:

laser confocal results show that the fluorescence of HMGB1 before stimulation is mainly located in nuclei, the fluorescence is strong green fluorescence, and cytoplasmic expression is not significant; after the candida albicans is stimulated for 36 hours, strong green fluorescence can be seen in nucleus and cytoplasm; the nuclear HMGB1 green fluorescence in the mmu-miR-146b-5p mimic group is obviously higher than that in the mimic NC group, and the cytoplasmic green fluorescence is obviously lower than that in the mimic NC group; the green fluorescence of the nucleus in the mmu-miR-146b-5p inhibitor group is obviously lower than that of the inhibitor NC group, and the green fluorescence in the cytoplasm is obviously higher than that of the inhibitor NC group, so that experiments show that after the candida albicans infects primary abdominal cavity macrophages of mice, the mmu-miR-146b-5p has an important negative control effect on the translocation of HMGB1 protein in cells from the nucleus to the cytoplasm (figure 9).

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

SEQUENCE LISTING

<110> Chongqing medical university affiliated second hospital

<120> use of a nucleic acid molecule

<130>MP1710844

<160>17

<170>PatentIn version 3.3

<210>1

<211>22

<212>RNA

<213>mmu-miR-146b-5p mimic

<400>1

ugagaacuga auuccauagg cu 22

<210>2

<211>22

<212>RNA

<213>mmu-miR-146b-5p mimic

<400>2

ccuauggaau ucaguucuca uu 22

<210>3

<211>22

<212>RNA

<213>mmu-miR-146b-5p

<400>3

agccuaugga auucaguucu ca 22

<210>4

<211>21

<212>DNA

<213>mimic NC

<400>4

uucuccgaac gugucacgut t 21

<210>5

<211>21

<212>DNA

<213>mimic NC

<400>5

acgugacacg uucggagaat t 21

<210>6

<211>23

<212>RNA

<213>inhibitor NC

<400>6

ucauucguac augucuaacg cca 23

<210>7

<211>20

<212>DNA

<213> mmu-miR-146b-5p forward primer

<400>7

gcggtgagaa ctgaattcca 20

<210>8

<211>21

<212>DNA

<213> mmu-miR-146b-5p reverse primer

<400>8

cagtgcaggg tccgaggtat t 21

<210>9

<211>24

<212>DNA

<213> hmgb1 Forward primer

<400>9

acccggatgc ttctgtcaac ttct 24

<210>10

<211>24

<212>DNA

<213> HMGB1 reverse primer

<400>10

gccttgtcag cctttgccat atct 24

<210>11

<211>20

<212>DNA

<213> GAPDH Forward primer

<400>11

catggccttc cgtgttccta 20

<210>12

<211>17

<212>DNA

<213> GAPDH reverse primer

<400>12

gcggcacgtc agatcca 17

<210>13

<211>400

<212>DNA

<213>wt-HMGB1 3'-UTR

<400>13

catttaaaat gaagggtata ttttcctata ctgtggtttg tccctttatg aatcagatac 60

aagaggataa actttgcata ttagtaccat ttgtccaata catttgcttt ttctttataa 120

aacccaaact cattcattaa tcaggtttaa tctgcttagt ttagggaaca atttggcaat 180

tttgtggatt tttttttgag attatcgttc tcttaaagtg ccagtgtttt aaatagcgtt 240

cttgtaattt cacgcgcttt tgtgatggag tgctgttata taattttgac ttgggttctt 300

tacatttgcg ttgttaatgt aatttgagga ggaatactga acatgagtcc tggatgatac 360

taataaacta ataattacagaggttttaaa tattagttaa 400

<210>14

<211>400

<212>DNA

<213>mut-HMGB1 3'-UTR

<400>14

catttaaaat gaagggtata ttttcctata ctgtggtttg tccctttatg aatcagatac 60

aagaggataa actttgcata ttagtaccat ttgtccaata catttgcttt ttctttataa 120

aacccaaact cattcattaa tcaggtttaa tctgcttagt ttagggaaca atttggcaat 180

tttgtggatt tttttttgag attatcgtag acttaaagtg ccagtgtttt aaatagcgtt 240

cttgtaattt cacgcgcttt tgtgatggag tgctgttata taattttgac ttgggttctt 300

tacatttgcg ttgttaatgt aatttgagga ggaatactga acatgagtcc tggatgatac 360

taataaacta ataattacag aggttttaaa tattagttaa 400

<210>15

<211>3035

<212>DNA

<213>HMGB1

<400>15

gaatcaatcc tgcccgcgcg cgcgccaggg caccccaact tttcacgggc ccggtttggg 60

agacaaacaa acaaaaaaaa agacaaaaaa aaaaaaaaag aagagagcgt gcccgacacc 120

cccgtggtgg cggaggaggc ggcggcagga gtggcttttg tccctcatcc ttgtttactc 180

ggagaaactt cagaccggac gtgtttagtc agagcagaaa cgcatctcgg ggccaaagcg 240

ataggaaact gcggcctctc cgggccccgg cccagcgccg cctccgcccg cccgcccgag 300

caaagtttga tgcgaacacg gcgtgctcta agagctggaa aatcaactaa acatgggcaa 360

aggagatcct aaaaagccga gaggcaaaat gtcctcatat gcattctttg tgcaaacttg 420

ccgggaggag cacaagaaga agcacccgga tgcttctgtc aacttctcag agttctccaa 480

gaagtgctca gagaggtgga agaccatgtc tgctaaagaa aaggggaaat ttgaagatat 540

ggcaaaggct gacaaggctc gttatgaaag agaaatgaaa acctacatcc cccccaaagg 600

ggagaccaaa aagaagttca aggaccccaa tgcacccaag aggcctcctt cggccttctt 660

cttgttctgt tctgagtacc gccccaaaat caaaggcgag catcctggct tatccattgg 720

tgatgttgca aagaaactag gagagatgtg gaacaacact gcagcagatg acaagcagcc 780

ctatgagaag aaagctgcca agctgaagga gaagtatgag aaggatattg ctgcctacag 840

agctaaagga aaacctgatg cagcgaaaaa gggggtggtc aaggctgaaa agagcaagaa 900

aaagaaggaa gaggaagatg atgaggagga tgaagaggat gaggaagagg aggaagaaga 960

ggaagacgaa gatgaagaag aagatgatga tgatgaataa gttggttcta gcgcagtttt 1020

tttttcttgt ctataaagca tttaaccccc ctgtacacaa ctcactcctt ttaaagaaaa 1080

aaattgaaat gtaaggctgt gtaagatttg tttttaaact gtacagtgtc tttttttgta 1140

tagttaacac actaccgaat gtgtctttag atagccctgt cctggtggta ttttcaatag 1200

ccactaacct tgcctggtac agtctggggg ttgtaaattg gcatggaaat ttaaagcagg 1260

ttcttgttgg tgcacagcac aaattagtta tatatgggga cagtagtttg gttttttgtt 1320

tttttttttt tttcttttgg ttttcttttt gggttttatt tttttcatct tcagttgtct 1380

ctgatgcagc ttatacgaag ataattgttg ttctgttaac tgaataccac tctgtaattg 1440

caaaaaaaaa attgcggctg ttttgttgac attctgaatg cttctaagta aatacaattt 1500

tttttattag tattgttgtc cttttcatag gtctgaaagt tttcttctca aggggaagct 1560

agtcttttgc tttgcccatt ttgggtcaca tggattatta gtgtgttatc tttcatctag 1620

ttagctggaa gagagctttt gtccacatgc cctgccattg tggtagggta acattttcat 1680

ccatagttga agaatctcct aaatcgtgat agttggataa gagatattat ataacctact 1740

tggcaaagca aggagtgatc aatactgtca caccgtggga ctattaggat caagcaatct 1800

gaacgtctgt ccttgaagga ctgatagaaa agtaccttct aatccttaca cgaggactct 1860

cctttaaccg ccattactgt gtaatgacag ttatattttg cagtttcccc tactaaagaa 1920

gacctgagaa tgtatcccca aaagtgtgag cttaaaatac aagactgctg tactatttgt 1980

tgaccttagt cccagcgaag gctatcacaa gaacgctggc tgtaaagcct ttgcccttct 2040

atctagatat ggattgctca ggaaacttga ctgtttaaag gtatttttaa ttacttgagc 2100

cagcttttaa aattatgcca catttaaaat gaagggtata ttttcctata ctgtggtttg 2160

tccctttatg aatcagatac aagaggataa actttgcata ttagtaccat ttgtccaata 2220

catttgcttt ttctttataa aacccaaact cattcattaa tcaggtttaa tctgcttagt 2280

ttagggaaca atttggcaat tttgtggatt tttttttgag attatcgttc tcttaaagtg 2340

ccagtgtttt aaatagcgtt cttgtaattt cacgcgcttt tgtgatggag tgctgttata 2400

taattttgac ttgggttctt tacatttgcg ttgttaatgt aatttgagga ggaatactga 2460

acatgagtcc tggatgatac taataaacta ataattacag aggttttaaa tattagttaa 2520

atgactttca cttaagaatt taagcttttg gtcacacttt ataatagtgc cttatagtat 2580

aaacaactga aaggctcttt cccattaaca acccttgatg ctggggccag tgagatagtg 2640

ggtaaaaagg cagttggctg ccaaccctga caaccgatgg caaaaggagg gaaccagctt 2700

ccaaaatgct ttgaccaaat gctccctcca ttcatgaaca cagttttaaa atgttaaata 2760

ggctagaggg cagtaaaaac aggttttttt atcgagcatc cctaatctat acatatgagg 2820

agccataatc tgaatgttaa gtgaaaagcg aggttggtct taaagattgc acgtgtgttc 2880

ttaagcctgt agaggacctc cgcaggccgt aatggtctcg attaccaact taagaacaag 2940

tgactggctt ggaaacttgt actgttgctt tagaactacc attgtggaca tctgttgtta 3000

gtaagtgatc catttaaaag tgaactctgc ctcaa 3035

<210>16

<211>17

<212>DNA

<213> U6 Forward primer

<400>16

ctcgcttcgg cagcaca 17

<210>17

<211>20

<212>DNA

<213> U6 reverse primer

<400>17

aacgcttcac gaatttgcgt 20

Claims

1. The application of a nucleic acid molecule in preparing a product for negatively regulating the expression of HMGB1 is characterized in that the nucleotide sequence of the nucleic acid molecule is shown as SEQ ID No. 1.

2. The application of a nucleic acid molecule in preparing a product for negatively regulating translocation of HMGB1 from nucleus to cytoplasm is characterized in that the nucleotide sequence of the nucleic acid molecule is shown as SEQ ID No. 1.

3. The application of a nucleic acid molecule in preparing a medicine for treating candida albicans infection is characterized in that the nucleotide sequence of the nucleic acid molecule is shown as SEQ ID No. 1.