CN107216375A - It is a kind of for jellyfish antibacterial peptide of cosmetics preservative and preparation method thereof - Google Patents
It is a kind of for jellyfish antibacterial peptide of cosmetics preservative and preparation method thereof Download PDFInfo
- Publication number
- CN107216375A CN107216375A CN201710404198.3A CN201710404198A CN107216375A CN 107216375 A CN107216375 A CN 107216375A CN 201710404198 A CN201710404198 A CN 201710404198A CN 107216375 A CN107216375 A CN 107216375A
- Authority
- CN
- China
- Prior art keywords
- antibacterial peptide
- peptide
- jellyfish
- antibacterial
- positive
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43595—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from coelenteratae, e.g. medusae
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K8/00—Cosmetics or similar toiletry preparations
- A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
- A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
- A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
- A61Q19/00—Preparations for care of the skin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/10—General cosmetic use
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
- A61K2800/40—Chemical, physico-chemical or functional or structural properties of particular ingredients
- A61K2800/52—Stabilizers
- A61K2800/524—Preservatives
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Mycology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Veterinary Medicine (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Public Health (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Animal Behavior & Ethology (AREA)
- Gastroenterology & Hepatology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Physics & Mathematics (AREA)
- Epidemiology (AREA)
- Birds (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Plant Pathology (AREA)
- Dermatology (AREA)
- Microbiology (AREA)
- Toxicology (AREA)
- Cosmetics (AREA)
- Peptides Or Proteins (AREA)
Abstract
Jellyfish antibacterial peptide of cosmetics preservative and preparation method thereof is used as the invention provides a kind of, jellyfish antibacterial peptide of the present invention has the advantages that has a broad antifungal spectrum, antibacterial efficiency high, safety and environmental protection, existing cosmetics can be solved and there is antibacterial ability deficiency in Antimicrobial preservative, narrow antimicrobial spectrum, not environmentally, the low problems of security performance.The present invention devises a kind of novel antibacterial peptide amino acid sequence according to the sterilization feature of jellyfish antibacterial peptide.The jellyfish antibacterial peptide amino acid sequence is：AACSDRAHGHICESFKSFCKDSGRNGVKLRANCKKTCGLC.On this basis, from Pichia pastoris preference codon, synthesizing new antibacterial peptide gene, it is cloned in Pichia pastoris and expresses, novel antimicrobial peptide restructuring yeast strains are obtained, and fermentation-scale is amplified to fermentation tank level, the high density fermentation and high efficient expression of antibacterial peptide product is realized.The antimicrobial peptide preparations such as pulvis, liquid are made in zymotic fluid after being further purified.Antimicrobial peptide preparation can be used as cosmetics preservative.
Description
Technical field
The invention belongs to technical field of bioengineering, specifically, it is related to a kind of jellyfish for cosmetics preservative and resists
Bacterium peptide and preparation method thereof.
Background technology
Cosmetics refer to, to smear, spray or other similar approach, any position of human body surface be interspersed among, to reach
Cleaning, maintenance, beauty, modification and change outward appearance, or amendment human scent, the chemical industrial product for the purpose of maintaining a good state
Or fine chemical product.In recent years, countries in the world cosmetic industry is quickly grown, and the mankind are more and more universal using cosmetics, is changed
Cosmetic has turned into the daily necessities that mankind's flavouring adds U.S..Cosmetics whitening antioxygen, moisturizing moisturizing, pox-dispelling function, Firm be crease-resistant,
Light spot dispel scar, face cleaning makeup removing, oil-control toxin expelling, sensitive skin, whitening and moisturizing, pore refining, beautifying face and moistering lotion, anti-lose one's looks, arrange
Malicious beauty treatment, effect of moisturizing isolation, thus enjoy liking for masses.As the nutritional ingredient of the progress cosmetics of science and technology is also more next
It is more, such as：Protein, amino acid, marine polysaccharide, pearl powder, embryo extract, vitamin, or even micro- and rare ore deposit
Material etc., can provide the microorganism in the nutrient needed for growth, environment once entering, you can rapid numerous to most of microbe
Grow, destroy the organoleptic quality of product, damage the health of consumer.
Preservative refers to natural or synthetic chemical composition, for adding food, medicine, pigment, biological sample etc., to prolong
Corruption caused by slow microorganism growth or chemical change.All it is chemical synthesis anti-corrosion used in current most of cosmetics companies
Agent, and be not very satisfactory in terms of chemical synthesis preservative has the defect that excitant is big, toxicity is big, security.It is existing
Consumer to cosmetics safety pay special attention to, it is intended to using it is natural, non-stimulated, without it is allergic the problems such as product.
In recent years, as people suppress the continuous understanding of microbial mechanism to preservative, the safety that chemical synthesis preservative is present in addition
Sex chromosome mosaicism, safe and efficient Substance is found from natural products has turned into the focus that cosmetics are studied, with fine
Development prospect, have become cosmetics preservative research new development direction.
Antibacterial peptide is a class by gene code or the Amphiphilic peptide of proteolysis, with broad spectrum antibiotic activity and is exempted from
Epidemic disease regulation activity, is the important component of immunity of organism defence, is prevalent in organism.Antibacterial peptide has broad-spectrum antiseptic
Activity, can quickly killing target, and be wherein much pure natural peptide, the wide spectrum killing scope of antibacterial peptide is：Gram
Negative bacteria, gram-positive bacterium, fungi, parasite, tumour cell etc..Antibacterial peptide has good anti-bacterial effect, to environment friend
Well, the features such as green non-pollution, antibacterial peptide is applied to cosmetics anti-corrosion, is a kind of project of environmental protection.Current antibacterial peptide
Scale and industrialization are also not carried out applied to cosmetics anti-corrosion.
The content of the invention
The invention provides a kind of for jellyfish antibacterial peptide of cosmetics preservative and preparation method thereof, it can solve
There is antibacterial ability deficiency in existing cosmetics, antimicrobial spectrum is not wide enough, not environmentally in Antimicrobial preservative, uneasy congruence problems.
The present invention devises a kind of novel antibacterial peptide amino acid sequence according to the sterilization feature of jellyfish antibacterial peptide.In this base
On plinth, from Pichia pastoris preference codon, artificial synthesized novel antibacterial peptide gene is cloned in Pichia pastoris and expressed, obtains
Novel antimicrobial peptide restructuring yeast strains, and fermentation-scale is amplified to fermentation tank level, realize the high density hair of antibacterial peptide product
Ferment and high efficient expression.The antimicrobial peptide preparations such as pulvis, liquid are made in zymotic fluid after being further purified.Antimicrobial peptide preparation can be used as cosmetic
Savor preservative.
In order to solve the above technical problems, the present invention is achieved using following technical scheme：Jellyfish antibacterial peptide, the antibacterial
Peptide has following amino acid sequence：AACSDRAHGHICESFKSFCKDSGRNGVKLRANCKKTCGLC.
Further, the preparation method of above-mentioned jellyfish antibacterial peptide, comprises the following steps：
（1）The synthesis of antibacterial peptide gene
According to jellyfish antibacterial peptide amino acid sequence, from Pichia pastoris preferred codons, synthetic antimicrobial peptide gene sequence, and at it
N-terminal introduces Kex2 restriction enzyme sites, and two ends introduce Xho I and Xba I restriction enzyme sites, in order to be cloned into yeast expression vector
In, another design synthesis pair of primers P1 and P2, for the identification of recombinant vector and recombinant yeast, sense primer is located at antibacterial peptide
Gene regions, anti-sense primer is located at the AOX of Pichia pastoris 3 ' gene regions；
Primer sequence is：P1：5'-TCGTCGGGAATGCCCAAATC -3', P2：5'—GCAGATTACAT'
TCAAGTCATGC—3'；
（2）The structure of peptide expression carrier and identification
Carrier and expression vector containing antibacterial peptide gene are used into Xho I and Xba I double digestions, digestion products are reclaimed and connected,
Enter performing PCR sequencing identification；
（3）Recombinate positive plasmid transformed yeast bacterial strain and screening
Positive plasmid is added in Pichia pastoris competent cell suspension after being linearized through Sac I single endonuclease digestions, is uniformly applied after electricity conversion
It is distributed on the YPDS selection flat boards containing 100 μ g/mL Zeocin, 28 ~ 30 DEG C are cultivated 3 ~ 5 days, treats that the positive on YPDS flat boards turns
Beggar's growth is larger, by each transformant successively dibbling to μ g/mL, 500 μ g/mL containing Zeocin 200,1000 μ g/mL's
YPDS selects flat board, using the bacterium colony of the normal growth on high concentration Zeocin flat boards as possible high copy recombinant bacterial strain；
Possible high copy recombination yeast genomic DNA is extracted, performing PCR reaction, 1% fine jade of PCR primer are entered by primer of P1, P2
Sepharose electrophoresis observation, the band recon of amplification carries out positive transformant identification；
（4）The induced expression of positive colony
The positive restructuring bacterium single bacterium colony screened is inoculated in the YPD nutrient solutions containing 100 μ g/mL Zeocin, 28 ~ 30 DEG C
Shaking 18 ~ 24 hours of culture, this bacterium solution is taken to be transferred by 3 ~ 5% volume ratios in 10 ml BMGY culture mediums, 28 ~ 30 DEG C of shakes
Cultivate 12 ~ 20 h or so, OD600 values are 5 ~ 6, and culture is directly transferred in 30 ~ 50 ml BMMY culture mediums, 28 ~ 30 DEG C after
Continuous shake culture, in order to maintain induced expression, adding 100% methanol every 15 ~ 20 h makes final concentration up to after 1 ~ 2%, 40 ~ 50 h,
Under the conditions of 4 DEG C, 4000 ~ 6000 r/min centrifuge 10 ~ 15 min, collect supernatant, carry out Antibacterial Activity.
Further, the positive recombinant of the high yield antibacterial peptide obtained through above-mentioned preparation method（Recombinant yeast pichia pastoris bacterium
Strain）, it is high density, the fermentation tank production technology of high efficient expression.
The described specific preparation technology of jellyfish antimicrobial peptide preparation is as follows：To screen after obtained positive recombinant activation by 4 ~
8% inoculum concentration is inoculated in triangular flask, 28 ~ 30 DEG C, is accessed after the h of 150 ~ 200 r/min shaking table cultures 18 ~ 24 with 4 ~ 8% inoculum concentrations
Fermentation tank, in 28 ~ 30 DEG C, 150 ~ 200 r/min, pH value 5.0 ~ 6.0, the VVM of throughput 0.5 ~ 1.0（The min of 1 L zymotic fluids 1
The amount of oxygen being passed through）, dissolved oxygen>Fermented in the case of 20%, after 18 ~ 24 h are cultivated, stream plus 50% glycerine treat that dissolved oxygen rises suddenly
To when 100%, stream plus methanol are to fermentation ends, whole 48 ~ 72h of fermentation lasts；
Former tank steam 100 DEG C of sterilizings 10 ~ 15 min, blowing, 5000 ~ 6000 r/min centrifuge 10 ~ 20 min after fermentation ends,
It is antibacterial peptide semi-finished product to collect fermentation supernatant；
Above-mentioned antibacterial peptide semi-finished product spray drying is freezed the pulvis of production and is refined with biochemical method, obtains liquid system after purification
Agent, as antibacterial peptide product.
Further, above-mentioned antibacterial peptide product can be used as cosmetics preservative.
The novel antimicrobial peptide that the present invention is designed is compared with similar products at home and abroad, and simple production process, production cost is low, suppression
Bacterium ability is strong, and has a broad antifungal spectrum, great market prospects.
Embodiment
Below by embodiment, the present invention will be further described.In the present invention, if not refering in particular to, Suo Youbai
Point ratio is unit of weight, and all devices and raw material are commercially available or the industry is commonly used, in following embodiments
Method, is this area conventional method unless otherwise instructed.
Embodiment 1
A kind of jellyfish antibacterial peptide for kit preservative, the antibacterial peptide has following amino acid sequence：
AACSDRAHGHICESFKSFCKDSGRNGVKLRANCKKTCGLC。
The preparation method of jellyfish antibacterial peptide, comprises the following steps：
（1）The synthesis of antibacterial peptide gene
According to jellyfish antibacterial peptide amino acid sequence, from Pichia pastoris preferred codons, synthetic antimicrobial peptide gene sequence, and at it
N-terminal introduces Kex2 restriction enzyme sites, and two ends introduce Xho I and Xba I restriction enzyme sites, in order to be cloned into yeast expression vector
In, another design synthesis pair of primers P1 and P2, for the identification of recombinant vector and recombinant yeast, sense primer is located at antibacterial peptide
Gene regions, anti-sense primer is located at the AOX of Pichia pastoris 3 ' gene regions；
Primer sequence is：P1：5'-TCGTCGGGAATGCCCAAATC -3', P2：5'—GCAGATTACAT'
TCAAGTCATGC—3'；
（2）The structure of peptide expression carrier and identification
Carrier and expression vector containing antibacterial peptide gene are used into Xho I and Xba I double digestions, digestion products are reclaimed and connected,
Enter performing PCR sequencing identification；
（3）Recombinate positive plasmid transformed yeast bacterial strain and screening
Positive plasmid is added in Pichia pastoris competent cell suspension after being linearized through Sac I single endonuclease digestions, is uniformly applied after electricity conversion
It is distributed on the YPDS selection flat boards containing 100 μ g/mL Zeocin, 28 DEG C are cultivated 4 days, treat the positive transformant on YPDS flat boards
Growth is larger, and each transformant successively dibbling is selected to the YPDS containing Zeocin 200 μ g/mL, 500 μ g/mL, 1000 μ g/mL
Flat board is selected, using the bacterium colony of the normal growth on high concentration Zeocin flat boards as possible high copy recombinant bacterial strain；
Possible high copy recombination yeast genomic DNA is extracted, performing PCR reaction, 1% fine jade of PCR primer are entered by primer of P1, P2
Sepharose electrophoresis observation, the band recon of amplification carries out positive transformant identification；
（4）The induced expression of positive colony
The positive restructuring bacterium single bacterium colony screened is inoculated in the YPD nutrient solutions containing 100 μ g/mL Zeocin, 28 DEG C of shakings
20 hours are cultivated, take this bacterium solution to be transferred by 3% volume ratio in 10 ml BMGY culture mediums, 30 DEG C of h of shake culture 15 are left
The right side, OD600 values are 6, and culture is directly transferred in 30 ml BMMY culture mediums, 28 DEG C of continuation shake cultures, in order to maintain to lure
Expression is led, adding 100% methanol every 15 h makes final concentration up to after 1.0%, 40 h, under the conditions of 4 DEG C, 5000 r/min centrifugations
15 min, collect supernatant, carry out Antibacterial Activity.
The specific preparation technology of jellyfish antibacterial peptide is as follows：It is inoculated with after the positive recombinant activation that screening is obtained by 4% inoculum concentration
In triangular flask, 28 DEG C, fermentation tank is accessed with 6% inoculum concentration after the h of 160 r/min shaking table cultures 20, at 30 DEG C, 180 r/min,
PH value 6.0, the VVM of throughput 0.8（The amount of oxygen that the min of 1 L zymotic fluids 1 is passed through）, dissolved oxygen>Fermented in the case of 20%, in training
Support after 18 h, stream plus 50% glycerine, stream plus methanol are to fermentation ends when dissolved oxygen rises to 100% suddenly, whole fermentation lasts 48h；
Former tank steam 100 DEG C of sterilizings 10 min, blowing, 6000 r/min centrifuge 12 min after fermentation ends, and collecting fermentation supernatant is
Antibacterial peptide semi-finished product；
Above-mentioned antibacterial peptide semi-finished product spray drying is freezed the pulvis of production and is refined with biochemical method, obtains liquid system after purification
Agent, as antibacterial peptide product, can be used as cosmetics preservative.
Embodiment 2
A kind of jellyfish antibacterial peptide for kit preservative, the antibacterial peptide has following amino acid sequence：
AACSDRAHGHICESFKSFCKDSGRNGVKLRANCKKTCGLC。
The preparation method of jellyfish antibacterial peptide, comprises the following steps：
（1）The synthesis of antibacterial peptide gene
According to jellyfish antibacterial peptide amino acid sequence, from Pichia pastoris preferred codons, synthetic antimicrobial peptide gene sequence, and at it
N-terminal introduces Kex2 restriction enzyme sites, and two ends introduce Xho I and Xba I restriction enzyme sites, in order to be cloned into yeast expression vector
In, another design synthesis pair of primers P1 and P2, for the identification of recombinant vector and recombinant yeast, sense primer is located at antibacterial peptide
Gene regions, anti-sense primer is located at the AOX of Pichia pastoris 3 ' gene regions；Primer sequence is：P1：5'—
TCGTCGGGAATGCCCAAATC -3', P2：5'—GCAGATTACAT'TCAAGTCATGC—3'；
（2）The structure of peptide expression carrier and identification
Carrier and expression vector containing antibacterial peptide gene are used into Xho I and Xba I double digestions, digestion products are reclaimed and connected,
Enter performing PCR sequencing identification；
（3）Recombinate positive plasmid transformed yeast bacterial strain and screening
Positive plasmid is added in Pichia pastoris competent cell suspension after being linearized through Sac I single endonuclease digestions, is uniformly applied after electricity conversion
It is distributed on the YPDS selection flat boards containing 100 μ g/mL Zeocin, 30 DEG C are cultivated 5 days, treat the positive transformant on YPDS flat boards
Growth is larger, and each transformant successively dibbling is selected to the YPDS containing Zeocin 200 μ g/mL, 500 μ g/mL, 1000 μ g/mL
Flat board is selected, using the bacterium colony of the normal growth on high concentration Zeocin flat boards as possible high copy recombinant bacterial strain；
Possible high copy recombination yeast genomic DNA is extracted, performing PCR reaction, 1% fine jade of PCR primer are entered by primer of P1, P2
Sepharose electrophoresis observation, the band recon of amplification carries out positive transformant identification；
（4）The induced expression of positive colony
The positive restructuring bacterium single bacterium colony screened is inoculated in the YPD nutrient solutions containing 100 μ g/mL Zeocin, 28 DEG C of shakings
24 hours are cultivated, take this bacterium solution to be transferred by 4% volume ratio in 10 ml BMGY culture mediums, 30 DEG C of h of shake culture 18 are left
The right side, OD600 values are 6, and culture is directly transferred in 40 ml BMMY culture mediums, 30 DEG C of continuation shake cultures, in order to maintain to lure
Expression is led, adding 100% methanol every 20 h makes final concentration up to after 1.5%, 45 h, under the conditions of 4 DEG C, 6000 r/min centrifugations
10 min, collect supernatant, carry out Antibacterial Activity.
The specific preparation technology of jellyfish antibacterial peptide is as follows：It is inoculated with after the positive recombinant activation that screening is obtained by 5% inoculum concentration
In accessing fermentation tank after 30 DEG C of triangular flask, the h of 180 r/min shaking table cultures 20 with 5% inoculum concentration, at 30 DEG C, 200 r/min,
PH value 6, throughput 0.6VVM（The amount of oxygen that the min of 1 L zymotic fluids 1 is passed through）, dissolved oxygen>Fermented in the case of 20%, in culture
After 20 h, stream plus 50% glycerine, stream plus methanol are to fermentation ends when dissolved oxygen rises to 100% suddenly, whole fermentation lasts 60h；Hair
Ferment former 100 DEG C of 10 min of sterilizing of tank steam after terminating, blowing, 5000 r/min centrifuge 15 min, and collection fermentation supernatant is anti-
Bacterium peptide semi-finished product；
Above-mentioned antibacterial peptide semi-finished product spray drying is freezed the pulvis of production and is refined with biochemical method, obtains liquid system after purification
Agent, as antibacterial peptide product, can be used as cosmetics preservative.
Anti-corrosion performance test of the antibacterial peptide in kit
Experimental program：Common bacteria in identification kit is separated, and carries out rejuvenation respectively；Certain bacterium amount is added in kit,
The antimicrobial peptide products of embodiment are added, the performance of kit is determined.Chemical preservative is added simultaneously and is opposed without preservative
Than determining antibacterial peptide Antimicrobial preservative performance of the present invention.Antibacterial peptide of the present invention is thousand as addition of the preservative in kit
/ mono-, the addition in kit of chemical preservative is 5/1000ths.
The test statistics result of each embodiment of table 1 and comparative example
From table 1, it is apparent that antipollution number of days is significantly more than chemical preservative group and preservative free group in each embodiment, say
Bright jellyfish antibacterial peptide of the invention has notable Antimicrobial preservative performance, can significantly extend the kit quality guarantee period.
Embodiment described above is a kind of preferably scheme of the present invention, not makees any formal to the present invention
Limitation, also has other variants and remodeling on the premise of without departing from the technical scheme described in claim.
Claims (4)
1. a kind of jellyfish antibacterial peptide, it is characterised in that the antibacterial peptide has following amino acid sequence：
AACSDRAHGHICESFKSFCKDSGRNGVKLRANCKKTCGLC。
2. the preparation method of the jellyfish antibacterial peptide described in a kind of claim 1, it is characterised in that comprise the following steps：
（1）The synthesis of antibacterial peptide gene
According to jellyfish antibacterial peptide amino acid sequence, from Pichia pastoris preferred codons, synthetic antimicrobial peptide gene sequence, and at it
N-terminal introduces Kex2 restriction enzyme sites, and two ends introduce Xho I and Xba I restriction enzyme sites, in order to be cloned into yeast expression vector
In, another design synthesis pair of primers P1 and P2, for the identification of recombinant vector and recombinant yeast, sense primer is located at antibacterial peptide
Gene regions, anti-sense primer is located at the AOX of Pichia pastoris 3 ' gene regions；Primer sequence is：P1：5'—
TCGTCGGGAATGCCCAAATC -3', P2：5'—GCAGATTACAT'TCAAGTCATGC—3'；
（2）The structure of peptide expression carrier and identification
Carrier and expression vector containing antibacterial peptide gene are used into Xho I and Xba I double digestions, digestion products are reclaimed and connected,
Enter performing PCR sequencing identification；
（3）Recombinate positive plasmid transformed yeast bacterial strain and screening
Positive plasmid is added in Pichia pastoris competent cell suspension after being linearized through Sac I single endonuclease digestions, is uniformly applied after electricity conversion
It is distributed on the YPDS selection flat boards containing 100 μ g/mL Zeocin, 28 ~ 30 DEG C are cultivated 3 ~ 5 days, treats that the positive on YPDS flat boards turns
Beggar's growth is larger, by each transformant successively dibbling to μ g/mL, 500 μ g/mL containing Zeocin 200,1000 μ g/mL's
YPDS selects flat board, using the bacterium colony of the normal growth on high concentration Zeocin flat boards as possible high copy recombinant bacterial strain；
Possible high copy recombination yeast genomic DNA is extracted, performing PCR reaction, 1% fine jade of PCR primer are entered by primer of P1, P2
Sepharose electrophoresis observation, the band recon of amplification carries out positive transformant identification；
（4）The induced expression of positive colony
The positive restructuring bacterium single bacterium colony screened is inoculated in the YPD nutrient solutions containing 100 μ g/mL Zeocin, 28 ~ 30 DEG C
Shaking 18 ~ 24 hours of culture, this bacterium solution is taken to be transferred by 3 ~ 5% volume ratios in 10 ml BMGY culture mediums, 28 ~ 30 DEG C of shakes
Cultivate 12 ~ 20 h or so, OD600 values are 5 ~ 6, and culture is directly transferred in 30 ~ 50 ml BMMY culture mediums, 28 ~ 30 DEG C after
Continuous shake culture, in order to maintain induced expression, adding 100% methanol every 15 ~ 20 h makes final concentration up to after 1 ~ 2%, 40 ~ 50 h,
Under the conditions of 4 DEG C, 4000 ~ 6000 r/min centrifuge 10 ~ 15 min, collect supernatant, carry out Antibacterial Activity.
3. the specific preparation technology of high yield antimicrobial peptide preparation described in claim 1 and 2, it is characterised in that comprise the following steps：
（1）After the positive recombinant activation that screening is obtained triangular flask, 28 ~ 30 DEG C, 150 ~ 200 are inoculated in by 4 ~ 8% inoculum concentrations
Fermentation tank is accessed with 4 ~ 8% inoculum concentrations after the h of r/min shaking table cultures 18 ~ 24, in 28 ~ 30 DEG C, 150 ~ 200 r/min, pH value 5.0
~ 6.0, the VVM of throughput 0.5 ~ 1.0（The amount of oxygen that the min of 1 L zymotic fluids 1 is passed through）, dissolved oxygen>Fermented in the case of 20%,
Cultivate after 18 ~ 24 h, stream plus 50% glycerine, stream plus methanol are to fermentation ends when dissolved oxygen rises to 100% suddenly, whole fermentation lasts
48~72h；
（2）Former 100 DEG C of 10 ~ 15 min of sterilizing of tank steam, blowing, 5000 ~ 6000 r/min centrifugations 10 ~ 20 after fermentation ends
Min, it is antibacterial peptide semi-finished product to collect fermentation supernatant；
（3）Above-mentioned antibacterial peptide semi-finished product spray drying is freezed the pulvis of production and is refined with biochemical method, obtains liquid after purification
Body preparation, as antibacterial peptide product.
4. the antibacterial peptide product described in any of the above-described claim is used as cosmetics preservative.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710404198.3A CN107216375A (en) | 2017-06-01 | 2017-06-01 | It is a kind of for jellyfish antibacterial peptide of cosmetics preservative and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710404198.3A CN107216375A (en) | 2017-06-01 | 2017-06-01 | It is a kind of for jellyfish antibacterial peptide of cosmetics preservative and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107216375A true CN107216375A (en) | 2017-09-29 |
Family
ID=59947087
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710404198.3A Pending CN107216375A (en) | 2017-06-01 | 2017-06-01 | It is a kind of for jellyfish antibacterial peptide of cosmetics preservative and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107216375A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102199196A (en) * | 2010-09-03 | 2011-09-28 | 青岛康地恩药业有限公司 | Gene engineering antibacterial peptide and preparation method and application thereof |
-
2017
- 2017-06-01 CN CN201710404198.3A patent/CN107216375A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102199196A (en) * | 2010-09-03 | 2011-09-28 | 青岛康地恩药业有限公司 | Gene engineering antibacterial peptide and preparation method and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| TATIANA V.OVCHINNIKOVA等: "Aurelin, a novel antimicrobial peptide from jellyfish Aurelia aurita with structural features of defensins and channel-blocking toxins", 《BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102199196B (en) | Gene engineering antibacterial peptide and preparation method and application thereof | |
| CN107736379B (en) | Application of bacillus amyloliquefaciens in preventing and treating plant fungal diseases | |
| TWI734048B (en) | Cosmetic composition for improving skin wrinkles comprising lactobacillus plantarum culture | |
| CN111040976B (en) | Bacillus amyloliquefaciens and application thereof | |
| CN108893424A (en) | A kind of bacillus megaterium BM22 and its microcapsule formulation and application | |
| CN103893022A (en) | Application of antibacterial peptide as preservative in preparing cosmetics | |
| CN108795827B (en) | Bacillus megaterium BM22, and water dispersible granule and application thereof | |
| CN107365710A (en) | One plant of Metarhizium Strains and its application to hazelnut weevil with High pathogenicity | |
| CN104356222B (en) | Mutant of one boar derived antimicrobial peptide PR 39 and its preparation method and application | |
| CN107760630B (en) | Bacillus methylotrophicus B18, microbial inoculum and application thereof | |
| CN107629985B (en) | Plant endophytic bacterium with antagonistic effect on plant pathogenic fungi | |
| CN107384803B (en) | One plant of beauveria bassiana BB-T02 to hot-zone flowers and fruits thrips with strong infecting potential | |
| CN108913622A (en) | The preparation and application of a kind of bacillus megaterium BM22 and its gemma pulvis | |
| CN107188942A (en) | It is a kind of for flower clam antibacterial peptide of aquaculture feed additive and preparation method thereof | |
| CN113180101A (en) | Preservative for inhibiting diseases of dragon fruit pathogenic bacteria and preparation method and application thereof | |
| CN107216375A (en) | It is a kind of for jellyfish antibacterial peptide of cosmetics preservative and preparation method thereof | |
| KR20140055959A (en) | Antibiotic composition containing antibiotic microbial fermented extracts | |
| CN114317628B (en) | Gamma-aminobutyric acid product with low irritation, preparation method thereof and application of gamma-aminobutyric acid product with low irritation | |
| CN108841752A (en) | The application of bacillus megaterium BM22 and its gemma liquid preparation in prevention and treatment cyclamen black root | |
| CN105753958B (en) | A kind of Novel fish derived antimicrobial peptide mutant and its preparation method and application | |
| CN108715817A (en) | A kind of Streptomycesalbidoflhaving bacterial strain and its application | |
| CN107099489A (en) | One plant raising hypocrellin fermentation production rate associated bacteria bacterial strain and its application | |
| CN104448006B (en) | A kind of heterozygous antibacterial peptide CE-PR and application thereof | |
| CN104285757B (en) | A kind of super hybridization rice mechanical enhancement on daytime irrigation method | |
| CN108060110B (en) | A kind of Arthrobacter strain and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170929 |