CN107245500A - A kind of pouring based on OCTS technologies is leukaemia CAR T therapy vectors and its construction method and application - Google Patents

Abstract

It is leukaemia CAR T therapy vectors the invention discloses a kind of pouring based on OCTS technologies, including slow virus skeleton plasmid, people EF1 α promoters, OCTS Chimerical receptors domain and IL6R single-chain antibodies；OCTS Chimerical receptor domains include：CD8 leader Chimerical receptors signal peptide, two groups of single-chain antibodies：First group is selected from any one group of following four groups of single-chain antibodies：CD20 single-chain antibody light chain VL, CD20 single-chain antibody heavy chains VH；CD22 single-chain antibody light chain VL, CD22 single-chain antibody heavy chains VH；CD30 single-chain antibody light chain VL, CD30 single-chain antibody heavy chains VH；CD123 single-chain antibody light chain VL, CD123 single-chain antibody heavy chains VH；Second group is CD19 single-chain antibody light chain VL and CD19 single-chain antibody heavy chains VH；Hinge Inter Linker, CD8 Hinge Chimerical receptors hinge, CD8 Transmembrane Chimerical receptors transmembrane region, TCR Chimerical receptor t cell activation domains and Chimerical receptor costimulating factor region between antibody inner hinge Inner Linker, single-chain antibody.In addition, the invention also discloses the construction method of the carrier and its preparing the application during the medicine for being leukaemia is drenched in treatment.

Description

A kind of pouring based on OCTS technologies is leukaemia CAR-T therapy vectors and its structure side Method and application

Technical field

The invention belongs to field of medical biotechnology, and in particular to a kind of carrier, more particularly to a kind of pouring based on OCTS technologies It is leukaemia CAR-T therapy vectors.Moreover, it relates to construction method and the application of the carrier.

Background technology

The theoretical foundation of immunotherapy of tumors is that immune system has identification tumor associated antigen, regulation and control body attack tumour The ability of cell (the cell dissolving of high degree of specificity).Generation nineteen fifty, Burnet and Thomas propose " immunosurveillance " reason By, it is believed that the tumour cell of the mutation often occurred in body can be recognized and removed by immune system, be that tumour immunity is controlled Treatment established theoretical foundation [Burnet FM.Immunological aspects of malignant disease.Lancet, 1967；1:1171-4].Then, various tumour immunotherapies include cytokine therapy, monoclonal antibody therapy, adoptive immunity The sequential uses such as therapy, vaccine therapy are in clinic.

A kind of more advanced tumour immunotherapy in 2013 --- CAR-T therapies are used successfully to clinic, and are demonstrated by preceding institute not Some clinical efficacies.CAR-T, full name is Chimeric Antigen Receptor T-Cell Immunotherapy, is fitted together to Antigen receptor T cell immunotherapy.The therapy is the means by transgenosis, by promoter, antigen recognizing district, costimulation because The chimeric molecule that son, effect area etc. are collectively constituted, is imported in T cell genome, so that T cell is to the identification of target cell, letter Number transduction, killing etc. function combine together, realize specific killing [the Eleanor J.Cheadle, et to target cell al.CAR T cells:driving the road from the laboratory to the clinic. Immunological Reviews 2014.Vol.257:91–106].CAR-T therapies are clinically most leading Novartis CLT019, refractory Patients With Acute Lymphoblastic Leukemia, the tumour Progression free survival rate of six months are recurred using CLT019 treatments 67% is reached, wherein most long response time was reached more than 2 years.General headquarters are located at the Shanghai You Kadi biological medicines section of Chinese Shanghai Skill Co., Ltd cooperated with hospital, by the end of 2 months 2017, altogether the refractory Patients With Acute Lymphoblastic Leukemia 36 for the treatment of recurrence Example, wherein complete 24, alleviation ratio reaches 66.6%.This is the subversiveness breakthrough of anticancer research.CAR-T cell therapies can Can be one of most possible means for curing cancer, and by《Science》Magazine be chosen as 2013 annual ten big technological breakthroughs it It is first.

CAR-T is evident in efficacy in terms of the neoplastic hematologic disorder of the several types such as treatment B- lymphocytic leukemias at present, still There is also some limitations, the previous Chimeric antigen receptor of mesh can only recognize a kind of antigenic targets, and tumour cell is a complexity Colony, after the tumour cell containing corresponding antigens is eliminated, the tumour cell without corresponding antigens can be bred rapidly, one section Cause tumor recurrence after time.CAR-T identifications are so made just there are two schemes optional while recognizing two kinds of antigens：One is Two groups of Chimeric antigen receptors are built and enter a slow virus transgene carrier, disposably two groups of Chimeric antigen receptors are transduceed Into primary T lymphocytes；Two are transduceed in two times with two slow virus transgene carriers, by two groups of Chimeric antigen receptors point Primary T lymphocytes Zhuan Dao not entered.

The shortcoming of scheme one is the valuable capacity for taking slow virus transgene carrier, is unfavorable for loading other Functional Units Part；Transgene carrier packaging efficiency is low；Gene transduction efficiency is very low, it is difficult to transduce into primary T lymphocytes.

Scheme two disadvantage is that by transduceing twice, the overall efficiency transduceed twice is relatively low, transduce cycle time Long, the easy aging of primary cell causes multiplication capacity to fail, and killing ability declines, and influences tumor clearance curative effect.

People B-lymphocyte antigen CD19, also known as CD19, are a kind of albumen by people's CD19 gene codes Matter.CD19 is mainly expressed in dendritic cells,follicular and B cell surface.CD19 is not expressed in hemopoietic stem cell surface, and it is present In Pro-B cell to Memory B cell stage of development, thick liquid cell (Plasma cell) surface is disappeared to.CD19 is big Most B cell malignant tumour surface expressions, including chronic lymphocytic leukemia (CLL), B ALLs (B- ALL), Diffuse Large B-Cell Lymphoma (DLBCL), follicular lymphoma (FL) lymphoma mantle cell (MCL).Therefore, CD19 is Target spot [Scheuermann RH, the Racila E.CD19 antigen in of one good tumour cell immunization therapy leukemia and lymphoma diagnosis and immunotherapy.Leukemia&Lymphoma.1995,18 (5-6): 385–97.]。

CD22 is the main I type transmembrane protein expressed in ripe bone-marrow-derived lymphocyte, and important work is played in B cell signal transduction With.CD22 causes CD22 and BCR to be crosslinked as a co-receptor of B-cell receptor (BCR) by antigen, triggers CD22 phosphoric acid Change, mainly make downstream signaling proteins dephosphorylation and inactivation, suppress BCR signal transductions.CD22 is prevalent in normal B cells In B cell malignant tumour.

A kind of growths of the CD20 as composition of signal transduction compound to bone-marrow-derived lymphocyte has adjustment effect, and CD20 The specific expressed differential period in pre B cell to mature B cell, especially most of lymphoma cell surfaces (Mohamed-Rachid Boulassel and Ahmed Galal. Immunotherapy for B-Cell Neoplasms using T Cells expressing Chimeric Antigen Receptors.Sultan Qaboos University Med J,August 2012,Vol.12,Iss.3,pp.273-285.)。

CD30 belongs to Tumor Necrosis Factor Receptors family, is played an important role in the apoptosis and propagation of lymphocyte, almost There is expression in all Hodgkin lymphomas and part NHL surface, drenched at present in clinic as Huo Qijin Bar knurl and important symbol (Carlos A.Ramos, the et al.Chimeric T-Cells of primary cutaneous type diagnosis for Therapy of CD30+Hodgkin and Non-Hodgkin Lymphomas (HL&NHL).Biology of Blood and MarrowTransplantation,2016,22(3):S145-S146.)。

CD123 is the alpha chains of human interleukin-13 acceptor, in most acute myeloid leukemia (AML) cell and a lot There is expression on hematopoietic cell surface, and CD123 is an extraordinary immunotherapeutic targets, because even seldom in CD123 expression Cell in, its expression can increase with the time and gradually strengthen, and acute myeloid leukemia is likely due to be in white blood The candidate stem cell of sick early stage passes through clone evolution, using CD123 as target spot, then can play a part of clear marrow (Saar Gill,Carl H.June et al.Preclinical targeting of human acute myeloid leukemia and myeloablation using chimeric antigen receptor-modified T cells.Blood.2014；123(15):2343-2354.).

IL-6 acceptors (IL-6R) are made up of an IL6 receptor subunits and two gp130 signal transductions subunits, mainly It is distributed in liver cell, neutrophil leucocyte, monokaryon, macrophage and lymphocytic cell surface；There is a kind of soluble recepter in addition (sIL-6R), this receptor deficiency cross-film composition and cytoplasmic components, in signal transduction, the sIL-6R and film combination of activation Gp130 subunits combine, and play it and act on [RoseJS, SchellerJ, ElsonG, et al.Interleukin- 6biology is coordinated by membrane-bound and soluble receptors:role in in- flammation and cancer.J Leukoc Biol,2006,80:227-236].Cell in CAR-T cell therapies because Sub- storm (CRS) is just related to the overactivity of IL-6 signal paths, blocks closing IL-6R, is conducive to blocking IL-6 signals to lead to The excessive activation on road, so as to control CRS to react.

At present, not yet have and overcome disadvantages mentioned above to be directed to CD19 and any one in CD22, CD20, CD30, CD123 Plant the relevant report of the dual anti-former CAR-T treatments of antigen composition.

The content of the invention

It is leukaemia CAR-T treatments that one of the technical problem to be solved in the present invention, which is to provide a kind of pouring based on OCTS technologies, Carrier.First, it only needs once to transduce, and transduction efficiency is high, the curative effect for not influenceing CAR-T to treat；Secondly, it is not take up slowly The valuable capacity of Viral Gene Transfer Vectors, beneficial to the other function element of loading.3rd, IL6R can be effectively closed, IL6 letters are blocked Number path, prevents inflammatory factor storm (CRS) from upgrading.

The second technical problem to be solved by the present invention is to provide the construction method of the carrier.

The third technical problem to be solved by the present invention is to provide the application of the carrier.

In order to solve the above technical problems, the present invention is adopted the following technical scheme that：

It is in one aspect of the invention leukaemia CAR-T therapy vectors there is provided a kind of pouring based on OCTS technologies, including it is slow Viral backbone plasmid, people EF1 α promoters, OCTS Chimerical receptors domain and IL6R single-chain antibodies；

The slow virus skeleton plasmid includes：The AmpR containing ampicillin resistance gene largely expanded for purpose bacterial strain Sequence, as shown in SEQ ID NO.1；For the prokaryotic replions pUC Ori sequences of plasmid replication, such as SEQ ID NO.2 institutes Show；Viral Replicon SV40Ori sequences for strengthening the duplication in eukaryotic, as shown in SEQ ID NO.3；For slow The slow virus packaging cis element of virus packaging；ZsGreen1 green fluorescent proteins, as shown in SEQ ID NO.11；IRES cores Sugared body binding sequence, as shown in SEQ ID NO.12；The enhanced marmots of eWPRE of expression efficiency for strengthening transgenosis Hepatitis B posttranscriptional regulatory element, as shown in SEQ ID NO.13；

The sequence of the people EF1 α promoters is as shown in SEQ ID NO.14；

The OCTS Chimerical receptors domain includes：CD8 leader Chimerical receptor signals as shown in SEQ ID NO.15 Peptide, two groups of single-chain antibodies：First group is selected from any one group of following four groups of single-chain antibodies：As shown in SEQ ID NO.18 CD20 single-chain antibody light chains VL, the CD20 single-chain antibody heavy chains VH as shown in SEQ ID NO.19；As shown in SEQ ID NO.20 CD22 single-chain antibody light chains VL, the CD22 single-chain antibody heavy chains VH as shown in SEQ ID NO.21；Such as SEQ ID NO.22 institutes The CD30 single-chain antibody light chains VL shown, the CD30 single-chain antibody heavy chains VH as shown in SEQ ID NO.23；Such as SEQ ID NO.24 Shown CD123 single-chain antibody light chains VL, the CD123 single-chain antibody heavy chains VH as shown in SEQ ID NO.25；Second group is such as CD19 single-chain antibody light chain VL shown in SEQ ID NO.16 and the CD19 single-chain antibody heavy chains as shown in SEQ ID NO.17 VH；Antibody inner hinge Inner-Linker as shown in SEQ ID NO.26, between the single-chain antibody as shown in SEQ ID NO.27 Hinge Inter-Linker, the CD8 Hinge Chimerical receptors hinge as shown in SEQ ID NO.28, as shown in SEQ ID NO.29 CD8 Transmembrane Chimerical receptors transmembrane region, the TCR Chimerical receptor t cell activations domain as shown in SEQ ID NO.32 And Chimerical receptor costimulating factor region；The Chimerical receptor costimulating factor region be selected from 4-1BB, ICOS, CD27, OX40、CD28、 MYD88、IL1R1、CD70、TNFRSF19L、TNFRSF27、TNFRSF1OD、TNFRSF13B、TNFRSF18、 The tumor necrosis factor superfamilies such as CD134 (tumor necrosis factor receptor superfamily, TNFRSF) In the combination of any one or more.

The slow virus packaging cis element can use second generation slow virus carrier, it would however also be possible to employ third generation slow virus Carrier.The slow virus packaging cis element is included using second generation slow virus carrier：Slow disease as shown in SEQ ID NO.5 Malicious 5terminal LTR, slow virus 3terminal Self-Inactivating LTR as shown in SEQ ID NO.6, such as Gag cis elements shown in SEQ ID NO.7, the RRE cis elements as shown in SEQ ID NO.8, such as SEQ ID NO.9 institutes Env cis elements, the cPPT cis elements as shown in SEQ ID NO.10 shown.The slow virus packaging cis element is used Third generation slow virus carrier includes：Slow virus 5terminal LTR as shown in SEQ ID NO.5, such as SEQ ID NO.6 institutes The terminal Self-Inactivating LTR of slow virus 3 that show, Gag cis elements as shown in SEQ ID NO.7, such as RRE cis elements shown in SEQ ID NO.8, the env cis elements as shown in SEQ ID NO.9, such as SEQ ID NO.10 institutes The cPPT cis elements shown, and the RSV promoters as shown in SEQ ID NO.4.Present invention preferably employs third generation slow virus Carrier.

It is preferred that, two groups of single-chain antibodies use and are connected in series mode or corner connected mode；As shown in Figure 4：

When two groups of single-chain antibodies are CD20 single-chain antibodies and CD19 single-chain antibodies, the mode that is connected in series is specially： CD20 single-chain antibody light chain VL and CD19 single-chain antibody light chains VL uses hinge Inter-Linker connections between single-chain antibody, CD20 single-chain antibody light chain VL are connected with CD20 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker, and CD19 is mono- Chain antibody light chain VL is connected with CD19 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker, i.e. pOCTS2019s (see Fig. 4 A, Fig. 4 C)；The corner connected mode is specially：CD19 single-chain antibody light chain VL and CD19 single-chain antibody heavy chains VH Using the Inner-Linker connections of antibody inner hinge, CD20 single-chain antibody light chain VL and CD19 single-chain antibody heavy chains VH is using single Hinge Inter-Linker connections between chain antibody, CD20 single-chain antibody heavy chain VH and CD19 single-chain antibody light chains VL is using single-stranded Hinge Inter-Linker connections between antibody, i.e. pOCTS2019t (see Fig. 4 B, Fig. 4 C)；

When two groups of single-chain antibodies are CD30 single-chain antibodies and CD19 single-chain antibodies, the mode that is connected in series is specially： CD30 single-chain antibody light chain VL and CD19 single-chain antibody light chains VL uses hinge Inter-Linker connections between single-chain antibody, CD30 single-chain antibody light chain VL are connected with CD30 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker, and CD19 is mono- Chain antibody light chain VL is connected with CD19 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker, i.e. pOCTS3019s (see Fig. 4 A, Fig. 4 C)；The corner connected mode is specially：CD19 single-chain antibody light chain VL and CD19 single-chain antibody heavy chains VH Using the Inner-Linker connections of antibody inner hinge, CD30 single-chain antibody light chain VL and CD19 single-chain antibody heavy chains VH is using single Hinge Inter-Linker connections between chain antibody, CD30 single-chain antibody heavy chain VH and CD19 single-chain antibody light chains VL is using single-stranded Hinge Inter-Linker connections between antibody, i.e. pOCTS3019t (see Fig. 4 B, Fig. 4 C)；

When two groups of single-chain antibodies are CD22 single-chain antibodies and CD19 single-chain antibodies, the mode that is connected in series is specially： CD22 single-chain antibody light chain VL and CD19 single-chain antibody light chains VL uses hinge Inter-Linker connections between single-chain antibody, CD22 single-chain antibody light chain VL are connected with CD22 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker, and CD19 is mono- Chain antibody light chain VL is connected with CD19 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker, i.e. pOCTS2219s (see Fig. 4 A, Fig. 4 C)；The corner connected mode is specially：CD19 single-chain antibody light chain VL and CD19 single-chain antibody heavy chains VH Using the Inner-Linker connections of antibody inner hinge, CD22 single-chain antibody light chain VL and CD19 single-chain antibody heavy chains VH is using single Hinge Inter-Linker connections between chain antibody, CD22 single-chain antibody heavy chain VH and CD19 single-chain antibody light chains VL is using single-stranded Hinge Inter-Linker connections between antibody, i.e. pOCTS2219t (see Fig. 4 B, Fig. 4 C)；

When two groups of single-chain antibodies are CD123 single-chain antibodies and CD19 single-chain antibodies, the mode that is connected in series is specially： CD123 single-chain antibody light chain VL and CD19 single-chain antibody light chains VL uses hinge Inter-Linker connections between single-chain antibody, CD123 single-chain antibody light chain VL are connected with CD123 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker, CD19 Single-chain antibody light chain VL is connected with CD19 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker, i.e., POCTS12319s (see Fig. 4 A, Fig. 4 C)；The corner connected mode is specially：CD19 single-chain antibody light chain VL and CD19 are single-stranded Heavy chain of antibody VH uses the Inner-Linker connections of antibody inner hinge, CD123 single-chain antibody light chain VL and CD19 single-chain antibody weights Chain VH uses hinge Inter-Linker connections between single-chain antibody, CD123 single-chain antibody heavy chain VH and CD19 single-chain antibody light chains VL uses hinge Inter-Linker connections, i.e. pOCTS12319t between single-chain antibody (see Fig. 4 B, Fig. 4 C).

It is preferred that, the sequence of the IL6R single-chain antibodies is as shown in SEQ ID NO.33.

It is preferred that, the enhancing that the enhanced marmot hepatitis B posttranscriptional regulatory elements of eWPRE have 6 nucleotides is dashed forward Become, be specially： g.396G>A、g.397C>T、g.398T>C、g.399G>A、g.400A>T、g.411A>T.

It is preferred that, whole OCTS expression of structural gene is started by the people EF1 α promoters, the CD8 leader are fitted together to Receptor signal peptide is located at the N-terminal of OCTS coded sequences, for guiding OCTS albumen to be positioned at cell membrane；Described two groups single-stranded anti- Body is combined into double antigen recognizing districts, for recognizing corresponding target antigen；The CD8 Hinge Chimerical receptors hinge is used for scFv It is anchored on the outside of cell membrane；The CD8 Transmembrane Chimerical receptors transmembrane region is used to whole Chimerical receptor being fixed on On cell membrane；The CD28 Chimerical receptors costimulating factor is used to stimulate the activation of T lymphocytes in vitro and interior tumor cell to kill Wound is acted on；The CD134 Chimerical receptors costimulating factor is used to promote T lymphopoiesis and cytokine secretion, and enhancing tumour is exempted from Epidemic disease, is conducive to the long-term surviving of memory T cell；The TCR Chimerical receptors t cell activation domain is used to activate downstream signaling pathway Expression；The IL6R single-chain antibodies are secreted into extracellular, closing IL6R, block IL6 signal paths, prevent inflammatory factor storm Upgrading；When antigen recognition region is combined with target antigen, signal be transferred to by Chimerical receptor it is intracellular, so as to produce T cell Propagation, cytokine secretion increase, Anti-apoptotic proteins secretion increase, cell death delay, cracking target cell etc. are a series of Biological effect.

It is preferred that, the Chimerical receptor costimulating factor region is using the CD28 Chimerical receptors as shown in SEQ ID NO.30 Costimulating factor and the CD134 Chimerical receptors costimulating factor combination as shown in SEQ ID NO.31.

It is preferred that, CD19 single-chain antibodies light chain VL, CD19 single-chain antibody heavy chain VH, CD20 single-chain antibody light chain VL, CD20 single-chain antibody heavy chain VH, CD30 single-chain antibody light chain VL, CD30 single-chain antibody heavy chain VH, CD123 single-chain antibody light chains VL, CD123 single-chain antibody heavy chain VH, IL6R single-chain antibody are by humanization modified.

There is provided a kind of above-mentioned pouring based on OCTS technologies it is leukaemia CAR-T therapy vectors in the second aspect of the present invention Construction method, comprise the following steps：

(1) by the sequences of AmpR containing ampicillin resistance gene as shown in SEQ ID NO.1, such as SEQ ID NO.2 institutes The prokaryotic replions pUC Ori sequences shown, the Viral Replicon SV40Ori sequences as shown in SEQ ID NO.3, for slow disease Slow virus packaging cis element, such as the ZsGreen1 green fluorescent proteins as shown in SEQ ID NO.11, the SEQ ID of poison packaging The enhanced marmot hepatitis B of IRES ribosome binding sequences shown in NO.12, the eWPRE as shown in SEQ ID NO.13 turns Controlling element is stored on slow virus skeleton plasmid after record；

(2) by the people EF1 α promoters shown in SEQ ID NO.14, as described in OCTS Chimerical receptors domain and such as SEQ IL6R single-chain antibodies shown in ID NO.33 are combined into OCTS Chimerical receptor designs, by digestion, connection, recombining reaction It is cloned into slow virus skeleton plasmid, obtains the recombinant slow virus plasmid of third generation OCTS designs；

(3) by obtained recombinant slow virus plasmid respectively with slow virus packaging plasmid pPac-GP, pPac-R and memebrane protein Plasmid pEnv-G transfects HEK293T/17 cells jointly, carries out after gene transcript expression, is packaged into HEK293T/17 cells Work(recombined lentivirus vector can be discharged into cells and supernatant, collect the supernatant of the recombined lentivirus vector included；

(4) obtained recombinant slow virus supernatant is purified using the post way of purification of suction filtration, absorption, elution, respectively Obtain recombined lentivirus vector.

It is preferred that, in step (4), the suction filtration step will control supernatant volume in 200ml~2000ml, control vacuum In -0.5MPA~-0.9MPA, prevent due to the carrier loss that plug-hole is brought；The adsorption step will control the pH value of solution to exist 6~8, preventing PH change causes carrier to inactivate；The elution step to control the ionic strength of eluent 0.5M~ 1.0M, prevents the change of ionic strength from causing elution not exclusively or carrier inactivation.

In the third aspect of the present invention the application during the medicine for being leukaemia is drenched in treatment is being prepared there is provided described carrier.

Compared with prior art, the present invention has the advantages that：

OCTS-CAR-T technologies of the present invention, are on the basis of current tradition CAR-T cell therapies, by right The Optimizing Reconstruction of Chimeric antigen receptor (CAR) structure so that Chimeric antigen receptor can recognize two kinds of antigens, is expanded significantly The identification range of CAR-T cells, the removing for cancer colonies is more thorough, and curative effect is more longlasting；Avoid batch culture CAR-T thin Born of the same parents, greatly save cost；Avoid patient from repeatedly feeding back different targeting CAR-T cells, saved the economic expenditure of patient, reduce The probability of recurrence, improves life in patients indirectly.Only need once to transduce, transduction efficiency is high, do not influence what CAR-T was treated Curative effect；The valuable capacity of slow virus transgene carrier is not take up, beneficial to other function element are loaded, transgene carrier packaging is imitated Rate is high, and gene transduction efficiency is high.

OCTS full name is One CAR with Two ScFvs, passes through the OCTS that connects (Series OCTS) or corner OCTS (Turn OCTS) connected mode, by two sections of scFv with being integrated into a chimeric molecule (as shown in Figure 1), assigns T and drenches The mode of bar cell HLA non-dependent recognizes the ability of two kinds of tumour antigens, can be recognized more relative to traditional CAR-T cells Extensive target, further expands the removing scope of tumour cell.It is anti-that OCTS basic engineering includes two tumour correlations Former (tumor-associated antigen, TAA) land (is typically derived from monoclonal antibody antigen calmodulin binding domain CaM ScFv sections), an extracellular hinge area, a transmembrane region, Liang Ge intracellular signal transductions area and a response element area.ScFv areas Domain is crucial determinant for OCTS specificity, validity and the genetic modification T cell security of itself. It will indicate that CAR-T cell therapies will enter for 2.0 epoch into clinical investigation phase with OCTS-CAR-T.

Carrier framework of the present invention can apply in third generation slow virus carrier structure, can also be applied to the In two generation slow virus carrier structures.The difference of the second generation and third generation slow virus carrier in structure is as shown in Figure 2 B.The present invention It is preferred that third generation slow virus carrier (as shown in Figure 2 A), 3 ' SIN LTR eliminate U3 regions, eliminate slow virus carrier self The possibility of duplication, substantially increases security；CPPT and WPRE elements are added, transduction efficiency and transgenosis is improved Expression efficiency；The lasting efficient transcription of core RNA when ensure that slow virus carrier packaging using RSV promoters；Using people itself EF1 α promoters, enable CAR genes in human body long lasting for expression.

CD19 single-chain antibodies light chain VL, CD19 single-chain antibody heavy chain VH, CD20 single-chain antibody light chain VL of the present invention, CD20 single-chain antibody heavy chain VH, CD22 single-chain antibody light chain VL, CD22 single-chain antibody heavy chain VH, CD30 single-chain antibody light chains VL, CD30 single-chain antibody heavy chain VH, CD123 single-chain antibody light chain VL, CD123 single-chain antibody heavy chain VH, IL6R single-chain antibodies are passed through Cross humanization modified, can effectively reduce the production that the anti-mouse of internal people resists (Human anti-mouse antibodies, HAMA) It is raw, extend scFv half-life period and action effect, increase the existence time of OCTS-CAR-T cells.

One kind of the costimulating factor used in the present invention or several combination, by increasing capacitance it is possible to increase the propagation speed of cell after transduction The characteristics such as rate, time-to-live, killing-efficiency, immunological memory.

The OCTS-CAR-T cells that the present invention is used are after the Workshop Production of GMP ranks, available for human clinical trial.

The present invention recombined lentivirus vector can realize on human T lymphocyte express CD19, CD20, CD22, CD30, Double targeting Chimeric antigen receptors of the combinations such as CD123, guide and activated T lymphocytes to CD19, CD20, CD22, CD30, The lethal effect of the positive cells such as CD123, the clinically treatment available for treatment bone-marrow-derived lymphocyte leukaemia, B lymthomas.

The present invention by recombined lentivirus vector skeleton, OCTS domains, interleukin-6 acceptor (IL6R) single Chain antibody (single-chain antibody) build and form recombined lentivirus vector, and the recombined lentivirus vector which is obtained can To realize the single-chain antibody that IL-6R is expressed in human T lymphocyte, IL6R can be effectively closed, IL-6 signal paths is blocked, faces It can be used for alleviating cytokine release syndrome (Cytokine Release Syndrome, CRS) on bed, ensure cell therapy During patient life security.

It can be seen that, OCTS-CAR-T cells of the present invention will provide reliable ensure to tumour cell treatment.

Brief description of the drawings

Fig. 1 is the schematic diagram of OCTS Chimerical receptors of the present invention, contains series connection OCTS (Series OCTS) and turns Angle OCTS (Turn OCTS) schematic diagram；

Fig. 2 slow virus carrier structural representations of the present invention；Wherein Fig. 2A is that the third generation that the present invention is used is sick slowly Poisonous carrier structural representation, Fig. 2 B are the second generation and third generation slow virus carrier structure comparison schematic diagram；

Fig. 3 is to build the structure flow chart of recombined lentivirus vector of the present invention in the embodiment of the present invention 1.Wherein, (A) figure is slow virus skeleton plasmid pLenti-3G basic structural representation；(B) figure is the schematic diagram of 8 OCTS plasmids； (C) figure is the structural representation of pPac-GP plasmids；(D) figure is the structural representation of pPac-R plasmids；(E) figure is pEnv-G bags Fill the structural representation of plasmid；

Fig. 4 is the element orders schematic diagram of OCTS structures in the embodiment of the present invention 1, wherein, A figures are series connection OCTS The structural representation of (Series OCTS), B figures are corner OCTS (Turn OCTS) structural representations, and C figures are OCTS structures Plasmid number (OCTS Symbol) list schematic diagram；

Fig. 5 be recombinant slow virus plasmid pOCTS12319s in the embodiment of the present invention 1, pOCTS2219s, pOCTS2019s, POCTS3019s, pOCTS12319t, pOCTS2219t, pOCTS2019t, pOCTS3019t digestion prediction and digestion agarose Gel electrophoresis figure；Wherein Fig. 5 A are pOCTS12319s digestion prediction schematic diagrames, and Fig. 5 B are pOCTS12319s digestion agar Sugared gel electrophoresis figure；Fig. 5 C are pOCTS2219s digestion prediction schematic diagrames, and the digestion agarose that Fig. 5 D are pOCTS2219s coagulates Gel electrophoresis figure；Fig. 5 E are pOCTS2019s digestion prediction schematic diagrames, and Fig. 5 F are pOCTS2019s digestion Ago-Gel electricity Swimming figure；Fig. 5 G are pOCTS3019s digestion prediction schematic diagrames, and Fig. 5 H are pOCTS3019s digestion agarose gel electrophoresis Figure；Fig. 5 I are pOCTS12319t digestion prediction schematic diagrames, and Fig. 5 J are pOCTS12319t digestion agarose gel electrophoresis Figure；Fig. 5 K are pOCTS2219t digestion prediction schematic diagrames, and Fig. 5 L are pOCTS2219t digestion agarose gel electrophoresis figures； Fig. 5 M are pOCTS2019t digestion prediction schematic diagrames, and Fig. 5 N are pOCTS2019t digestion agarose gel electrophoresis figures；Fig. 5 O It is pOCTS3019t digestion prediction schematic diagram, Fig. 5 P are pOCTS3019t digestion agarose gel electrophoresis figures；In Fig. 5 A Lane1 is 1kb DNA ladder Marker：Band is followed successively by from top to bottom：10kb、8kb、6kb、5kb、4kb、3.5kb、 3kb、2.5kb、2kb、 1.5kb、1kb、750bp、500bp、250bp；Lane2 in Fig. 5 A is pOCTS12319s BamH I Digestion is predicted：Band is followed successively by from top to bottom：11384bp、818bp；Lane1 in Fig. 5 B is 1kb DNA ladder Marker electrophoresis result；Lane2 in Fig. 5 B is pOCTS12319s BamH I restriction enzyme digestion and electrophoresis results；In Fig. 5 C Lane1 is 1kb DNA ladder Marker：Band is followed successively by from top to bottom：10kb、8kb、6kb、5kb、4kb、3.5kb、 3kb、2.5kb、2kb、1.5kb、1kb、750bp、500bp、250bp；Lane2 in Fig. 5 C is pOCTS2219s Kpn I enzymes Cut prediction：Band is followed successively by from top to bottom：7824bp、4322bp；Lane1 in Fig. 5 D is 1kb DNA ladder Marker Electrophoresis result；Lane2 in Fig. 5 D is pOCTS2219s Kpn I restriction enzyme digestion and electrophoresis results；Lane1 in Fig. 5 E is 1kb DNA ladder Marker：Band is followed successively by from top to bottom：10kb、8kb、6kb、5kb、4kb、3.5kb、3kb、2.5kb、 2kb、1.5kb、1kb、750bp、500bp、250bp；Lane2 in Fig. 5 E is pOCTS2019s ApaL I digestions prediction：Bar Band is followed successively by from top to bottom：4883bp、3931bp、1726bp、1246bp、497bp；Fig. 5 F lane1 are 1kb DNA Ladder Marker electrophoresis result；Fig. 5 F lane2 are pOCTS2019s ApaL I restriction enzyme digestion and electrophoresis results；In Fig. 5 G Lane1 is 1kb DNA ladder Marker：Band is followed successively by from top to bottom：10kb、8kb、6kb、5kb、4kb、3.5kb、 3kb、2.5kb、2kb、1.5kb、1kb、750bp、500 bp、250bp；Lane2 in Fig. 5 G is pOCTS3019s BamH I Digestion is predicted：Band is followed successively by from top to bottom：10268bp、1197bp、 818bp；Lane1 in Fig. 5 H is 1kb DNA Ladder Marker electrophoresis result；Lane2 in Fig. 5 H is pOCTS3019s BamH I restriction enzyme digestion and electrophoresis results；In Fig. 5 I Lane1 be 1kb DNA ladder Marker：Band is followed successively by from top to bottom：10kb、8kb、6kb、5kb、 4kb、 3.5kb、3kb、2.5kb、2kb、1.5kb、1kb、750bp、500bp、250bp；Lane2 in Fig. 5 I is pOCTS12319t Sal I digestions are predicted：Band is followed successively by from top to bottom：6934bp、5389bp；Lane1 in Fig. 5 J is 1kb DNA ladder Marker electrophoresis result；Lane2 in Fig. 5 J is pOCTS12319t Sal I restriction enzyme digestion and electrophoresis results；Lane1 in Fig. 5 K It is 1kb DNA ladder Marker：Band is followed successively by from top to bottom：10kb、8kb、6kb、5kb、4kb、3.5kb、3kb、 2.5kb、2kb、1.5kb、1kb、750 bp、500bp、250bp；Lane2 in Fig. 5 K is pOCTS2219t EcoR I digestions Prediction：Band is followed successively by from top to bottom：10626bp、 1399bp、311bp；Lane1 in Fig. 5 L is 1kb DNA ladder Marker electrophoresis result；Lane2 in Fig. 5 L is pOCTS2219t EcoR I restriction enzyme digestion and electrophoresis results；Lane1 in Fig. 5 M It is 1kb DNA ladder Marker：Band is followed successively by from top to bottom：10kb、8kb、 6kb、5kb、4kb、3.5kb、3kb、 2.5kb、2kb、1.5kb、1kb、750bp、500bp、250bp；The Pst I digestions that lane2 in Fig. 5 M is pOCTS2019t are pre- Survey：Band is followed successively by from top to bottom：9231bp、2554bp、617bp；Lane1 in Fig. 5 N is 1kb DNA ladder Marker electrophoresis result；Lane2 in Fig. 5 N is pOCTS2019t Pst I restriction enzyme digestion and electrophoresis results；Lane1 in Fig. 5 O It is 1kb DNA ladder Marker：Band is followed successively by from top to bottom：10kb、8kb、6kb、5kb、4kb、3.5kb、3kb、 2.5kb、2kb、1.5kb、1kb、750 bp、500bp、250bp；Lane2 in Fig. 5 O is pOCTS3019t Sac II digestions Prediction：Band is followed successively by from top to bottom：11652bp、887bp；Lane1 in Fig. 5 P is 1kb DNA ladder Marker Electrophoresis result；Lane2 in Fig. 5 P is pOCTS3019t Sac II restriction enzyme digestion and electrophoresis results；

Fig. 6 is the titre testing result schematic diagram of recombined lentivirus vector in the embodiment of the present invention 1；

Fig. 7 is the step flow chart of the OCTS-CAR-T cell constructions described in the embodiment of the present invention 1, includes separation training The stages such as foster, activation, gene transfer, OCTS-CAR-T cellular identifications；

Fig. 8 is the detection of mycoplasma result schematic diagram of OCTS-CAR-T cells in the embodiment of the present invention 2, wherein, lane1 is DL2000marker, from top to bottom bar counterband tape be followed successively by from top to bottom：2kb、1kb、750bp、500bp、250bp、100bp； Lane2 is positive control；Lane3 is negative control；Lane4 is PBS；Lane5 is lysate；Lane6 is OCTS12319s- CAR-T cells；Lane7 is OCTS2219s-CAR-T cells；Lane8 is OCTS2019s-CAR-T cells；Lane9 is OCTS3019s-CAR-T cells；Lane10 is OCTS12319t-CAR-T cells；Lane11 is that OCTS2219t-CAR-T is thin Born of the same parents；Lane12 is OCTS2019t-CAR-T cells；Lane13 is OCTS3019t-CAR-T cells；

Fig. 9 is the transduction efficiency and immunophenotyping result of flow cytometer detection OCTS-CAR-T cells in the embodiment of the present invention 2 Schematic diagram；Wherein, Fig. 9 A represent the transduction efficiency result of OCTS12319s-CAR-T cells；Fig. 9 B represent OCTS12319s- The immunophenotyping result of CAR-T cells；Fig. 9 C represent the transduction efficiency result of OCTS2219s-CAR-T cells；Fig. 9 D are represented The immunophenotyping result of OCTS2219s-CAR-T cells；Fig. 9 E represent the transduction efficiency result of OCTS2019s-CAR-T cells； Fig. 9 F represent the immunophenotyping result of OCTS2019s-CAR-T cells；Fig. 9 G represent the transduction of OCTS3019s-CAR-T cells Efficiencies；Fig. 9 H represent the immunophenotyping result of OCTS3019s-CAR-T cells；Fig. 9 I represent OCTS12319t-CAR-T The transduction efficiency result of cell；Fig. 9 J represent the immunophenotyping result of OCTS12319t-CAR-T cells；Fig. 9 K are represented The transduction efficiency result of OCTS2219t-CAR-T cells；Fig. 9 L represent the immunophenotyping result of OCTS2219t-CAR-T cells； Fig. 9 M represent the transduction efficiency result of OCTS2019t-CAR-T cells；Fig. 9 N represent immune point of OCTS2019t-CAR-T cells Type result；Fig. 9 O represent the transduction efficiency result of OCTS3019t-CAR-T cells；Fig. 9 P represent OCTS3019t-CAR-T cells Immunophenotyping result；

Under the conditions of Figure 10 is different effect target ratio in the embodiment of the present invention 3, OCTS-CAR-T cells are to target cell killing-efficiency Block diagram；Wherein, Figure 10 A represent OCTS12319s-CAR-T cells and OCTS12319t-CAR-T cells to different target cells Mortaility results；Figure 10 B represent that OCTS2219s-CAR-T cells and OCTS2219t-CAR-T cells are killed to different target cells Hinder result；Figure 10 C represent the killing knot of OCTS2019s-CAR-T cells and OCTS2019t-CAR-T cells to different target cells Really；Figure 10 D represent the Mortaility results of OCTS3019s-CAR-T cells and OCTS3019t-CAR-T cells to different target cells.

Embodiment

This invention is expanded on further with reference to specific embodiment.It should be understood that particular implementation described here Represent by way of example, be not intended as limitation of the present invention.Without departing from the scope of the invention, this hair Bright principal character can be used for various embodiments.Material

1st, slow virus skeleton plasmid pLenti-3G basic, slow virus packaging plasmid pPac-GP, pPac-R and film egg White matter grain pEnv-G, HEK293T/17 cells, homologous recombination enzyme, Oligo Annealing Buffer, mycoplasma test reagent Box, endotoxin detection kit, CD19⁺K562、 CD20⁺K562、CD22⁺K562、CD30⁺K562、CD123⁺K562、CD19⁺ CD123⁺K562、CD19⁺CD20⁺K562、CD19⁺CD22⁺K562、 CD19⁺CD30⁺K562, K562 cell are taken wing in (Shanghai) purchased from generation Biological medicine Science and Technology Ltd.；Slow virus skeleton plasmid pLenti-3G basic specific preparation method has been proposed in hair Bright entitled " a kind of based on the CAR-T transgene carriers and its construction method of replication defective recombinant slow virus and application ", specially In the patent application specification of sharp Application No. 201610008360.5；

2nd, people's fresh peripheral blood is provided by health donors；

3、OCTS12319s、OCTS2219s、OCTS2019s、OCTS3019s、OCTS12319t、OCTS2219t、 The combination of OCTS2019t, OCTS3019t DNA sequence dna, (referring to Fig. 4 C), gives Shanghai JaRa life by the design of Shanghai You Kadi companies Thing Engineering Co., Ltd synthesizes, and is preserved with oligonucleotides dry powder or plasmid form；

4th, toolenzyme Cla I, Pst I, Sac II, Sal I, EcoR I, BamH I, ApaL I, Kpn I, T4DNA connections Enzyme is purchased from NEB companies；

5th, 0.22 μm of -0.8 μm of PES filter is purchased from millipore companies；

6th, D-PBS (-), 0.4% trypan blue, screen cloth, all types of Tissue Culture Dish, culture bag, culture plate are purchased from Corning companies；

7、Opti-MEM、Pen-Srep、Hepes、FBS、AIM-V、RPMI 1640、DMEM、lipofectamine 3000 Purchased from invitrogen companies；

8th, Biotinylated protein L are purchased from GeneScript companies；

9th, LDH detection kits are purchased from promega companies；

10th, Ficoll lymphocyte separation mediums are purchased from GE companies；

11st, 20% human serum albumin injection is purchased from Ztel's Belling company；

12nd, CryoPremium frozen stock solutions, sorting buffer solution come from Shanghai You Kadi companies；

13rd, rIL-2, rIL-7, rIL-15, rIL-21 is purchased from peprotech companies；

14th, CD3 monoclonal antibodies, CD28 monoclonal antibodies, CD3/CD28 magnetic bead CD4/CD8 magnetic beads are purchased from Germany Miltenyi companies；

15th, refrigerated centrifuge (ThermoScientific companies of the U.S.；

16th, FACS flow cytometers are purchased from Thermo companies；

17th, fluorescence inverted microscope is purchased from Olympus companies；

18th, CD4-FITC, CD8-APC are purchased from BioLegend companies；

19th, 0.9% physiological saline is purchased from Jin Mai companies；

20th, ProteinL Magnetic Beads are purchased from BioVision companies；

21st, PrimeSTAR, RetroNectin are purchased from Takara companies；

22nd, phycoerythrin (PE)-conjugated streptavidin are purchased from BD Bioscience companies；

23rd, plasmid extraction kit, Ago-Gel QIAquick Gel Extraction Kit are purchased from MN companies；

24th, competent cell TOP10 is purchased from tiangen companies；

25、NaCl、KCl、Na₂HPO₄.12H₂O、KH₂PO₄、Trypsin、EDTA、CaCl₂, NaOH, PEG6000 be purchased from Give birth to work in Shanghai；

26th, DNeasy kits are purchased from Shanghai JaRa company；

27th, SA-HRP is purchased from Shanghai Yi Sheng companies；

28th, primer：Primer according to needed for design of primers principle designs amplification of DNA fragments and target site, the primer is by upper Marine growth company synthesizes,

Specially：

EF1α-F：5’-ATTCAAAATTTTATCGATGCTCCGGTGCCCGTCAGT-3’(SEQ ID NO.34)

EF1α-R：5’-TCACGACACCTGAAATGGAAGA-3’(SEQ ID NO.35)

OCTS-F：CATTTCAGGTGTCGTGAGGATCCGCCACCATGGCGCTGCCGGTGAC(SEQ ID NO.36)

OCTS-R：GGGGAGGGAGAGGGGCTTAGCGCGGCGGCAGCG(SEQ ID NO.37)

IRES-F：GCCCCTCTCCCTCCCCC(SEQ ID NO.38)

IRES-R：ATTATCATCGTGTTTTTCAAAGGAA(SEQ ID NO.39)

IL6Rscab-F：AAAACACGATGATAATGCCACCATGAACTCCTTCTCCACAAGCG(SEQ ID NO.40)

IL6Rscab-R：AATCCAGAGGTTGATTGTCGACGAATTCTCATTTGCCCGGGCTCAG(SEQ ID NO.41)

WPRE-QPCR-F：5’-CCTTTCCGGGACTTTCGCTTT-3’(SEQ ID NO.42)

WPRE-QPCR-R：5’-GCAGAATCCAGGTGGCAACA-3’(SEQ ID NO.43)

Actin-QPCR-F：5’-CATGTACGTTGCTATCCAGGC-3’(SEQ ID NO.44)

Actin-QPCR-R：5’-CTCCTTAATGTCACGCACGAT-3’(SEQ ID NO.45)

29th, in the present invention, SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ the ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ DNA fragmentation is by Shanghai shown in ID NO.29, SEQ ID NO.30, SEQ ID NO.31, SEQ ID NO.32, SEQ ID NO.33 The sequent synthesis that JaRa bioengineering Co., Ltd provides according to the present inventor.

The OCTS-CAR-T cell constructions of embodiment 1

First, recombined lentivirus vector lvOCTS12319s, lvOCTS2219s, lvOCTS2019s, lvOCTS3019s, LvOCTS12319t, lvOCTS2219t, lvOCTS2019t, lvOCTS3019t structure, purifying, detection method.

Referring to Fig. 3, the construction method of recombined lentivirus vector of the present invention is as follows：

1st, by people EF1 α promoters (SEQ ID NO.14), OCTS structures【CD8 as shown in SEQ ID NO.15 Leader Chimerical receptors signal peptide, two groups of single-chain antibodies：First group is selected from any one group of following four groups of single-chain antibodies：Such as SEQ CD20 single-chain antibody light chains VL shown in ID NO.18, the CD20 single-chain antibody heavy chains VH as shown in SEQ ID NO.19；Such as CD22 single-chain antibody light chains VL shown in SEQ ID NO.20, the CD22 single-chain antibody heavy chains VH as shown in SEQ ID NO.21； CD30 single-chain antibody light chains VL as shown in SEQ ID NO.22, the CD30 single-chain antibody heavy chains as shown in SEQ ID NO.23 VH；CD123 single-chain antibody light chains VL, the CD123 single-chain antibodies as shown in SEQ ID NO.25 as shown in SEQ ID NO.24 Heavy chain VH；Second group for the CD19 single-chain antibody light chain VL as shown in SEQ ID NO.16 and as shown in SEQ ID NO.17 CD19 single-chain antibody heavy chains VH；Antibody inner hinge Inner-Linker, such as SEQ ID as shown in SEQ ID NO.26 Hinge Inter-Linker, the CD8 Hinge Chimerical receptors as shown in SEQ ID NO.28 between single-chain antibody shown in NO.27 Hinge, the CD8 Transmembrane Chimerical receptors transmembrane region as shown in SEQ ID NO.29, as shown in SEQ ID NO.30 CD28 Chimerical receptors costimulating factor, the CD134 Chimerical receptors costimulating factor as shown in SEQ ID NO.31, such as SEQ ID TCR Chimerical receptor t cell activations domain shown in NO.32.OCTS12319s、OCTS2219s、OCTS2019s、OCTS3019s、 OCTS12319t, OCTS2219t, OCTS2019t, OCTS3019t, structure refer to Fig. 4】, IL6R single-chain antibodies (SEQ ID NO.33 OCTS Chimerical receptor designs) are combined into, slow virus skeleton plasmid is cloned into by digestion, connection, recombining reaction In pLenti-3G basic, respectively obtain recombinant slow virus plasmid pOCTS12319s, pOCTS2219s, pOCTS2019s, POCTS3019s, pOCTS12319t, pOCTS2219t, pOCTS2019t, pOCTS3019t, element orders and numbering such as Fig. 4 C It is shown.

(1) slow virus skeleton plasmid pLenti-3G basic are carried out using Cla I and EcoR I restriction enzymes double Digestion, product passes through 1.5% agarose gel electrophoresis, confirms 5823bp fragment V1, and recovery of tapping rubber is placed in In Eppendorf pipes, corresponding fragment (being shown in Table 1) is reclaimed with the Ago-Gel QIAquick Gel Extraction Kit of MN companies, and determine product Purity and concentration；

1st, colloidal sol	Sol solutionses are added in 200 μ l NTI/100mg gel ratios, 50 DEG C of water-baths are placed 5-10 minutes.
		2nd, with reference to DNA	11000g is centrifuged 30 seconds, discards filtrate.
3rd, film is washed	700 μ l NT3,11000g centrifugation 30 seconds is added, filtrate is discarded.
		4th, film is washed	Repeat the 3rd step once
5th, dry	11000g is centrifuged 1 minute, the collecting pipe renewed, and room temperature is placed 1 minute.
		6th, eluted dna	15-30 μ l NE are added, room temperature is placed 1 minute, and 11000g is centrifuged 1 minute, collects filtrate.

The Ago-Gel recycling step of table 1

(2) with primer EF1 α-F and EF1 α-R with the people EF1 α promoters (SEQ ID NO.14) that synthesize for template, use System in table 2, PCR cycle condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 2min) * 35cycle, 72 ℃10min.Product passes through 1.5% agarose gel electrophoresis, confirms 1208bp fragment a, and recovery of tapping rubber is placed in In Eppendorf pipes, corresponding fragment (being shown in Table 1) is reclaimed with the Ago-Gel QIAquick Gel Extraction Kit of MN companies, and determine product Purity and concentration；

Reagent	Volume (μ l)
		H2O	32.5
5×Buffer(with Mg2+)	10
		DNTP (each 2.5mM)	4
Primer1(+)(10μM)	1
		Primer2 (-) (10 μM)	1
Template	1
		PrimeSTAR	0.5

The μ l PCR reaction systems of table 2 50

(3) with primer OCTS-F and OCTS-R using the OCTS12319s that synthesizes as template, using the system in table 2, PCR is followed Ring condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms 2363bp fragment b, and recovery of tapping rubber is placed in Eppendorf pipes, uses MN companies Ago-Gel QIAquick Gel Extraction Kit reclaim corresponding fragment (being shown in Table 1), and determine the purity and concentration of product；

(4) with primer OCTS-F and OCTS-R using the OCTS2219s that synthesizes as template, using the system in table 2, PCR is followed Ring condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms 2369bp fragment c, and recovery of tapping rubber is placed in Eppendorf pipes, uses MN companies Ago-Gel QIAquick Gel Extraction Kit reclaim corresponding fragment (being shown in Table 1), and determine the purity and concentration of product；

(5) with primer OCTS-F and OCTS-R using the OCTS2019s that synthesizes as template, using the system in table 2, PCR is followed Ring condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms 2381bp fragment d, and recovery of tapping rubber is placed in Eppendorf pipes, uses MN companies Ago-Gel QIAquick Gel Extraction Kit reclaim corresponding fragment (being shown in Table 1), and determine the purity and concentration of product；

(6) with primer OCTS-F and OCTS-R using the OCTS3019s that synthesizes as template, using the system in table 2, PCR is followed Ring condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms 2381bp fragment e, and recovery of tapping rubber is placed in Eppendorf pipes, uses MN companies Ago-Gel QIAquick Gel Extraction Kit reclaim corresponding fragment (being shown in Table 1), and determine the purity and concentration of product；

(7) with primer OCTS-F and OCTS-R using the OCTS12319t that synthesizes as template, using the system in table 2, PCR is followed Ring condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms 2390bp fragment f, and recovery of tapping rubber is placed in Eppendorf pipes, uses MN companies Ago-Gel QIAquick Gel Extraction Kit reclaim corresponding fragment (being shown in Table 1), and determine the purity and concentration of product；

(8) with primer OCTS-F and OCTS-R using the OCTS2219t that synthesizes as template, using the system in table 2, PCR is followed Ring condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms 2399bp fragment g, and recovery of tapping rubber is placed in Eppendorf pipes, uses MN companies Ago-Gel QIAquick Gel Extraction Kit reclaim corresponding fragment (being shown in Table 1), and determine the purity and concentration of product；

(9) with primer OCTS-F and OCTS-R using the OCTS2019t that synthesizes as template, using the system in table 2, PCR is followed Ring condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms 2411bp fragment h, and recovery of tapping rubber is placed in Eppendorf pipes, uses MN companies Ago-Gel QIAquick Gel Extraction Kit reclaim corresponding fragment (being shown in Table 1), and determine the purity and concentration of product；

(10) with primer OCTS-F and OCTS-R using the OCTS3019t that synthesizes as template, using the system in table 2, PCR is followed Ring condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms 2424bp fragment i, and recovery of tapping rubber is placed in Eppendorf pipes, uses MN companies Ago-Gel QIAquick Gel Extraction Kit reclaim corresponding fragment (being shown in Table 1), and determine the purity and concentration of product；

(11) with primer I RES-F and IRES-R with the IRES ribosome binding sequences (SEQ ID NO.12) that synthesize for mould Plate, using the system in table 2, PCR cycle condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms 575bp fragment j, and recovery of tapping rubber is put In in Eppendorf pipes, corresponding fragment (being shown in Table 1) is reclaimed with the Ago-Gel QIAquick Gel Extraction Kit of MN companies, and determine production The purity and concentration of thing；

(12) it is with the IL6R single-chain antibodies (SEQ ID NO.33) synthesized with primer I L6Rscab-F and IL6Rscab-R Template, using the system in table 2, PCR cycle condition is：98 DEG C of 3min, (98 DEG C of 10sec, 55 DEG C of 15sec, 72 DEG C of 30sec) * 35cycle, 72 DEG C of 5min.Product passes through 1.5% agarose gel electrophoresis, confirms 1569bp fragment k, and recovery of tapping rubber It is placed in Eppendorf pipes, reclaims corresponding fragment (being shown in Table 1) with the Ago-Gel QIAquick Gel Extraction Kit of MN companies, and determine The purity and concentration of product；

(16) by recombinant slow virus DNA fragment combination (being shown in Table 3) with 5 μ l cumulative volumes and mol ratio 1:1:1:1 ratio Example is added in Eppendorf pipes, is added the μ l of homologous recombination enzyme reaction solution 15, is incubated 30 minutes at 42 DEG C after mixing, is transferred to ice Upper placement 2-3 minutes, reaction solution is added in 50 μ l TOP10, gently rotated to mix content, and 30 points are placed in ice Clock, is put into pre-heating heat shock 90 seconds into 42 DEG C of thermostat water bath by pipe, quickly pipe is transferred in ice bath, makes cell cold But 2-3 minutes, often pipe, was then transferred on 37 DEG C of shaking tables by pipe plus 900 μ l LB nutrient solutions, and incubation makes bacteria resuscitation in 1 hour, Take 100 μ l transformed bacteria solution to be coated on Amp LB agar plates, be inverted plate, 37 DEG C of cultures in constant incubator, 16 is small When.

The recombinant slow virus DNA fragment combination of table 3

Picked clones progress bacterium colony PCR identifications, the correct clone of identification as recombinant slow virus plasmid pOCTS12319s, pOCTS2219s、 pOCTS2019s、pOCTS3019s、pOCTS12319t、pOCTS2219t、pOCTS2019t、 POCTS3019t, carries out digestion identification (see Fig. 5), and send sequencing to check result to correct clone.

2nd, recombined lentivirus vector lvOCTS12319s, lvOCTS2219s, lvOCTS2019s, lvOCTS3019s, LvOCTS12319t, lvOCTS2219t, lvOCTS2019t, lvOCTS3019t packaging.

(1) complete medium：Preheated fresh culture is taken out, 10%FBS+5ml Pen-Srep is added, runs up and down Mix；

(2) 1XPBS solution：Weigh NaCl 8g, KCl 0.2, Na₂HPO₄.12H₂O 3.58g, KH₂PO4 0.24g are placed in In 1000ml beakers, the dissolving of 900ml Milli-Q grade ultra-pure waters is added, after the completion of dissolving, 1000ml graduated cylinder constant volumes are used To 1000ml, 121 DEG C of high-temperature heat sterilization 20min；

(3) 0.25%Trypsin solution:Trypsin 2.5g, EDTA 0.19729g is weighed to be placed in 1000ml beakers, 900ml 1XPBS dissolvings are added, after the completion of dissolving, 1000ml are settled to using 1000ml graduated cylinders, 0.22 μM of filtration sterilization is long Phase use can be preserved to -20 DEG C of refrigerators；

(4) 0.5M CaCl2 solution：Weigh 36.75g CaCl₂Dissolved with 400ml Milli-Q grade ultra-pure waters；With Cumulative volume is settled to 500ml by Milli-Q grade ultra-pure waters, is mixed；0.22 μm of filtration sterilization, packing be saved in 50ml from In heart pipe, every pipe 45ml or so, 4 DEG C of preservations.

(5) 2XHBS solution：Weigh 4.09g NaCl, 0.269g Na₂HPO4,5.96g Hepes, use 400ml Milli- Q grade ultra-pure waters dissolve；Calibrate after pH instrument, the pH of HBS solution is transferred to 7.05 with 2M NaOH solutions.Adjust every bottle of HBS PH consumption 2M NaOH be 3ml or so；

(6) the HEK293T/17 cells frozen are taken out from liquid nitrogen container, are quickly transferred in 37 DEG C of water-baths, after 1~2min It is transferred in super-clean bench, the liquid in cryopreservation tube is fully transferred to 10cm by sterile working²In culture dish, supply containing 10%FBS DMEM to 8mL/10cm²Micro- sem observation cell after dish, 24h, the degree of cell confluency is passed on more than 80%；

(7) cell state is good, free of contamination HEK293T/17 cells for selection, is one group per 2-6 culture dish, by cell After pancreatin digestion, 4-12ml complete mediums are drawn with electric pipettor, 2ml is added into each postdigestive culture dish, it is to avoid Culture dish is dried；All cells are blown and beaten into single cell suspension using 1ml pipettors, are transferred in medium bottle；

(8) remaining cell in above-mentioned 2-6 culture dish is transferred in medium bottle, and rinsed again with culture medium once Culture dish；

(9) culture medium bottle cap is covered tightly, turns upside down 10 times or so and fully mixes cell suspension, cell is passed to 8-24 10cm²In culture dish, the cell density per ware should about 4 × 10⁶Individual/10ml complete mediums or so.If cell density and Expected difference is larger, then needs to count cell, then according to 4 × 10⁶The amount inoculation of individual/ware；

(10) every 6 culture dishes arrange piles up for one, notes the cooperation between ware above and below keeping.It is front and rear by culture dish or so Rock for several times, cell is fully spread out, be then placed in 5%CO₂Incubator.Remaining cell does same processing；

(11) institute's passage cell is checked, cell confluency degree should be 70-80%, and profile is full, it is adherent good, in cell training Support and be uniformly distributed in ware；

(12) liquid is changed for cell, culture medium is replaced with into fresh complete medium, per ware 9ml, and by the CO of incubator₂It is dense Degree setting value brings up to 8%；

(13) DNA/CaCl is matched somebody with somebody according to N+0.5₂Solution.Per ware HEK293T/17 cell transfecting plasmid amounts according to following ratio Use：Recombinant slow virus plasmid (20 μ g), pPac-GP (15 μ g), pPac-R (10 μ g), pEnv-G (7.5 μ g).Take one newly 5ml centrifuge tubes, add 0.5M CaCl2：0.25ml, the μ g of recombinant slow virus plasmid 20：pPac-GP 15μg：pPac-R 10μ g：The μ g of pEnv-G 7.5, supplement ultra-pure water to 0.5ml closes the lid, and fully mixes；

(14) it is another to take a 5ml centrifuge tube, add 0.5ml DNA/CaCl2 solution.Turbula shaker is opened, a hand is taken The firmly upper end of 5ml centrifuge tubes, makes ttom of pipe contact oscillating end, liquid is scattered on tube wall flowing, another hand is by one 1mL Liquid-transfering gun, draws 0.5mL 2 × HBS solution, is slowly added dropwise and enters centrifuge tube, coutroi velocity is dripped off with half a minute and is advisable.2× After HBS is added, continue to vibrate 5 seconds, stop oscillation, can be directly added into the cell for needing to transfect；

(15) take a ware cell, the 1mL calcium in centrifuge tube is turned into drop adds, make as far as possible calcium turn reagent be distributed to it is whole In individual culture dish；

(16) calcium turns after liquid addition, is covered in ware and carries out mark, culture dish is released to another 5%CO₂In incubator. Ensure culture dish horizontal positioned, often pile up culture dish and do not exceed 6.In 5%CO₂(6-8h) is placed in incubator；

(17) by the CO of first incubator₂Concentration set point adjusts back to 5%；

After (18) 24 hours, cell state is checked.Cell confluency degree should be 80-85% or so, in good condition.Will culture Base is siphoned away, and changes the fresh DMEM complete mediums of 10ml；

After (19) 48 hours, transfection efficiency is observed.Most cells are still adherent.It can be seen that thin more than 95% Born of the same parents can carry green fluorescence.Same virus is packed into supernatant collection to together, and continues into culture dish addition 10mL Fresh culture；

After (20) 72 hours, same vial supernatant is collected into the virus together, collected twice again to be placed on Together, culture dish is abandoned；Contained in the supernatant now collected recombined lentivirus vector lvOCTS12319s, lvOCTS2219s、lvOCTS2019s、lvOCTS3019s、 lvOCTS12319t、lvOCTS2219t、lvOCTS2019t、 lvOCTS3019t。

3rd, ion exchange chromatography recombined lentivirus vector；

(1) supernatant of collection is used into Thermo vavuum pumps, through 0.22 μm -0.8 μm of PES filter suction filtrations, except impurity elimination Matter；

(2) 1 is pressed:1~1:10 ratio is toward adding 1.5M NaCl 250mM Tris-HCl (pH 6-8) in supernatant；

(3) 2 ion exchange columns are placed in series, with 4ml 1M NaOH, 4ml 1M NaCl, 5ml 0.15M NaCl 25mM Tris-HCl (pH 6-8) solution crosses post successively；

(4) ion exchange column loading is given by peristaltic pump with 1-10ml/min speed by the solution obtained in step 2；

(5) whole supernatants are crossed after post, are cleaned using 10ml 0.15M NaCl 25mM Tris-HCl (pH 6-8) solution One time；

(6) eluted according to applied sample amount using 1-5ml 1.5M NaCl 25mM Tris-HCl (pH 6-8), collection is washed De- liquid；

(7) eluent is divided into the pipes of 25 to 50 μ l mono-, freezes -80 DEG C of refrigerators, preserved for a long time；

4th, recombined lentivirus vector titer determination；

(1) 24 orifice plates are taken to be inoculated with 293T cells.It is 5 × 10 per hole cell⁴Individual, added culture volume is 500ul, different The vitro growth rates of species difference, cell confluency when carrying out virus infection is 40%-60%；

(2) prepare 3 sterile EP pipes, 90ul fresh complete medium (DMEM in high glucose+10% is added in each pipe FBS) inoculating cell takes the cell in two holes to be counted with blood counting chamber after 24 hours, it is determined that infection when cell actual number Mesh, is designated as N；

(3) take virus stock solution used 10ul to be determined to be added in first pipe, after gently mixing, take 10ul to be added to second In individual pipe, a to the last pipe is then operated successively；410ul complete medium (DMEM in high glucose+10% is added in every pipe ), FBS final volume is 500ul；

(4) 20 hours after infection starts, culture supernatant is removed, 500 μ l complete medium (DMEM in high glucose+10% are replaced by FBS), 5%CO₂Continue to cultivate 48 hours；

After (5) 72 hours, luciferase expression situation is observed, under normal circumstances, fluorecyte number increases and phase with extension rate It should reduce, and take pictures；

(6) the pancreas enzyme -EDTA solution digestion cells of 0.2ml 0.25% are used, are placed 1 minute at 37 DEG C.Purged with culture medium whole Individual cell face, is collected by centrifugation cell.Genomic DNA is extracted according to the explanation of DNeasy kits.Added in each sample cell 200 μ l eluents wash lower DNA and quantitative；

(7) preparing target DNA detection house steward qPCRmix I, (QPCR primer sequences are SEQ ID NO.42---SEQ ID NO.43)：

N=number of reactions. are for example：Overall reaction number is 40, by 2 × TaqMan of 1ml Universal PCR Master Mix, 4 μ l forward primer, 4 μ l reverse primer, 4 μ l probe and 788 μ l H2O are mixed With.It is placed on ice after concussion；

(8) preparing internal reference DNA detection qPCRmix pipes II, (QPCR primer sequences are SEQ ID NO.44---SEQ ID NO.45)：

2×TaqMan Master Mix 25μl×n

10×RNaseP primer/probe mix 2.5μl×n

H₂O 17.5μl×n

N=number of reactions. are for example：Overall reaction number is 40, by 2 × TaqMan of 1ml Universal PCR Master Mix, 100 μ l 10 × RNaseP primer/probe mix and 700 μ l H₂O is mixed.Ice is placed on after concussion On；

(9) PCR system is completed in 96 hole PCR plates of precooling to set up.45 μ l are respectively taken to be added to each rows of A-D from house steward I Hole in, respectively take 45 μ l to be added in the hole of each rows of E-G from house steward II.

(10) 5 μ l plasmid standards and testing sample genomic DNA is taken to be added in A-D rows respectively, each sample repeats 1 It is secondary.It is another to stay the water that 1 hole adds 5 μ l as no template control (no-template control).

(11) 5 μ l genomes standard items and testing sample genomic DNA is taken to be added in E-G rows respectively, each sample weight It is multiple 1 time.It is another to stay the water that 1 hole adds 5 μ l as no template control (no-template control).

(12) it is the quantitative systems of ABI PRISM 7500 to use quantitative PCR apparatus.Cycling condition is set as：50 DEG C 2 minutes, 95 DEG C 10 minutes, followed by 95 DEG C 15 seconds, 60 DEG C of 40 of 1 minute circulations.

Data analysis：The slow virus carrier copy number integrated in the DNA sample measured is demarcated with genome number, is obtained Viral copy number per genome conformity.

Titre (integration units per ml, IU ml^-1) calculation formula it is as follows：

IU ml^-1=(C × N × D × 1000)/V

Wherein：Viral copy numbers of the C=averagely per genome conformity

The number (about 1 × 10 of cell when N=infects⁵)

The extension rate of D=viral vectors

The volume number for the dilution virus that V=is added

(13) recombined lentivirus vector lvOCTS12319s, lvOCTS2219s, lvOCTS2019s, lvOCTS3019s, LvOCTS12319t, lvOCTS2219t, lvOCTS2019t, lvOCTS3019t titre results (as shown in Figure 6)；

2nd, OCTS-CAR-T cell constructions

Referring to Fig. 7, the construction method of OCTS-CAR-T cells of the present invention is as follows：

1st, PBMC is separated.

(1) health donors fresh peripheral blood 50ml is extracted；

(2) blood taking bag spray is wiped into alcohol twice, and dried.

(3) haemocyte in bag is sucked out with 50ml syringes and moved in new 50ml pipes.

(4) 400g, 20 DEG C of centrifugation 10min.

(5) upper plasma is moved on in new 50ml centrifuge tubes, 56 DEG C, 30min inactivation blood plasma recovers to room temperature, 2000g, centrifuges 30min, takes supernatant stand-by into 50ml centrifuge tubes.

(6) mended with D-PBS (-) to 50ml, tighten lid, overturned and mix.

(7) 2 new 50ml centrifuge tubes are taken, often pipe adds 15ml Ficoll lymphocyte separation mediums.

(8) it is carefully added into haemocyte dilution 25ml on every pipe Ficoll.800g, 20 DEG C of centrifugation 20min.

(9) liquid is divided into four layers in centrifuge tube, is respectively from top to bottom：The plasma layer (reclaim stand-by) of yellow, tunica albuginea layer, The Ficoll layers of water white transparency, the cell mixing layer of reddish black.

(10) careful tunica albuginea layer of drawing adds D-PBS (-) to 50ml, overturns 500g after mixing into new 50ml centrifuge tubes, 20 DEG C of centrifugation 10min.

(11) human serum albumins of 25ml 5% are added and cell is resuspended, 400g, 20 DEG C of centrifugation 10min.

(12) supernatant is abandoned, the human serum albumins of 25ml 5% is added and cell precipitation is resuspended, and crosses 70um screen clothes, is counted.

(13) 1 part is taken to contain 1.25x10⁸Cells is used to activate；Remaining cell suspension 400g, 20 DEG C of centrifugation 10min, plus CryoPremium simultaneously freezes.

2nd, CD4/CD8 positive T cells are sorted.

(1) PBMC of acquisition is counted, with 80ul/10⁷Cells ratio adds sorting buffer solution, and cell precipitation is resuspended.

(2) again with 20ul/10⁷Cells ratio adds CD4/CD8 magnetic beads, and piping and druming is put into 4 DEG C after mixing and is incubated 15min。

(3) magnetic bead-cell mixture is taken out, with 2ml/10⁷Cells ratio adds sorting buffer solution, overturns after mixing, 250g, 4 DEG C of centrifugation 10min.

(4) with 500ul/10⁸Cells ratio adds sorting buffer solution, and cell precipitation is resuspended.

(5) LS splitters are gripped to magnetic frame with tweezers.

(6) while preparing 2 15ml centrifuge tubes, mark respectively：CD4-/CD8- cell liquid (A pipes), CD4+/CD8+ cells Liquid (B pipes).

(7) 3ml dissociating buffer rinse LS are used, and buffer solution is connect with A pipes.

(8) cell-magnetic bead mixed liquor is added, 3ml wash buffers pillar is added after dripping off (during each no liquid residual again Add new liquid), three times altogether, collection obtains CD4/CD8- cells.

(9) LS splitters are separated with magnetic frame, and cell suspension is connect with B pipes, add 5ml buffer solutions, will and be filled in in pillar Slightly firmly rinse, be collected as CD4+/CD8+ cells, sampling is counted.

(10) 1x10 is pressed⁶/ml-4x10⁶/ ml cell density AIM-V culture mediums resuspension cell precipitation, and addition 2 × 10⁵~1 × 10⁶The U/L IFN-γ factors.

3rd, t cell activation.

(1) the previous day is carried by 1 × 10³Ug/L~1 × 10⁴Ug/L CD3 monoclonal antibodies and 1 × 10³Ug/L~1 × 10⁴Ug/L CD28 monoclonal antibodies add 24 orifice plates, and sealed membrane sealing is stayed overnight for 4 DEG C and is coated with.

(2) coated T75 bottles is taken out, coating buffer is outwelled, washed once with D-PBS (-), and the cell that sorting is obtained hangs Liquid is inoculated into T75 bottles, is shaken up, and is put into 37 DEG C, 5%CO₂Cultivated in incubator.

4th, CAR gene transfers and OCTS-CAR-T cell induction cultures.

(1) the previous day coating 1 × 10 is put forward³Ug/L~1 × 10⁴Ug/L RetroNectin are in 24 orifice plates, and sealed membrane is sealed Mouthful, 4 DEG C are coated with overnight.

(2) toward in 24 orifice plates, according to every hole 5 × 10⁵Cell concentration, by the amount of MOI=5~20, is separately added into lvOCTS12319s、lvOCTS2219s、 lvOCTS2019s、lvOCTS3019s、lvOCTS12319t、lvOCTS2219t、 LvOCTS2019t, lvOCTS3019t slow virus transgene carrier, while addition contains 2 × 10⁵~5 × 10⁵U/L rIL-2,5 × 10³Ng/L~1 × 10⁴Ng/L rIL-7,5 × 10³Ng/L~1 × 10⁴Ng/L rIL-15,5 × 10³Ng/L~1 × 10⁴ng/L RIL-21 and 37 DEG C of AIM-V culture mediums, 5%CO containing 10% autoserum₂Continue to cultivate.

5th, OCTS-CAR-T cell expansion ex vivos.

(1) every 2 days equivalent is added containing 2 × 10⁵~5 × 10⁵U/LrIL-2,5 × 10³Ng/L~1 × 10⁴Ng/LrIL-7,5 ×10³Ng/L~1 × 10⁴Ng/L rIL-15,5 × 10³Ng/L~1 × 10⁴Ng/L rIL-21 and containing 10% autoserum AIM-V culture mediums, make pH value maintain between 6.5~7.5, and cell density maintains 5 × 10⁵~2 × 10⁶Between/ml, 37 DEG C, 5%CO₂Continue to cultivate 10-14 days.

(2) the 7th days or so, freezing the OCTS-CAR-T cells of culture was used for subsequent detection.

Embodiment 2

OCTS-CAR-T cells Pathogen test and detection of expression.

First, endotoxin is detected；

(1), endotoxin working standard is 15EU/ branch；

(2), sensitivity of the limulus reagent λ=0.25EU/ml, 0.5ml/ are managed

(3), endotoxin standard dilutes：Endotoxin standard one is taken, 4 λ and 2 λ are diluted in proportion with BET water respectively Dissolving, sealed membrane sealing, concussion dissolving 15min；A step is often diluted during dilution all should mix 30s on eddy mixer；

(4), it is loaded：If taking the TAL Heavenly Stems and Earthly Branches, every adds BET water 0.5ml dissolvings, and as Heavenly Stems and Earthly Branches endotoxin-free is tried for packing Guan Zhong, often pipe 0.1ml.Wherein 2 are negative control pipe, add BET water 0.1ml；

2 are positive control pipe, add the endotoxin working standard solution 0.1ml of 2 λ concentration；

2 are Sample Positive control tube, and adding sample solutions of the 0.1ml containing 2 λ endotoxin standards, (20 times of dilution is treated Test sample product 1ml+4 λ endotoxin standard solution 1ml=2ml contains 40 times of samples of dilution of 2 λ endotoxin standards).

Add 0.1ml samples in sample cell, dilution ratio be shown in Table 4,37 ± 1 DEG C of water-baths (or incubator) insulation 60 ± 1min；

The endotoxin dilution ratio of table 4 and correspondence endotoxin content

(5), the endotoxin testing result (as shown in table 5) of OCTS-CAR-T cells, the endotoxin content of all cells is equal Less than 2.5EU/ml, meet《Pharmacopoeia of People's Republic of China》In be less than 10EU/ml standard；

Table 5

2nd, detection of mycoplasma；

(1) first three day is being tested, cell sample is cultivated with antibiotic-free culture medium；

(2) (cell number is more than 1*10 to collection 1ml cell suspending liquids⁵), it is placed in 1.5ml centrifuge tubes；

(3) 13000g centrifuges 1min, collects precipitation, discards culture medium；

(4) 500ul PBS pipette tips pressure-vaccum or vortex oscillation are added, precipitation is resuspended.13000g centrifuges 5min；

(5) step 4 is repeated once；

(6) 50 μ l Cell Lysis Buffer are added, pipette tips pressure-vaccum is used, after fully mixing, are incubated in 55 DEG C of water-baths 20min；

(7) sample is placed in 95 DEG C and heats 5min；

(8) 13000g is centrifuged after 5min, takes 5 μ l supernatants as template, 25 μ l PCR reaction systems are：ddH20 6.5μl、 The μ l of Myco Mix 1,2x Taq Plus Mix Master (Dye Plus) 12.5 μ l, the μ l of template 5；PCR cycle condition is：95 DEG C 30sec, (95 DEG C of 30sec, 56 DEG C of 30sec, 72 DEG C of 30sec) * 30cycle, 72 DEG C of 5min.

(9) detection of mycoplasma result is shown (as shown in Figure 8), and mycoplasma is free of in OCTS-CAR-T cells.

3rd, the detection of OCTS gene transduction efficiencies and immunophenotyping detection；

(1) T cell after viral transduction is collected, cell is resuspended with D-PBS (-) solution containing 1~4% human serum albumin And it is adjusted to 1 × 10⁶/ml。

(2) D-PBS (-) solution 1ml containing 1~4% human serum albumin is added into centrifuge tube and is mixed, 350g centrifugations 5min, abandons supernatant.

(3) repeat step 2 is once.

(4) cell is resuspended with 0.2ml D-PBS (-) solution containing 1~4% human serum albumin, and is added into centrifuge tube 1ul 1mg/ul protein L, 5ul CD4-FITC, 5ul CD8-APC, are mixed, 4 DEG C of incubation 45min.

(5) D-PBS (-) solution of the 1ml containing 1~4% human serum albumin is added into centrifuge tube and is mixed, 350g centrifugations 5min, abandons supernatant.

(6) repeat step 5 is twice.

(7) cell is resuspended with D-PBS (-) solution of 0.2ml containing 1~4% human serum albumin, and is added into centrifuge tube 0.2ul PE-SA, are mixed, and 37 DEG C of lucifuges are incubated 15min.

(8) add D-PBS (-) solution of 1ml containing 1~4% human serum albumin into centrifuge tube to weigh and mix, 350g centrifugations 5min, abandons supernatant.

(9) cell precipitation is resuspended with 1ml D-PBS (-) solution, 350g centrifugation 5min abandon supernatant.

(10) repeat step 9 is twice.

(11) cell precipitation is resuspended with 0.4ml D-PBS (-) solution, flow cytometer is detected.

(12) OCTS gene transduction efficiencies and the testing result of immunophenotyping detection are as shown in figure 9, the OCTS-CAR- prepared Most of efficiency of infection of T cell is located between 30%~40%, and the ratio of CD4 positive cells and CD8 positive cells is located at 1: Between 3~3: 1, follow-up function detection can be carried out.

The Function detection of the OCTS-CAR-T cells of embodiment 3.

First, target cell fragmentation effect is assessed.

(1) target cell [CD19 is cultivated respectively⁺K562、CD20⁺K562、CD22⁺K562、CD30⁺K562、CD123⁺K562、 CD19⁺CD123⁺K562、CD19⁺CD20⁺K562、CD19⁺CD22⁺K562、CD19⁺CD30⁺K562, K562 cell] and effector cell [OCTS-CAR-T cells]；

(2) target cell 4x10 is collected⁵Cells and OCTS-CAR-T cells 2.8x10⁶Cells, 800g, 6min are centrifuged, and are abandoned Clearly；

(3) target cell and effector cell is resuspended respectively with 1ml D-PBS (-) solution, supernatant is abandoned in 800g, 6min centrifugations；

(4) repeat step 3 is once；

(5) effector cell is resuspended with 700ul culture mediums (+1~10%FBS of AIM-V culture mediums), with 2ml culture mediums (AIM- The FBS of V culture mediums+1~10%) target cell is resuspended；

(6) experimental port that effect target ratio is 1: 1,5: 1,10: 1 is set, effector cell respectively with single target cell and pair target cell The packet situation being incubated altogether as shown in table 6, and sets control group (K562 cells), every group of 3 multiple holes；

Table 6

Effector cell	Target cell 1	Target cell 2	Target cell 3
				OCTS12319s-CAR-T	CD123+K562	CD19+K562	CD19+CD123+K562
OCTS2219s-CAR-T	CD22+K562	CD19+K562	CD19+CD22+K562
				OCTS2019s-CAR-T	CD20+K562	CD19+K562	CD19+CD20+K562
OCTS3019s-CAR-T	CD30+K562	CD19+K562	CD19+CD30+K562
				OCTS12319t-CAR-T	CD123+K562	CD19+K562	CD19+CD123+K562
OCTS2219t-CAR-T	CD22+K562	CD19+K562	CD19+CD22+K562
				OCTS2019t-CAR-T	CD20+K562	CD19+K562	CD19+CD20+K562
OCTS3019t-CAR-T	CD30+K562	CD19+K562	CD19+CD30+K562

(7) 250g, 5min flat board are centrifuged；

(8) 37 DEG C, cultivated 4 hours in 5%CO2 incubators；

(9) 250g, 5min flat board are centrifuged；

(10) the 50ul supernatants in each hole are taken into new 96 orifice plate, and addition 50ul substrate solutions (the lucifuge behaviour per hole Make)；

(11) lucifuge is incubated 25min；

(12) 50ul terminate liquids are added per hole；

(13) ELIASA detection 490nm absorbances；

(14) 3 multiple holes are averaged；The light absorption value of all experimental ports, Target cell wells and effector cell hole is subtracted into training Support the average of base background light absorption value；The light absorption value of target cell maximum is subtracted into the average that volume correction compares light absorption value.

(15) bring the corrected value obtained in step 14 into formula below, calculate each effect target thinner than produced Cellular toxicity percentage.As a result as shown in Figure 10, OCTS-CAR-T has to respective single target cell and double target cells and preferably killed Hinder effect, the CAR-T cells of Turn OCTS structures are slightly above the CAR- of Series OCTS structures to the killing-efficiency of target cell T cell；

Killing-efficiency=(experimental port-effector cell hole-Target cell wells)/(target cell largest hole-Target cell wells) X100%

(16) it is above-mentioned test result indicates that, pass through in traditional CAR structures antigen recognizing district transformation formed OCTS tie Structure, can significantly improve OCTS-CAR-T cell recognitions and kill the scope of target cell, therefore OCTS-CAR-T cells will be not The double positives of the CD19 positives/CD22 positives/CD20 positives/CD123 positives/CD30 positives/CD19, CD22 come/CD19, CD20 The malignant tumours such as the double positives of double positives/CD19, CD123/CD19, CD30 double positive bone-marrow-derived lymphocyte leukaemia, B lymthomas Huge effect is played in cell therapy.

Sequence table

<110>Shanghai You Kadi biological medicines Science and Technology Ltd.

<120>A kind of pouring based on OCTS technologies is leukaemia CAR-T therapy vectors and its construction method and application

<130> HJ17-13348

<160> 45

<170> PatentIn version 3.5

<210> 1

<211> 861

<212> DNA

<213>Artificial sequence

<400> 1

atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct 60

gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca 120

cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc 180

gaagaacgtt ttccaatgat gagcactttt aaagttctgc tatgtggcgc ggtattatcc 240

cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg 300

gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta 360

tgcagtgctg ccataaccat gagtgataac actgcggcca acttacttct gacaacgatc 420

ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt 480

gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg 540

cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct 600

tcccggcaac aattaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc 660

tcggcccttc cggctggctg gtttattgct gataaatctg gagccggtga gcgtgggtct 720

cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac 780

acgacgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc 840

tcactgatta agcattggta a 861

<210> 2

<211> 674

<212> DNA

<213>Artificial sequence

<400> 2

cccgtagaaa agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc 60

ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca 120

actctttttc cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgtccttcta 180

gtgtagccgt agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct 240

ctgctaatcc tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg 300

gactcaagac gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc 360

acacagccca gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta 420

tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg 480

gtcggaacag gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt 540

cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg 600

cggagcctat ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg 660

ccttttgctc acat 674

<210> 3

<211> 147

<212> DNA

<213>Artificial sequence

<400> 3

atcccgcccc taactccgcc cagttccgcc cattctccgc cccatggctg actaattttt 60

tttatttatg cagaggccga ggccgcctcg gcctctgagc tattccagaa gtagtgagga 120

ggcttttttg gaggcctaga cttttgc 147

<210> 4

<211> 228

<212> DNA

<213>Artificial sequence

<400> 4

gtagtcttat gcaatactct tgtagtcttg caacatggta acgatgagtt agcaacatgc 60

cttacaagga gagaaaaagc accgtgcatg ccgattggtg gaagtaaggt ggtacgatcg 120

tgccttatta ggaaggcaac agacgggtct gacatggatt ggacgaacca ctgaattgcc 180

gcattgcaga gatattgtat ttaagtgcct agctcgatac aataaacg 228

<210> 5

<211> 180

<212> DNA

<213>Artificial sequence

<400> 5

ggtctctctg gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac 60

tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt 120

gtgactctgg taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca 180

<210> 6

<211> 234

<212> DNA

<213>Artificial sequence

<400> 6

tgctagagat tttccacact gactaaaagg gtctgaggga tctctagtta ccagagtcac 60

acaacagacg ggcacacact acttgaagca ctcaaggcaa gctttattga ggcttaagca 120

gtgggttccc tagttagcca gagagctccc aggctcagat ctggtctaac cagagagacc 180

cagtacaagc aaaaagcaga tcttattttc gttgggagtg aattagccct tcca 234

<210> 7

<211> 353

<212> DNA

<213>Artificial sequence

<400> 7

atgggtgcga gagcgtcagt attaagcggg ggagaattag atcgcgatgg gaaaaaattc 60

ggttaaggcc agggggaaag aaaaaatata aattaaaaca tatagtatgg gcaagcaggg 120

agctagaacg attcgcagtt aatcctggcc tgttagaaac atcagaaggc tgtagacaaa 180

tactgggaca gctacaacca tcccttcaga caggatcaga agaacttaga tcattatata 240

atacagtagc aaccctctat tgtgtgcatc aaaggataga gataaaagac accaaggaag 300

ctttagacaa gatagaggaa gagcaaaaca aaagtaagac caccgcacag caa 353

<210> 8

<211> 233

<212> DNA

<213>Artificial sequence

<400> 8

aggagctttg ttccttgggt tcttgggagc agcaggaagc actatgggcg cagcctcaat 60

gacgctgacg gtacaggcca gacaattatt gtctggtata gtgcagcagc agaacaattt 120

gctgagggct attgaggcgc aacagcatct gttgcaactc acagtctggg gcatcaagca 180

gctccaggca agaatcctgg ctgtggaaag atacctaaag gatcaacagc tcc 233

<210> 9

<211> 489

<212> DNA

<213>Artificial sequence

<400> 9

tggggatttg gggttgctct ggaaaactca tttgcaccac tgctgtgcct tggaatgcta 60

gttggagtaa taaatctctg gaacagattg gaatcacacg acctggatgg agtgggacag 120

agaaattaac aattacacaa gcttaataca ctccttaatt gaagaatcgc aaaaccagca 180

agaaaagaat gaacaagaat tattggaatt agataaatgg gcaagtttgt ggaattggtt 240

taacataaca aattggctgt ggtatataaa attattcata atgatagtag gaggcttggt 300

aggtttaaga atagtttttg ctgtactttc tatagtgaat agagttaggc agggatattc 360

accattatcg tttcagaccc acctcccaac cccgagggga cccgacaggc ccgaaggaat 420

agaagaagaa ggtggagaga gagacagaga cagatccatt cgattagtga acggatctcg 480

acggttaac 489

<210> 10

<211> 119

<212> DNA

<213>Artificial sequence

<400> 10

ttttaaaaga aaagggggga ttggggggta cagtgcaggg gaaagaatag tagacataat 60

agcaacagac atacaaacta aagaattaca aaaacaaatt acaaaaattc aaaatttta 119

<210> 11

<211> 696

<212> DNA

<213>Artificial sequence

<400> 11

atggcccagt ccaagcacgg cctgaccaag gagatgacca tgaagtaccg catggagggc 60

tgcgtggacg gccacaagtt cgtgatcacc ggcgagggca tcggctaccc cttcaagggc 120

aagcaggcca tcaacctgtg cgtggtggag ggcggcccct tgcccttcgc cgaggacatc 180

ttgtccgccg ccttcatgta cggcaaccgc gtgttcaccg agtaccccca ggacatcgtc 240

gactacttca agaactcctg ccccgccggc tacacctggg accgctcctt cctgttcgag 300

gacggcgccg tgtgcatctg caacgccgac atcaccgtga gcgtggagga gaactgcatg 360

taccacgagt ccaagttcta cggcgtgaac ttccccgccg acggccccgt gatgaagaag 420

atgaccgaca actgggagcc ctcctgcgag aagatcatcc ccgtgcccaa gcagggcatc 480

ttgaagggcg acgtgagcat gtacctgctg ctgaaggacg gtggccgctt gcgctgccag 540

ttcgacaccg tgtacaaggc caagtccgtg ccccgcaaga tgcccgactg gcacttcatc 600

cagcacaagc tgacccgcga ggaccgcagc gacgccaaga accagaagtg gcacctgacc 660

gagcacgcca tcgcctccgg ctccgccttg ccctga 696

<210> 12

<211> 575

<212> DNA

<213>Artificial sequence

<400> 12

gcccctctcc ctcccccccc cctaacgtta ctggccgaag ccgcttggaa taaggccggt 60

gtgcgtttgt ctatatgtta ttttccacca tattgccgtc ttttggcaat gtgagggccc 120

ggaaacctgg ccctgtcttc ttgacgagca ttcctagggg tctttcccct ctcgccaaag 180

gaatgcaagg tctgttgaat gtcgtgaagg aagcagttcc tctggaagct tcttgaagac 240

aaacaacgtc tgtagcgacc ctttgcaggc agcggaaccc cccacctggc gacaggtgcc 300

tctgcggcca aaagccacgt gtataagata cacctgcaaa ggcggcacaa ccccagtgcc 360

acgttgtgag ttggatagtt gtggaaagag tcaaatggct cacctcaagc gtattcaaca 420

aggggctgaa ggatgcccag aaggtacccc attgtatggg atctgatctg gggcctcggt 480

gcacatgctt tacatgtgtt tagtcgaggt taaaaaacgt ctaggccccc cgaaccacgg 540

ggacgtggtt ttcctttgaa aaacacgatg ataat 575

<210> 13

<211> 592

<212> DNA

<213>Artificial sequence

<400> 13

aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct 60

ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt 120

atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg 180

tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc aacccccact 240

ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct 300

attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg ggctcggctg 360

ttgggcactg acaattccgt ggtgttgtcg gggaaatcat cgtcctttcc ttggctgctc 420

gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc 480

aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt 540

cgccttcgcc ctcagacgag tcggatctcc ctttgggccg cctccccgcc tg 592

<210> 14

<211> 1178

<212> DNA

<213>Artificial sequence

<400> 14

gctccggtgc ccgtcagtgg gcagagcgca catcgcccac agtccccgag aagttggggg 60

gaggggtcgg caattgaacc ggtgcctaga gaaggtggcg cggggtaaac tgggaaagtg 120

atgtcgtgta ctggctccgc ctttttcccg agggtggggg agaaccgtat ataagtgcag 180

tagtcgccgt gaacgttctt tttcgcaacg ggtttgccgc cagaacacag gtaagtgccg 240

tgtgtggttc ccgcgggcct ggcctcttta cgggttatgg cccttgcgtg ccttgaatta 300

cttccacctg gctgcagtac gtgattcttg atcccgagct tcgggttgga agtgggtggg 360

agagttcgag gccttgcgct taaggagccc cttcgcctcg tgcttgagtt gaggcctggc 420

ctgggcgctg gggccgccgc gtgcgaatct ggtggcacct tcgcgcctgt ctcgctgctt 480

tcgataagtc tctagccatt taaaattttt gatgacctgc tgcgacgctt tttttctggc 540

aagatagtct tgtaaatgcg ggccaagatc tgcacactgg tatttcggtt tttggggccg 600

cgggcggcga cggggcccgt gcgtcccagc gcacatgttc ggcgaggcgg ggcctgcgag 660

cgcggccacc gagaatcgga cgggggtagt ctcaagctgg ccggcctgct ctggtgcctg 720

gcctcgcgcc gccgtgtatc gccccgccct gggcggcaag gctggcccgg tcggcaccag 780

ttgcgtgagc ggaaagatgg ccgcttcccg gccctgctgc agggagctca aaatggagga 840

cgcggcgctc gggagagcgg gcgggtgagt cacccacaca aaggaaaagg gcctttccgt 900

cctcagccgt cgcttcatgt gactccactg agtaccgggc gccgtccagg cacctcgatt 960

agttctcgag cttttggagt acgtcgtctt taggttgggg ggaggggttt tatgcgatgg 1020

agtttcccca cactgagtgg gtggagactg aagttaggcc agcttggcac ttgatgtaat 1080

tctccttgga atttgccctt tttgagtttg gatcttggtt cattctcaag cctcagacag 1140

tggttcaaag tttttttctt ccatttcagg tgtcgtga 1178

<210> 15

<211> 63

<212> DNA

<213>Artificial sequence

<400> 15

atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60

ccg 63

<210> 16

<211> 333

<212> DNA

<213>Artificial sequence

<400> 16

gacattgtgc tgacccaatc tccagcttct ttggctgtgt ctctagggca gagggccacc 60

atctcctgca aggccagcca aagtgttgat tatgatggtg atagttattt gaactggtac 120

caacagattc caggacagcc acccaaactc ctcatctatg atgcatccaa tctagtttct 180

gggatcccac ccaggtttag tggcagtggg tctgggacag acttcaccct caacatccat 240

cctgtggaga aggtggatgc tgcaacctat cactgccagc aaagtactga ggatccgtgg 300

acgttcggtg gaggcaccaa gctggaaatc aaa 333

<210> 17

<211> 375

<212> DNA

<213>Artificial sequence

<400> 17

caggttcagc tgcagcagtc tggggctgag ctggtgaggc ctgggtcctc agtgaagatt 60

tcctgcaagg cttctggcta tgcattcagt agctactgga tgaactgggt gaagcagagg 120

cctggacagg gtcttgagtg gattggacag atttggcctg gagatggtga tactaactac 180

aatggaaagt tcaagggtaa agccactctg actgcagacg aatcctccag cacagcctac 240

atgcaactca gcagcctagc atctgaggac tctgcggtct atttctgtgc aagacgggag 300

actacgacgg taggccgtta ttactatgct atggactact ggggtcaagg aacctcagtc 360

accgtctcct cgagt 375

<210> 18

<211> 318

<212> DNA

<213>Artificial sequence

<400> 18

gacattgtgc tgacccaatc tccagctatc ctgtctgcat ctccagggga gaaggtcaca 60

atgacttgca gggccagctc aagtgtaaat tacatggact ggtaccagaa gaagccagga 120

tcctccccca aaccctggat ttatgccaca tccaacctgg cttctggagt ccctgctcgc 180

ttcagtggca gtgggtctgg gacctcttac tctctcacaa tcagcagagt ggaggctgaa 240

gatgctgcca cttattactg ccagcagtgg agttttaatc cacccacgtt cggagggggg 300

accaagctgg aaataaaa 318

<210> 19

<211> 366

<212> DNA

<213>Artificial sequence

<400> 19

gaggtgcagc tgcagcagtc tggggctgag ctggtgaagc ctggggcctc agtgaagatg 60

tcctgcaagg cttctggcta cacatttacc agttacaata tgcactgggt aaagcagaca 120

cctggacagg gcctggaatg gattggagct atttatccag gaaatggtga tacttcctac 180

aatcagaagt tcaaaggcaa ggccacattg actgcagaca aatcctccag cacagcctac 240

atgcagctca gcagcctgac atctgaggac tctgcggact attactgtgc aagatctaat 300

tattacggta gtagctactg gttcttcgat gtctggggcg cagggaccac ggtcaccgtc 360

tcctca 366

<210> 20

<211> 321

<212> DNA

<213>Artificial sequence

<400> 20

gatattcaga tgacccagac caccagcagc ctgagcgcga gcctgggcga tcgcgtgacc 60

attagctgcc gcgcgagcca ggatattagc aactatctga actggtatca gcagaaaccg 120

gatggcaccg tgaaactgct gatttattat accagcattc tgcatagcgg cgtgccgagc 180

cgctttagcg gcagcggcag cggcaccgat tatagcctga ccattagcaa cctggaacag 240

gaagattttg cgacctattt ttgccagcag ggcaacaccc tgccgtggac ctttggcggc 300

ggcaccaaac tggaaattaa a 321

<210> 21

<211> 369

<212> DNA

<213>Artificial sequence

<400> 21

gaagtgcagc tggtggaaag cggcggcggc ctggtgaaac cgggcggcag cctgaaactg 60

agctgcgcgg cgagcggctt tgcgtttagc atttatgata tgagctgggt gcgccagacc 120

ccggaaaaac gcctggaatg ggtggcgtat attagcagcg gcggcggcac cacctattat 180

ccggataccg tgaaaggccg ctttaccatt agccgcgata acgcgaaaaa caccctgtat 240

ctgcagatga gcagcctgaa aagcgaagat accgcgatgt attattgcgc gcgccatagc 300

ggctatggca gcagctatgg cgtgctgttt gcgtattggg gccagggcac cctggtgacc 360

gtgagcgcg 369

<210> 22

<211> 321

<212> DNA

<213>Artificial sequence

<400> 22

gatattcaga tgacccagag cccgaccagc ctgagcgcga gcgtgggcga tcgcgtgacc 60

attacctgcc gcgcgagcca gggcattagc agctggctga cctggtatca gcagaaaccg 120

gaaaaagcgc cgaaaagcct gatttatgcg gcgagcagcc tgcagagcgg cgtgccgagc 180

cgctttagcg gcagcggcag cggcaccgat tttaccctga ccattagcag cctgcagccg 240

gaagattttg cgacctatta ttgccagcag tatgatagct atccgattac ctttggccag 300

ggcacccgcc tggaaattaa a 321

<210> 23

<211> 336

<212> DNA

<213>Artificial sequence

<400> 23

caggtgcagc tgcagcagtg gggcgcgggc ctgctgaaac cgagcgaaac cctgagcctg 60

acctgcgcgg tgtatggcgg cagctttagc gcgtattatt ggagctggat tcgccagccg 120

ccgggcaaag gcctggaatg gattggcgat attaaccatg gcggcggcac caactataac 180

ccgagcctga aaagccgcgt gaccattagc gtggatacca gcaaaaacca gtttagcctg 240

aaactgaaca gcgtgaccgc ggcggatacc gcggtgtatt attgcgcgag cctgaccgcg 300

tattggggcc agggcagcct ggtgaccgtg agcagc 336

<210> 24

<211> 324

<212> DNA

<213>Artificial sequence

<400> 24

gatattgtga tgacccagag cccgagcagc gtgagcgcga gcgtgggcga tcgcgtgacc 60

attacctgcc gcgcgagcca gaacgtggat agcgcggtgg cgtggtatca gcagaaaccg 120

ggcaaagcgc cgaaagcgct gatttatagc gcgagctatc gctatagcgg cgtgccgagc 180

cgctttagcg gccgcggcag cggcaccgat tttaccctga ccattagcag cctgcagccg 240

gaagattttg cgacctatta ttgccagcag tattatagca ccccgtggac ctttggccag 300

ggcaccaaag tggaaattaa acgc 324

<210> 25

<211> 381

<212> DNA

<213>Artificial sequence

<400> 25

gaagtgaaac tggtggaaag cggcggcggc ctggtgcagc cgggccgcag cctgcgcctg 60

agctgcaccg cgagcggctt tacctttacc gattattata tgagctgggt gcgccaggcg 120

ccgggcaaag gcctggaatg ggtgggcctg attcgcagca aagcggatgg ctataccacc 180

gaatatagcg cgagcgtgaa aggccgcttt accattagcc gcgatgatag caaaagcatt 240

ctgtatctgc agatgaacag cctgaaaacc gaagataccg cggtgtatta ttgcgcgcgc 300

gatgcggcgt attatagcta ttatagcccg gaaggcgcga tggattattg gggccagggc 360

accctggtga ccgtgagcag c 381

<210> 26

<211> 45

<212> DNA

<213>Artificial sequence

<400> 26

ggtggcggtg gctcgggcgg tggtgggtcg ggtggcggcg gatct 45

<210> 27

<211> 57

<212> DNA

<213>Artificial sequence

<400> 27

gcctccacca agggcccatc tgtcttcccc ctggccccca gctcctctgg ctccgga 57

<210> 28

<211> 141

<212> DNA

<213>Artificial sequence

<400> 28

accacgacgc cagcgccgcg accaccaaca ccggcgccca ccatcgcgtc gcagcccctg 60

tccctgcgcc cagaggcgtg ccggccagcg gcggggggcg cagtgcacac gagggggctg 120

gacttcgcct gtgatatcta c 141

<210> 29

<211> 66

<212> DNA

<213>Artificial sequence

<400> 29

atctgggcgc ccttggccgg gacttgtggg gtccttctcc tgtcactggt tatcaccctt 60

tactgc 66

<210> 30

<211> 123

<212> DNA

<213>Artificial sequence

<400> 30

aggagtaaga ggagcaggct cctgcacagt gactacatga acatgactcc ccgccgcccc 60

gggcccaccc gcaagcatta ccagccctat gccccaccac gcgacttcgc agcctatcgc 120

tcc 123

<210> 31

<211> 111

<212> DNA

<213>Artificial sequence

<400> 31

cgccgcgatc agcgcctgcc gccggatgcg cataaaccgc cgggcggcgg cagctttcgc 60

accccgattc aggaagaaca ggcggatgcg catagcaccc tggcgaaaat t 111

<210> 32

<211> 336

<212> DNA

<213>Artificial sequence

<400> 32

cgcgtgaaat ttagccgcag cgcggatgcg ccggcgtatc agcagggcca gaaccagctg 60

tataacgaac tgaacctggg ccgccgcgaa gaatatgatg tgctggataa acgccgcggc 120

cgcgatccgg aaatgggcgg caaaccgcgc cgcaaaaacc cgcaggaagg cctgtataac 180

gaactgcaga aagataaaat ggcggaagcg tatagcgaaa ttggcatgaa aggcgaacgc 240

cgccgcggca aaggccatga tggcctgtat cagggcctga gcaccgcgac caaagatacc 300

tatgatgcgc tgcatatgca ggcgctgccg ccgcgc 336

<210> 33

<211> 1506

<212> DNA

<213>Artificial sequence

<400> 33

atgaactcct tctccacaag cgccttcggt ccagttgcct tctccctggg gctgctcctg 60

gtgttgcctg ctgccttccc tgccccagac atccagatga cccagagccc aagcagcctg 120

agcgccagcg tgggtgacag agtgaccatc acctgtagag ccagccagga catcagcagt 180

tacctgaatt ggtaccagca gaagccagga aaggctccaa agctgctgat ctactacacc 240

tccagactgc actctggtgt gccaagcaga ttcagcggta gcggtagcgg taccgacttc 300

accttcacca tcagcagcct ccagccagag gacatcgcta cctactactg ccaacagggt 360

aacacgcttc catacacgtt cggccaaggg accaaggtgg aaatcaaagg tggcggtggc 420

tcgggcggtg gtgggtcggg tggcggcgga tctcaggtcc aactgcagga gagcggtcca 480

ggtcttgtga gacctagcca gaccctgagc ctgacctgca ccgtgtctgg ctactcaatt 540

accagcgatc atgcctggag ctgggttcgc cagccacctg gacgaggtct tgagtggatt 600

ggatacatta gttatagtgg aatcacaacc tataatccat ctctcaaatc cagagtgaca 660

atgctgagag acaccagcaa gaaccagttc agcctgagac tcagcagcgt gacagccgcc 720

gacaccgcgg tttattattg tgcaagatcc ctagctcgga ctacggctat ggactactgg 780

ggtcaaggca gcctcgtcac agtctcctca gaaccgaaaa gctgcgataa aacccatacc 840

tgcccgccgt gcccggcgcc ggaactgctg ggcggcccga gcgtgtttct gtttccgccg 900

aaaccgaaag ataccctgat gattagccgc accccggaag tgacctgcgt ggtggtggat 960

gtgagccatg aagatccgga agtgaaattt aactggtatg tggatggcgt ggaagtgcat 1020

aacgcgaaaa ccaaaccgcg cgaagaacag tataacagca cctatcgcgt ggtgagcgtg 1080

ctgaccgtgc tgcatcagga ttggctgaac ggcaaagaat ataaatgcaa agtgagcaac 1140

aaagcgctgc cggcgccgat tgaaaaaacc attagcaaag cgaaaggcca gccgcgcgaa 1200

ccgcaggtgt ataccctgcc gccgagccgc gaagaaatga ccaaaaacca ggtgagcctg 1260

acctgcctgg tgaaaggctt ttatccgagc gatattgcgg tggaatggga aagcaacggc 1320

cagccggaaa acaactataa aaccaccccg ccggtgctgg atagcgatgg cagctttttt 1380

ctgtatagca aactgaccgt ggataaaagc cgctggcagc agggcaacgt gtttagctgc 1440

agcgtgatgc atgaagcgct gcataaccat tatacccaga aaagcctgag cctgagcccg 1500

ggcaaa 1506

<210> 34

<211> 36

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 34

attcaaaatt ttatcgatgc tccggtgccc gtcagt 36

<210> 35

<211> 22

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 35

tcacgacacc tgaaatggaa ga 22

<210> 36

<211> 46

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 36

catttcaggt gtcgtgagga tccgccacca tggcgctgcc ggtgac 46

<210> 37

<211> 33

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 37

ggggagggag aggggcttag cgcggcggca gcg 33

<210> 38

<211> 17

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 38

gcccctctcc ctccccc 17

<210> 39

<211> 25

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 39

attatcatcg tgtttttcaa aggaa 25

<210> 40

<211> 44

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 40

aaaacacgat gataatgcca ccatgaactc cttctccaca agcg 44

<210> 41

<211> 46

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 41

aatccagagg ttgattgtcg acgaattctc atttgcccgg gctcag 46

<210> 42

<211> 21

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 42

cctttccggg actttcgctt t 21

<210> 43

<211> 20

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 43

gcagaatcca ggtggcaaca 20

<210> 44

<211> 21

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 44

catgtacgtt gctatccagg c 21

<210> 45

<211> 21

<212> DNA

<213>Artificial sequence

<220>

<221> misc_feature

<223>Primer

<400> 45

ctccttaatg tcacgcacga t 21

Claims (11)

1. a kind of pouring based on OCTS technologies is leukaemia CAR-T therapy vectors, it is characterised in that including slow virus skeleton matter Grain, people EF1 α promoters, OCTS Chimerical receptors domain and IL6R single-chain antibodies；

The slow virus skeleton plasmid includes：The sequences of AmpR containing ampicillin resistance gene largely expanded for purpose bacterial strain Row, as shown in SEQ ID NO.1；For the prokaryotic replions pUC Ori sequences of plasmid replication, as shown in SEQ ID NO.2；With In the Viral Replicon SV40Ori sequences of the duplication in enhancing eukaryotic, as shown in SEQ ID NO.3；For slow virus bag The slow virus packaging cis element of dress；ZsGreen1 green fluorescent proteins, as shown in SEQ ID NO.11；IRES ribosomes is combined Sequence, as shown in SEQ ID NO.12；The enhanced marmot hepatitis Bs of eWPRE of expression efficiency for strengthening transgenosis turn Controlling element after record, as shown in SEQ ID NO.13；

The sequence of the people EF1 α promoters is as shown in SEQ ID NO.14；

The OCTS Chimerical receptors domain includes：CD8leader Chimerical receptors signal peptide as shown in SEQ ID NO.15, two Group single-chain antibody：First group is selected from any one group of following four groups of single-chain antibodies：CD20 as shown in SEQ ID NO.18 is single-stranded Antibody light chain VL, the CD20 single-chain antibody heavy chains VH as shown in SEQ ID NO.19；CD22 as shown in SEQ ID NO.20 is mono- Chain antibody light chain VL, the CD22 single-chain antibody heavy chains VH as shown in SEQ ID NO.21；CD30 as shown in SEQ ID NO.22 Single-chain antibody light chain VL, the CD30 single-chain antibody heavy chains VH as shown in SEQ ID NO.23；As shown in SEQ ID NO.24 CD123 single-chain antibody light chains VL, the CD123 single-chain antibody heavy chains VH as shown in SEQ ID NO.25；Second group is such as SEQ ID CD19 single-chain antibody light chain VL shown in the NO.16 and CD19 single-chain antibody heavy chains VH as shown in SEQ ID NO.17；Such as SEQ Antibody inner hinge Inner-Linker shown in ID NO.26, hinge Inter- between the single-chain antibody as shown in SEQ ID NO.27 Linker, the CD8Hinge Chimerical receptors hinge as shown in SEQ ID NO.28, as shown in SEQ ID NO.29 CD8Transmembrane Chimerical receptors transmembrane region, the TCR Chimerical receptor t cell activation domains as shown in SEQ ID NO.32 and Chimerical receptor costimulating factor region；The Chimerical receptor costimulating factor region be selected from 4-1BB, ICOS, CD27, OX40, CD28, MYD88, IL1R1, CD70, TNFRSF19L, TNFRSF27, TNFRSF1OD, TNFRSF13B, TNFRSF18, CD134 etc. The combination of any one or more in tumor necrosis factor superfamily.

2. carrier as claimed in claim 1, it is characterised in that the slow virus packaging cis element uses second generation slow virus Carrier or third generation slow virus carrier；The second generation slow virus carrier includes：Slow virus as shown in SEQ ID NO.5 5terminal LTR, slow virus 3terminal Self-Inactivating LTR, such as SEQ as shown in SEQ ID NO.6 Gag cis elements shown in ID NO.7, the RRE cis elements as shown in SEQ ID NO.8, as shown in SEQ ID NO.9 Env cis elements, the cPPT cis elements as shown in SEQ ID NO.10；The third generation slow virus carrier includes：Such as SEQ Slow virus 5terminal LTR shown in ID NO.5, the slow virus 3terminal Self- as shown in SEQ ID NO.6 Inactivating LTR, the Gag cis elements as shown in SEQ ID NO.7, the cis members of RRE as shown in SEQ ID NO.8 Part, the env cis elements as shown in SEQ ID NO.9, the cPPT cis elements as shown in SEQ ID NO.10, and such as SEQ RSV promoters shown in ID NO.4.

3. carrier as claimed in claim 1, it is characterised in that two groups of single-chain antibodies are using the mode that is connected in series or turn Angle connected mode；

When two groups of single-chain antibodies are CD20 single-chain antibodies and CD19 single-chain antibodies, the mode that is connected in series is specially：CD20 Single-chain antibody light chain VL and CD19 single-chain antibody light chain VL uses hinge Inter-Linker connections between single-chain antibody, and CD20 is single-stranded Antibody light chain VL is connected with CD20 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker, CD19 single-chain antibody light chains VL is connected with CD19 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker；The corner connected mode is specially： CD19 single-chain antibody light chain VL are connected with CD19 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker, and CD20 is single-stranded Antibody light chain VL and CD19 single-chain antibody heavy chain VH uses hinge Inter-Linker connections, CD20 single-chain antibodies between single-chain antibody Heavy chain VH and CD19 single-chain antibody light chain VL uses hinge Inter-Linker connections between single-chain antibody；

When two groups of single-chain antibodies are CD30 single-chain antibodies and CD19 single-chain antibodies, the mode that is connected in series is specially：CD30 Single-chain antibody light chain VL and CD19 single-chain antibody light chain VL uses hinge Inter-Linker connections between single-chain antibody, and CD30 is single-stranded Antibody light chain VL is connected with CD30 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker, CD19 single-chain antibody light chains VL is connected with CD19 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker；The corner connected mode is specially： CD19 single-chain antibody light chain VL are connected with CD19 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker, and CD30 is single-stranded Antibody light chain VL and CD19 single-chain antibody heavy chain VH uses hinge Inter-Linker connections, CD30 single-chain antibodies between single-chain antibody Heavy chain VH and CD19 single-chain antibody light chain VL uses hinge Inter-Linker connections between single-chain antibody；

When two groups of single-chain antibodies are CD22 single-chain antibodies and CD19 single-chain antibodies, the mode that is connected in series is specially：CD22 Single-chain antibody light chain VL and CD19 single-chain antibody light chain VL uses hinge Inter-Linker connections between single-chain antibody, and CD22 is single-stranded Antibody light chain VL is connected with CD22 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker, CD19 single-chain antibody light chains VL is connected with CD19 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker；The corner connected mode is specially： CD19 single-chain antibody light chain VL are connected with CD19 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker, and CD22 is single-stranded Antibody light chain VL and CD19 single-chain antibody heavy chain VH uses hinge Inter-Linker connections, CD22 single-chain antibodies between single-chain antibody Heavy chain VH and CD19 single-chain antibody light chain VL uses hinge Inter-Linker connections between single-chain antibody；

When two groups of single-chain antibodies are CD123 single-chain antibodies and CD19 single-chain antibodies, the mode that is connected in series is specially： CD123 single-chain antibody light chain VL and CD19 single-chain antibody light chains VL uses hinge Inter-Linker connections between single-chain antibody, CD123 single-chain antibody light chain VL are connected with CD123 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker, and CD19 is mono- Chain antibody light chain VL is connected with CD19 single-chain antibody heavy chains VH using antibody inner hinge Inner-Linker；The corner connection side Formula is specially：CD19 single-chain antibody light chain VL and CD19 single-chain antibody heavy chains VH is connected using antibody inner hinge Inner-Linker Connect, CD123 single-chain antibody light chain VL and CD19 single-chain antibody heavy chains VH uses hinge Inter-Linker connections between single-chain antibody, CD123 single-chain antibody heavy chain VH and CD19 single-chain antibody light chains VL uses hinge Inter-Linker connections between single-chain antibody.

4. carrier as claimed in claim 1, it is characterised in that the sequence of the IL6R single-chain antibodies such as SEQ ID NO.33 institutes Show.

5. carrier as claimed in claim 1, it is characterised in that adjusted after the enhanced marmot hepatitis B transcriptions of eWPRE Control element has the enhancing mutation of 6 nucleotides, is specially：g.396G>A、g.397C>T、g.398T>C、g.399G>A、g.400A >T、g.411A>T。

6. carrier as claimed in claim 1, it is characterised in that whole OCTS structural genes are started by the people EF1 α promoters Expression, the CD8leader Chimerical receptors signal peptide is located at the N-terminal of OCTS coded sequences, for guiding OCTS albumen to be positioned at Cell membrane；Two groups of single-chain antibodies are combined into double antigen recognizing districts, for recognizing corresponding target antigen；The CD8Hinge is fitted together to Acceptor hinge is used to scFv being anchored on the outside of cell membrane；The CD8Transmembrane Chimerical receptors transmembrane region is used for will be whole Individual Chimerical receptor is fixed on cell membrane；The CD28 Chimerical receptors costimulating factor is used to stimulate T lymphocytes in vitro to activate With interior tumor cell lethal effect；The CD134 Chimerical receptors costimulating factor is used to promote T lymphopoiesis and the factor Secretion, strengthens tumour immunity, is conducive to the long-term surviving of memory T cell；The TCR Chimerical receptors t cell activation domain is used to swash The expression of downstream signaling pathway living；The IL6R single-chain antibodies are secreted into extracellular, closing IL6R, block IL6 signal paths, prevent Only inflammatory factor storm is upgraded；When antigen recognition region is combined with target antigen, signal be transferred to by Chimerical receptor it is intracellular, So as to produce T cell propagation, cytokine secretion increase, Anti-apoptotic proteins secretion increase, cell death delay, cracking target A series of biological effects of cell.

7. carrier as claimed in claim 1, it is characterised in that the Chimerical receptor costimulating factor region uses such as SEQ ID CD28 Chimerical receptors costimulating factor shown in NO.30 and the CD134 Chimerical receptor costimulations as shown in SEQ ID NO.31 Combinations of factors.

8. carrier as claimed in claim 1, it is characterised in that CD19 single-chain antibodies light chain VL, CD19 single-chain antibody weight Chain VH, CD20 single-chain antibody light chain VL, CD20 single-chain antibody heavy chain VH, CD30 single-chain antibody light chain VL, CD30 single-chain antibody weight Chain VH, CD123 single-chain antibody light chain VL, CD123 single-chain antibody heavy chain VH, IL6R single-chain antibody are by humanization modified.

9. a kind of pouring based on OCTS technologies as described in claim any one of 1-8 is the structure of leukaemia CAR-T therapy vectors Construction method, it is characterised in that comprise the following steps：

(1) by the sequences of AmpR containing ampicillin resistance gene as shown in SEQ ID NO.1, as shown in SEQ ID NO.2 Prokaryotic replions pUC Ori sequences, the Viral Replicon SV40Ori sequences as shown in SEQ ID NO.3, for slow virus packaging Slow virus packaging cis element, the ZsGreen1 green fluorescent proteins as shown in SEQ ID NO.11, such as SEQ ID NO.12 After the enhanced marmot hepatitis B transcription of shown IRES ribosome binding sequences, the eWPRE as shown in SEQ ID NO.13 Controlling element is stored on slow virus skeleton plasmid；

(2) by the people EF1 α promoters shown in SEQ ID NO.14, as described in OCTS Chimerical receptors domain and such as SEQ ID IL6R single-chain antibodies shown in NO.33 are combined into OCTS Chimerical receptor designs, are cloned by digestion, connection, recombining reaction Into slow virus skeleton plasmid, the recombinant slow virus plasmid of third generation OCTS designs is obtained；

(3) by obtained recombinant slow virus plasmid respectively with slow virus packaging plasmid pPac-GP, pPac-R and memebrane protein plasmid PEnv-G transfects HEK293T/17 cells jointly, is carried out in HEK293T/17 cells after gene transcript expression, packs and successfully weigh Group slow virus carrier can be discharged into cells and supernatant, collect the supernatant of the recombined lentivirus vector included；

(4) obtained recombinant slow virus supernatant is purified using the post way of purification of suction filtration, absorption, elution, respectively obtained Recombined lentivirus vector.

10. method as claimed in claim 9, it is characterised in that in step (4), the suction filtration step will control supernatant volume In 200ml~2000ml, control vacuum is prevented due to the carrier loss that plug-hole is brought in -0.5MPA~-0.9MPA；It is described Adsorption step will control the pH value of solution 6~8, and preventing PH change causes carrier to inactivate；The elution step will control to wash The ionic strength of de- liquid prevents the change of ionic strength from causing elution not exclusively or carrier inactivation in 0.5M~1.0M.

11. the carrier as described in claim any one of 1-8 is preparing the application during the medicine for being leukaemia is drenched in treatment.