CN107177569A

CN107177569A - A kind of Kidney bean epoxide hydrolase and its heterogenetic expression method

Info

Publication number: CN107177569A
Application number: CN201710474196.1A
Authority: CN
Inventors: 邬敏辰; 石小玲; 阚婷婷; 李闯; 李剑芳
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2017-06-21
Filing date: 2017-06-21
Publication date: 2017-09-19

Abstract

The invention discloses a kind of Kidney bean epoxide hydrolase and its heterogenetic expression method, belong to technical field of bioengineering.The Kidney bean epoxide hydrolase gene nucleotides sequence of the present invention is classified as SEQ ID NO:1, its amino acid sequence is SEQ ID NO:2.The invention also discloses the structure of PvEH4 engineering bacterias and the method for the determination of activity for recombinating PvEH4.Using 6mM racemies Styryl oxide as substrate, PvEH4 engineering bacteria whole-cell catalytics are recombinated, when 25 DEG C, 220r/min reaction 4h, (R) SO enantiomeric excess (ee are obtained_s) and yield be respectively 99.9% and 32.1%, (R) PED enantiomeric excess (ee_p) and yield be respectively 92.7% and 65.4%.

Description

A kind of Kidney bean epoxide hydrolase and its heterogenetic expression method

Technical field

The present invention relates to a kind of Kidney bean epoxide hydrolase and its heterogenetic expression method, belong to biotechnology neck Domain.

Background technology

Chiral epoxides and its hydrolysate vicinal diamines can be used for the materials such as synthesis of chiral pharmaceutical intermediate, in medicine etc. Field can play a significant role.The material of two various configurations, while sometimes one can play pharmacological action, another configuration Toxic action can be produced, (R)-enantiomer of such as Thalidomide has sedation, forepart pregnant women reaction, but (S)-mapping can be treated Body and its metabolite have serious embryotoxicity and teratogenesis.The material that thus be accordingly used in synthesis of chiral pharmaceutical intermediate is best The application in the form of optical isomer.

Chiral purity epoxides and vicinal diols can be obtained by chemical method and bioanalysis, and chemical method can be divided mainly into not right Claim synthetic method, selection absorption Split Method, crystallization Split Method, chemical resolution method, Kinetic Resolution and chromatography, but it is all right The substrate type requirement of catalysis is strict and course of reaction in easily cause environmental pollution, do not meet the production theory of environmental protection； Compared to chemical method, bioanalysis is more efficiently single-minded, and reaction condition is gentle, green, economy, therefore is gradually taken seriously. In bioanalysis, obtaining the bioanalysis of epoxides and vicinal diamines mainly has direct oxygenation approach, indirect epoxidation approach and enzymolysis Split route of synthesis.Epoxide hydrolase (Epoxide hydrolase, EHs) and esterase each may participate in enzymolysis resolution way In footpath, but epoxide hydrolase (epoxide hydrolases, EHs) unlike esterase it is restricted to the substrate type of catalysis.

EHs wide material sources, in the animal and plant and microorganism such as mouse, potato, aspergillus niger (Aspergillus niger) It is found, because it can be by playing regulation metabolism, removing toxic substances, adjusting adjusting the contents level of epoxides in vivo The effect such as signaling molecule is saved, therefore is used for physiology and Biochemical Research more EHs for a long time.Until from it is microbe-derived it is middle find EHs presence, just causes its application in organic synthesis to be gradually taken seriously.Preferable EHs by Kinetic Resolution or can return The approach of one property hydrolysis obtains chiral purity epoxides or vicinal diamines, but in actual catalytic process, due to EHs property simultaneously It is undesirable so that obtained epoxides or the optical purity of vicinal diamines is not reaching to application requirement, and selective EHs power Learn split when often only focus on improve retain epoxides optical purity so that the optical purity of hydrolysate vicinal diamines because It can not be applied to be undesirable, cause the waste of vicinal diamines.Therefore still need to excavate new E Hs, to applied to chiral intermediate Synthesis, while chiral resolution epoxides, chiral purity vicinal diamines are also obtained, so as to realize industrialized production.

The content of the invention

First purpose of the present invention is to provide a kind of new epoxy in Kidney bean (Phaseolus vulgaris) source Thing hydrolase, amino acid sequence is such as shown in (a) or (b)：

(a) amino acid sequence is as shown in SEQ ID NO.2；

(b) amino acid sequence in (a) passes through substitution, lacks or adds one or several amino acid and with epoxidation Thing hydrolysing activity as protein derived from (a).

Second object of the present invention is to provide the gene for encoding the epoxide hydrolase.

In one embodiment of the invention, the nucleotide sequence of the gene is as shown in SEQ ID NO.1.

Third object of the present invention is to provide the genetic engineering bacterium for expressing the epoxide hydrolase.

In one embodiment of the invention, the genetic engineering bacterium is for carrier, in large intestine bar with pET-28a (+) SEQ ID NO, the epoxide hydrolase shown in 1 are expressed in bacterium.

In one embodiment of the invention, the Escherichia coli include E.coli BL21, E.coli JM109, E.coli DH5 α, E.coli TOP10 or E.coli JM109.

Fourth object of the present invention is to provide the application of the epoxide hydrolase, is by shown in SEQ ID NO.2 Epoxide hydrolase be used for racemation epoxy vinylbenzene (rac-SO) bioconversion.

In one embodiment of the invention, the epoxide hydrolase is enzyme liquid, enzyme powder or load epoxidation thing The cell of hydrolase.

In one embodiment of the invention, the application be by the genetic engineering bacterium by 1~2g wet thallus/6~ The addition of 8mmol substrates is added in the buffer solution containing rac-SO, and 4~18h is reacted in 22~28 DEG C.

In one embodiment of the invention, the application is by 1g wet thallus/6mmol bottoms by the genetic engineering bacterium The addition of thing is added in the buffer solution containing rac-SO, and 4~18h is reacted in 22~28 DEG C.

In one embodiment of the invention, the buffer solution is phosphate buffer.

In one embodiment of the invention, the buffer solution is 0.05~0.15mol/L, pH 7.0~7.2 phosphorus Phthalate buffer.

In one embodiment of the invention, also stirred in the course of reaction with 200~220r/min.

In one embodiment of the invention, the application is with 1g wet thallus/5mL phosphoric acid by the genetic engineering bacterium Buffer solution (K₂HPO₄-KH₂PO₄, 0.1M/L, pH 7.0) concentration suspend after, addition 6mM rac-SO be hydrolyzed, in 25 DEG C, 220r/min reacts.

The present invention also provide the epoxide hydrolase food, medicine, chemical field application.

Application of the genetic engineering bacterium in fermentation arts is also claimed in the present invention.

Beneficial effect：(1) the invention provides a kind of epoxide hydrolase PvEH4 acted on Kinetic Resolution, Being capable of hydrolysis of racemic Styryl oxide generation (S)-Styryl oxide and (R)-benzoglycols；(2) the invention provides application The method of the enzyme directionally hydrolyzing resolution of racemic Styryl oxide, when making resolution reaction reaction 4h, conversion ratio is 67.9%, (R)- The enantiomeric purity and yield of Styryl oxide are respectively 99.9%ee_sAnd 92.4%ee_p.Compared to existing Kinetic Resolution Racemation epoxy vinylbenzene retains the EHs for obtaining (R)-Styryl oxide, hydrolysate (R)-PED's that PvEH4 catalysis is obtained Enantiomeric purity increases, it is to avoid hydrolysate is because ee_pThe not high waste caused.

Brief description of the drawings

Fig. 1 is pET28a-pveh4 plasmid maps.

Embodiment

Below in conjunction with specific embodiment, the operating method of the present invention is expanded on further.But these embodiments are only used in detail Describe the bright present invention, rather than limitation the scope of the present invention in detail.

Racemation epoxy vinylbenzene (rac-SO) is purchased from Shanghai TCI companies；(S)-Styryl oxide ((S)-SO), (R)-ring Oxygen vinylbenzene ((R)-SO), (S)-benzoglycols ((S)-PED)) and (R)-benzoglycols ((R)-PED)) it is purchased from the resistance to Ji of Town in Shanghai Company；Other reagents are that domestic analysis is pure.Gas chromatograph GC-2010 is purchased from Shimadzu, Japan, chiral gas phase color Compose post CYCLOSIL-B (30m × 0.25mm × 0.25 μm) and be purchased from Agilent scientific ＆ technical corporation of the U.S..

Sample analysis uses gas chromatograph GC-2010, Chiral gas chromatography post and flame ionization ditector.Analysis Condition is：250 DEG C of injection port and detector temperature；100 DEG C of initial column temperature, 195 DEG C are warming up to 5 DEG C/min；Carrier gas is nitrogen, Flow velocity 3.0mL/min, split ratio 1:50.N-hexyl alcohol, (R)-SO, (S)-SO, (S)-PED and (R)-PED retention time are distinguished For 3.177,5.530,5.614,16.048 and 16.144min.

Calculation formula：ee_s=[(R-S)/(R+S)] × 100%；ee_p=[(R_d-S_d)/(R_d+S_d)] × 100%；(R)-SO Yield=R/ (R₀+S₀) × 100%, (R)-PED yields=R_d/(R₀+S₀) × 100%.Wherein：R and S represent (R)-and (S)-SO Concentration, R_dAnd S_dRepresent (R)-and (S)-PED concentration, R₀And S₀Represent (R)-and (S)-SO initial concentrations.

Enzymatic activity is defined：The enzyme amount of 1 μm of ol product of 1 μm of ol substrate of interior consumption per minute or generation is defined as an enzyme activity list Position (U).

Embodiment 1pveh4 design of primers

A pair of specific primers are designed according to pveh4 primary nucleotide sequence, for cloning pveh4.Primer sequence is such as Under：

pveh4-F:GAATTCATGGAGAACATACTTCACAGAAT(EcoR Ⅰ)

pveh4-R:CTCGAGTCAGAACTGCTTAATGAAGTCATAAATGT(Xho Ⅰ)

Embodiment 2pveh4 gene cloning

The Kidney bean of full seed is chosen, 30 DEG C of immersion 8h are incubated 20h.100mg plumules are taken to extract total serum IgE.It is total with Kidney bean RNA is that template, Oligo dT-Adaptor are primer, the reverse transcription synthesis chains of cDNA first；By template of the chain, PvEH4-F and M13 Primer M4 are primer, carry out first round PCR：94 DEG C of denaturation 2min, 30 circulations (94 DEG C of 30s, 50 DEG C 30s and 72 DEG C 70s)；Again by template of first round PCR primer, pveh4-F and pveh4-R be primer, carry out second and take turns PCR：94 DEG C of denaturation 2min, 30 circulations (94 DEG C of 30s, 52 DEG C of 30s and 72 DEG C of 70s), 72 DEG C of extension 10min.PCR primer is through agarose gel electrophoresis Analysis, as a result shows to have at about 1000bp a purpose band being consistent with expected size, after purpose band rubber tapping is reclaimed and Recon after being identified correctly through the screening of blue hickie, the digestions of Sac I, is carried out DNA by pUCm-T connections, Transformed E .coli JM109 Sequencing.Sequencing result shows that Pveh4 nucleotide sequence is as shown in SEQ ID NO.1, and the amino acid sequence of its enzyme encoded is such as Shown in SEQ ID NO.2.The recombinant plasmid is named as pUCm-T-Pveh4.

Embodiment 3PvEH4 heterogenous expression

With EcoR I and Xho I while double digestion pUCm-T-Pveh4 and pET-28a (+) plasmid, electric through Ago-Gel After swimming analysis, rubber tapping recovery obtains Pveh4 and pET-28a (+) fragment, is stayed overnight with the connection of T4DNA ligases, obtains recombinant plasmid PET28a-pveh4, is transformed into E.coli BL21 (DE3) competence, and picking single bacterium falls within 2mL containing 100 μ g/mL kanamycins LB in after culture 4h, carry out bacterium solution PCR checkings, will verify that correct transformant carries out DNA sequencing.As a result correct transformant It is named as E.coli/pET28a-pveh4.

Picking E.coli/pET28a-pveh4 and E.coli/pET28a single bacterium colony is inoculated in 2mL, and containing 100 μ g/mL cards, that is mould In the LB culture mediums of element, in 37 DEG C, 220r/min overnight incubations；2mL nutrient solutions are taken to transfer in 100mL identical culture mediums, Cultivate to OD₆₀₀For 0.6~0.8 when, add IPTG (final concentration 0.3mmol/L), 16 DEG C, 220r/min induction 10h after centrifuge receive Collect thalline (8000rpm, 5min).With being carried out after 1g/20ml KPB (pH 7.0) suspension E.coli/pET28a-pveh4 thalline SDS-PAGE, as a result shows that PvEH4 about has single band at 36.5kDa, the success of Pveh4 genes is realized different in Escherichia coli Express in source.

Embodiment 4PvEH4 viability examination

By the thalline being collected by centrifugation 1g/5ml phosphate buffer (K₂HPO₄-KH₂PO₄, 0.1M/L, pH 7.0) suspend, 1455 μ L bacteria suspensions are added in 2mL centrifuge tubes, 5min is incubated in 25 DEG C, 45 μ L 200mM racemation epoxy vinylbenzenes are added (rac-SO), to final concentration of 6mM, in 25 DEG C, 220r/min, the μ L reaction solutions of timing sampling 100 to 1ml ethyl acetate (contain 1mmol/L n-hexyl alcohols make internal standard) in extracted, (10000rpm, 2min) is centrifuged after mixing and takes upper organic phase, addition is anhydrous Magnesium sulfate is dried, and gas chromatographic detection is carried out after 0.22 μm of organic membrane filter.Conversion ratio is 67.9%, (S)-SO when reacting 4h It is exhausted, (R)-SO ee_sIt is respectively the 99.9% and 32.1% (theory for the epoxides that Kinetic Resolution is obtained with yield Yield is 50%) (R)-PED ee_pIt is respectively 92.7% and 65.4% with yield；Conversion ratio is 88.4% when reacting 12h.

Relatively more same PvEH4 and PvEH1 (Genebank to derive from Kidney bean:KR604729.1), PvEH1 is catalyzed rac-SO When hydrolysis reaches 70%, (R)-SO and (R)-PED are respectively 30.7%ee_sAnd 42.3%ee_p；When conversion ratio is 99.1%, ee_p For 33.6%, ee_sAnd ee_pIt is below PvEH4.

Reference examples 1

Search obtains another sequence (XM_007163062.1) from bean gene group from ncbi database, by this Unnamed gene is Pveh5, according to the strategy design primer of embodiment 1：

pveh5-F：5 '-CATATGATGGAGAAAATAGAGCACACAAGG-3 ' (Nde containing restriction enzyme site I)；

pveh5-R：5 '-CTCGAGTTAAAATTTCTTGATGAAGTCGTATATATGC-3 ' (Xho containing restriction enzyme site I).

The gene is cloned according to the strategy of embodiment 2, it is subjected to heterogenous expression in E.coli BL21 (DE3), obtained Recombinant bacterium E.coli/pveh5.Recombinant bacterium is obtained into PvEH5 according to progress heterogenous expression the step of embodiment 3, according to embodiment 4 Property is determined, using E.coli/pET28a as control, it is found that PvEH5 does not show EH catalytic activity to rac-SO.Will E.coli/pveh5 bacteria suspensions are mixed with 6mM rac-SO, reacted jointly in 25 DEG C, 220r/min and vapor detection is carried out after 12h, Interpretation of result shows that rac-SO concentration of the concentration compared to the rac-SO in E.coli/pET28a control groups is not reduced；Remove Rac-SO itself hydrolysis is outer, and PED concentration do not increase relative to control group.

Reference examples 2

According to embodiment 3, pveh4 is connected on pET32a (+) carrier, recombinant plasmid pET32a-pveh4 is obtained, will Recombinant plasmid is imported in BL21 (DE3), is obtained recombinant bacterium BL21/pET32a-pveh4 and is fermented, is carried out according to embodiment 4 Determination of activity, it is found that enzymatic activity have dropped 47% compared to BL21/pET28a-pveh4, enantioselectivity is compared to BL21/ PET28a-pveh4 is not improved.

Reference examples 3

According to embodiment 3, pET28a-pveh4 is imported in Rosetta (DE3) host, recombinant bacterium Rosetta/ is obtained PET28a-pveh4, enzymatic activity is determined according to embodiment 4, finds Rosetta/pET28a-pveh4 enzymatic activitys and enantioselectivity It is not improved compared to BL21/pET28a-pveh4.

Although the present invention is disclosed as above with preferred embodiment, it is not limited to the present invention, any to be familiar with this skill The people of art, without departing from the spirit and scope of the present invention, can do various changes and modification, therefore the protection model of the present invention Enclose being defined of being defined by claims.

SEQUENCE LISTING

<110>Southern Yangtze University

<120>A kind of Kidney bean epoxide hydrolase and its heterogenetic expression method

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 969

<212> DNA

<213>Artificial sequence

<400> 1

atggagaaca tacttcacag aattgtggaa ctcaatggca taaatatgca tgttgcagag 60

aagggagaag gcccagtggt gttgttcttg catggcttcc ccgaactctg gtactcatgg 120

cgccaccaga ttctgcatct cagttccctg ggttaccgtg ctgttgcccc tgacctccga 180

ggctacggtg acaccgatgc ccctgcgcca ctcaccacct acacgtgttt ccaccttgtc 240

ggtgacattg ttgcgctcat tgactctctt ggtgtggaca aagtgttcct tgtggcccat 300

gattggggtg ccatcctcgg ttggtacctc tgcttgttcc gaccagacag agtgaaggcc 360

tatgtcgctc tcagtgtccc cttccgaccc ttcctcggaa gaaacccgca acagaagacc 420

ctcgatattt tccatgcctt gtatggagat gactactaca tatgcagatt tcaggaacca 480

gggaagatgg aagctgagct gggtcgcgtt gacactgcat atctgatgaa gaacatgttt 540

acaacgcgcc aaaccggtcc acccattttc cccaaagggg aatatggaac tggatttaat 600

ccccatactc cagataccct gccctcttgg ctcactcaac aagatcttga ttattacgtt 660

acgaaagtcg agagatctgg cttcactgga ggcttgaact attacagaaa tctcaatata 720

aattgggagc tgacagcacc gtggactgga gtaggaattg agaatgtgcc agttaagttc 780

attacaggta gcgtagactt ggtgtacact tcaccgggga tgaaggagta catccacaac 840

ggtggtttca agaaagatgt gccaactctg gaggaagtgg tggtgcagga aggagttggc 900

cacttcaaca accaagaagc agcacacgat gtggccaatc acatttatga cttcattaag 960

cagttctga 969

<210> 2

<211> 322

<212> PRT

<213>Artificial sequence

<400> 2

Met Glu Asn Ile Leu His Arg Ile Val Glu Leu Asn Gly Ile Asn Met

1 5 10 15

His Val Ala Glu Lys Gly Glu Gly Pro Val Val Leu Phe Leu His Gly

20 25 30

Phe Pro Glu Leu Trp Tyr Ser Trp Arg His Gln Ile Leu His Leu Ser

35 40 45

Ser Leu Gly Tyr Arg Ala Val Ala Pro Asp Leu Arg Gly Tyr Gly Asp

50 55 60

Thr Asp Ala Pro Ala Pro Leu Thr Thr Tyr Thr Cys Phe His Leu Val

65 70 75 80

Gly Asp Ile Val Ala Leu Ile Asp Ser Leu Gly Val Asp Lys Val Phe

85 90 95

Leu Val Ala His Asp Trp Gly Ala Ile Leu Gly Trp Tyr Leu Cys Leu

100 105 110

Phe Arg Pro Asp Arg Val Lys Ala Tyr Val Ala Leu Ser Val Pro Phe

115 120 125

Arg Pro Phe Leu Gly Arg Asn Pro Gln Gln Lys Thr Leu Asp Ile Phe

130 135 140

His Ala Leu Tyr Gly Asp Asp Tyr Tyr Ile Cys Arg Phe Gln Glu Pro

145 150 155 160

Gly Lys Met Glu Ala Glu Leu Gly Arg Val Asp Thr Ala Tyr Leu Met

165 170 175

Lys Asn Met Phe Thr Thr Arg Gln Thr Gly Pro Pro Ile Phe Pro Lys

180 185 190

Gly Glu Tyr Gly Thr Gly Phe Asn Pro His Thr Pro Asp Thr Leu Pro

195 200 205

Ser Trp Leu Thr Gln Gln Asp Leu Asp Tyr Tyr Val Thr Lys Val Glu

210 215 220

Arg Ser Gly Phe Thr Gly Gly Leu Asn Tyr Tyr Arg Asn Leu Asn Ile

225 230 235 240

Asn Trp Glu Leu Thr Ala Pro Trp Thr Gly Val Gly Ile Glu Asn Val

245 250 255

Pro Val Lys Phe Ile Thr Gly Ser Val Asp Leu Val Tyr Thr Ser Pro

260 265 270

Gly Met Lys Glu Tyr Ile His Asn Gly Gly Phe Lys Lys Asp Val Pro

275 280 285

Thr Leu Glu Glu Val Val Val Gln Glu Gly Val Gly His Phe Asn Asn

290 295 300

Gln Glu Ala Ala His Asp Val Ala Asn His Ile Tyr Asp Phe Ile Lys

305 310 315 320

Gln Phe

<210> 3

<211> 29

<212> DNA

<213>Artificial sequence

<400> 3

gaattcatgg agaacatact tcacagaat 29

<210> 4

<211> 35

<212> DNA

<213>Artificial sequence

<400> 4

ctcgagtcag aactgcttaa tgaagtcata aatgt 35

<210> 5

<211> 30

<212> DNA

<213>Artificial sequence

<400> 5

catatgatgg agaaaataga gcacacaagg 30

<210> 6

<211> 37

<212> DNA

<213>Artificial sequence

<400> 6

ctcgagttaa aatttcttga tgaagtcgta tatatgc 37

Claims

1. a kind of epoxide hydrolase in Kidney bean source, it is characterised in that amino acid sequence is such as shown in (a) or (b)：

(a) amino acid sequence is as shown in SEQ ID NO.2；

(b) amino acid sequence in (a) passes through substitution, lacks or adds one or several amino acid and with epoxides water Solution activity as protein derived from (a).

2. encode the gene of epoxide hydrolase described in claim 1.

3. a kind of genetic engineering bacterium, it is characterised in that using Escherichia coli as host, the epoxidation shown in expression SEQ ID NO.1 Thing hydrolase.

4. genetic engineering bacterium according to claim 3, it is characterised in that with pET-28a (+) for carrier.

5. genetic engineering bacterium according to claim 3, it is characterised in that the host includes E.coli BL21, E.coli JM109, E.coli DH5 α, E.coli TOP10 or E.coli JM109.

6. a kind of bioconversion method of R- Styryl oxides, it is characterised in that the epoxides shown in application SEQ ID NO.2 Hydrolases racemation epoxy vinylbenzene.

7. method according to claim 6, it is characterised in that the epoxide hydrolase is enzyme liquid, enzyme powder or load The cell of epoxide hydrolase.

8. method according to claim 7, it is characterised in that the cell is the genetic engineering bacterium described in claim 3, The genetic engineering bacterium is added to the slow of the vinylbenzene containing racemation epoxy by the addition of 1~2g wet thallus/6~8mmol substrates In fliud flushing, 4~18h is reacted in 22~28 DEG C.

9. epoxide hydrolase belonging to claim 1 food, medicine, chemical field application.

10. application of the genetic engineering bacterium described in claim 3 in fermentation arts.