CN107176994B - MMAF novel pathogenic gene and application thereof - Google Patents

MMAF novel pathogenic gene and application thereof Download PDF

Info

Publication number
CN107176994B
CN107176994B CN201710495512.3A CN201710495512A CN107176994B CN 107176994 B CN107176994 B CN 107176994B CN 201710495512 A CN201710495512 A CN 201710495512A CN 107176994 B CN107176994 B CN 107176994B
Authority
CN
China
Prior art keywords
glu
leu
lys
ile
ser
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201710495512.3A
Other languages
Chinese (zh)
Other versions
CN107176994A (en
Inventor
沙艳伟
李萍
李琳
梅利斌
黄娴静
林绍彬
王旭
张庆
邱乒乒
龚秀芳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BEIJING OBSTETRICS AND GYNECOLOGY HOSPITAL CAPITAL MEDICAL UNIVERSITY
Xiamen Maternity & Child Healthcare Hospital (xiamen City Family Planning Service Center)
Original Assignee
BEIJING OBSTETRICS AND GYNECOLOGY HOSPITAL CAPITAL MEDICAL UNIVERSITY
Xiamen Maternity & Child Healthcare Hospital (xiamen City Family Planning Service Center)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BEIJING OBSTETRICS AND GYNECOLOGY HOSPITAL CAPITAL MEDICAL UNIVERSITY, Xiamen Maternity & Child Healthcare Hospital (xiamen City Family Planning Service Center) filed Critical BEIJING OBSTETRICS AND GYNECOLOGY HOSPITAL CAPITAL MEDICAL UNIVERSITY
Priority to CN201710495512.3A priority Critical patent/CN107176994B/en
Publication of CN107176994A publication Critical patent/CN107176994A/en
Application granted granted Critical
Publication of CN107176994B publication Critical patent/CN107176994B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/34—Genitourinary disorders

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Pathology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • General Engineering & Computer Science (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

A new MMAF pathogenic gene and application thereof relate to pathogenic genes, and a new MMAF pathogenic gene CFAP44 is discovered for the first time. The MMAF multiple diseased families and diseased individuals are taken as research objects, exome sequencing and comparison are carried out on the diseased individuals in the families, and different gene mutations of CFAP44 genes of different patients are found. These mutations can be used to detect brachyury spermatia (MMAF).

Description

MMAF novel pathogenic gene and application thereof
Technical Field
The invention relates to a pathogenic gene, in particular to a novel MMAF pathogenic gene and application thereof.
Background
Multiple morphological abnormalities of the tail of the sperm (MMAF) are a recessive inherited teratospermia that causes male infertility, a rare genetic disease whose primary clinical features are the sum of five abnormalities of the tail of the sperm, including short tail, no tail, curly tail, curved tail and irregular tail width. Early studies also reported that the disease was fibrous sheath Dysplasia (DFS) and brachyury (stub tails). Early foreign molecular pathogenesis research discovers that DNAH1 gene has mutation (1), and the gene codes ciliated axis motor protein heavy chain 1 (dyneixonemal heavy chain 1) protein.
At present, the gene mutation spectrum of MMAF is not completely discovered, and the relationship between genotype and phenotype is not clear. At present, the research on single-gene diseases starts to adopt a large number of methods of whole-exome sequencing (whole-exome sequencing) and whole-genome sequencing (whole-genome sequencing), and the two methods are successfully applied to find the pathogenic genes of rare single-gene diseases. The whole exome sequencing and whole genome sequencing technology is proved to be a powerful and effective means for reducing rare single-gene disease candidate genes and even discovering pathogenic genes thereof. The success rate of screening for disease-related variations is greatly enhanced by sequencing only the whole exome or genome of a few rare individuals, including patients and normal controls.
Therefore, the research on the MMAF in the field is not clear, and the reason for causing the disease is not clear, so that the research on the pathogenic mechanism of the MMAF to find a new pathogenic gene and a mutation site is urgently needed in the field.
Reference documents:
1.Ben Khelifa M,Coutton C,Zouari R,Karaouzene T,Rendu J,Bidart M,Yassine S,Pierre V,Delaroche J,Hennebicq S,Grunwald D,Escalier D,Pernet-Gallay K,Jouk PS,Thierry-Mieg N,Toure A,et al.Mutations in DNAH1,whichencodes an inner arm heavy chain dynein,lead to male infertility from mμltiple morphological abnormalities of the sperm flagella.Am J Hum Genet.2014；94(1):95-104.
disclosure of Invention
The first object of the present invention is to provide a method for determining a novel causative gene of MMAF by exome sequencing.
It is a second object of the invention to provide biomarkers for MMAF.
It is a third object of the present invention to provide a mutated CFAP44 gene.
A fourth object of the invention is to provide a mutant CFAP44 protein.
A fifth object of the present invention is to provide a method of detecting MMAF.
The sixth object of the present invention is to provide a primer set used in detecting a mutation in CFAP44 gene or CFAP44 protein by PCR.
The seventh object of the present invention is to provide a nucleic acid probe complementary to the mutant CFAP44 gene.
An eighth object of the present invention is to provide a kit for detecting a mutant CFAP44 gene or CFAP44 protein.
The ninth purpose of the present invention is to provide a kit for detecting a mutant CFAP44 gene.
The tenth purpose of the invention is to provide the application of the MMAF novel pathogenic gene.
The method determines the new pathogenic gene of MMAF through exome sequencing.
A biomarker for said MMAF, i.e. a mutated CFAP44 gene or CFAP44 protein, said biomarker being a mutated CFAP44 gene or CFAP44 protein having a sequence selected from the group consisting of:
missense mutations in exon 14 (c.1769T > A; p.L590Q);
a nonsense mutation in exon 22 (c.2935_2944 del; p.D979);
missense mutations in exon 23 (c.3262G > A; p.G1088S);
missense mutations in exon 14 (c.1718C > A; p.P573H);
frame-shift mutations in exon 16 (c.2005_2006 del; p.M669Vfs 13).
The mutated CFAP44 gene has the following mutations in the sequence of SEQ ID NO: 1:
a missense mutation in exon 14 (c.1769T > A);
a nonsense mutation in exon 22 (c.2935 — 2944 del);
a missense mutation in exon 23 (c.3262g > a);
missense mutation in exon 14 (c.1718c > a);
a frameshift mutation in exon 16 (c.2005_2006 del).
The mutated CFAP44 protein is a sequence of SEQ ID NO:2 and has the following mutations:
missense mutation in exon 14 (p.l590q);
nonsense mutations in exon 22 (p.d 979);
missense mutation in exon 23 (p.g1088s);
missense mutation in exon 14 (p.p573h);
a frameshift mutation in exon 16 (p.M669Vfs 13).
The mutant CFAP44 protein is a sequence shown in SEQ ID NO. 2, has nonsense mutation (p.D979) in an exon 22, and the sequence of the mutant CFAP44 protein is SEQ ID NO. 11;
the mutant CFAP44 protein is a sequence shown in SEQ ID NO. 2 and has a frame shift mutation (p.M669Vfs 13) in an exon 16, and the sequence of the mutant CFAP44 protein is SEQ ID NO. 12.
The method of detecting MMAF, the method comprising detecting the presence or absence of a mutation site in the CFAP44 gene or CFAP44 protein of a subject, and if so, identifying the subject as having or susceptible to MMAF, the mutation site being selected from any one or a combination of:
missense mutations in exon 14 (c.1769T > A; p.L590Q);
a nonsense mutation in exon 22 (c.2935_2944 del; p.D979);
missense mutations in exon 23 (c.3262G > A; p.G1088S);
missense mutations in exon 14 (c.1718C > A; p.P573H);
frame-shift mutations in exon 16 (c.2005_2006 del; p.M669Vfs 13).
The CFAP44 protein is represented by a sequence shown in SEQ ID NO. 2.
The CFAP44 gene is represented by the sequence of SEQ ID NO. 1.
The method for detecting MMAF comprises the following steps of amplifying at least one group of primers:
3 and 4;
5 and 6 SEQ ID NO;
7 and 8 SEQ ID NO;
SEQ ID NO 9 and SEQ ID NO 10.
In the method for detecting MMAF, mutation sites are detected by a method selected from the group consisting of: sequencing, electrophoresis, nucleic acid hybridization, in situ hybridization, PCR, reverse transcriptase chain reaction, and denaturing high performance liquid chromatography.
The primer pair used in the detection of the CFAP44 gene or CFAP44 protein mutation by PCR, wherein the mutation is selected from any one or combination of the following:
missense mutations in exon 14 (c.1769T > A; p.L590Q);
a nonsense mutation in exon 22 (c.2935_2944 del; p.D979);
missense mutations in exon 23 (c.3262G > A; p.G1088S);
missense mutations in exon 14 (c.1718C > A; p.P573H);
a frameshift mutation in exon 16 (c.2005_2006 del; p.M669Vfs 13),
wherein the primer pairs are designed based on a position selected from the group consisting of before and after, respectively, such that the position is amplified (numbering based on the cDNA sequence of CFAP 44): 1769. 2935_2944, 3262, 1718 and 2005_ 2006.
The nucleic acid probe complementary to a mutant CFAP44 gene, wherein the mutation is selected from any one or a combination of the following:
missense mutations in exon 14 (c.1769T > A; p.L590Q);
a nonsense mutation in exon 22 (c.2935_2944 del; p.D979);
missense mutations in exon 23 (c.3262G > A; p.G1088S);
missense mutations in exon 14 (c.1718C > A; p.P573H);
a frameshift mutation in exon 16 (c.2005_2006 del; p.M669Vfs 13),
the complementary region of the probe to the mutant CFAP44 gene includes a position selected from the following (numbering based on the cDNA sequence of CFAP 44): 1769. 2935_2944, 3262, 1718 and 2005_ 2006.
The kit for detecting the mutant CFAP44 gene or CFAP44 protein comprises one or more groups of primer pairs, wherein the mutation is selected from any one or the combination of the following:
missense mutations in exon 14 (c.1769T > A; p.L590Q);
a nonsense mutation in exon 22 (c.2935_2944 del; p.D979);
missense mutations in exon 23 (c.3262G > A; p.G1088S);
missense mutations in exon 14 (c.1718C > A; p.P573H);
a frameshift mutation in exon 16 (c.2005_2006 del; p.M669Vfs 13),
wherein the primer pairs are designed based on a position selected from the group consisting of such that their amplification products encompass the position (numbering based on the cDNA sequence of CFAP 44): 1769. 2935_2944, 3262, 1718 and 2005_ 2006.
The kit for detecting the mutant CFAP44 gene or CFAP44 protein comprises at least one group of primers selected from the following group:
3 and 4;
5 and 6 SEQ ID NO;
7 and 8 SEQ ID NO;
SEQ ID NO 9 and SEQ ID NO 10.
The kit for detecting the mutant CFAP44 gene comprises one or more nucleic acid probes, and the mutation is selected from any one or the combination of the following:
missense mutations in exon 14 (c.1769T > A; p.L590Q);
a nonsense mutation in exon 22 (c.2935_2944 del; p.D979);
missense mutations in exon 23 (c.3262G > A; p.G1088S);
missense mutations in exon 14 (c.1718C > A; p.P573H);
a frameshift mutation in exon 16 (c.2005_2006 del; p.M669Vfs 13),
the probe is complementary to a region on the mutant CFAP44 gene comprising a position selected from the group consisting of (numbering based on the cDNA sequence of CFAP 44): 1769. 2935_2944, 3262, 1718 and 2005_ 2006.
An application of MMAF new pathogenic gene.
The invention lays an important foundation for the research of the pathogenesis of the MMAF and possibly provides a brand-new theoretical basis for the treatment of patients with the MMAF.
Detailed Description
In the present invention, mutations are expressed using methods commonly used in the art. For example, in the mutation (c.1769T > A; p.L590Q), c represents cDNA, p represents protein, and mutation at the DNA level corresponds to mutation at the protein level; in the frameshift mutation (c.2005_2006 del; p.M669Vfs 13), c.2005_2006del represents the deletion of positions 2005-2006 at the DNA level, p.M669Vfs 13 represents the frameshift of 13 amino acids from position 669, and the formed mutant protein has only 681 amino acids as shown in SEQ ID NO: 12; among nonsense mutations (c.2935 — 2944 del; p.D979), c.2935 — 2944del represents deletion of 2935-2944 sites at the DNA level, and p.D979 represents mutation of amino acid D at 979 site to a stop codon, so that the formed mutant protein has only 978 amino acids, as shown in SEQ ID NO. 11.
The cDNA sequence of the wild-type CFAP44 gene is shown in SEQ ID NO. 1.
2, SEQ ID NO: amino acid sequence of wild-type CFAP44 protein.
For purposes of the present specification and claims, reference to gene sequences will be understood by those skilled in the art to include virtually either or both of the complementary double strands. For convenience, in the present specification and claims, although one strand is given in most cases, the other strand complementary thereto is actually disclosed. For example, reference is made to the cDNA sequence of the CFAP44 gene, including in fact that sequence and its complement. For example, reference to SEQ ID NO 1 actually includes the complementary sequence thereof. One skilled in the art will also appreciate that one strand may be used to detect the other strand and vice versa.
The gene sequences in this application include either the DNA form or the RNA form, one of which is disclosed, meaning the other is also disclosed. For example, reference is made to the cDNA sequence of the CFAP44 gene, and indeed to the corresponding RNA sequence.
Example 1 the causative gene of MMAF was determined.
27 cases of MMAF are collected, all patients show sterility, and tail malformation comprises typical MMAF disease characteristics such as short tail, no tail, tail curl, tail bending and irregular tail width.
The invention carries out whole exome sequencing on all patients, and comprises the following specific steps:
sample preparation: collecting peripheral blood of the patient and a parent mother, extracting genomic DNA (QIAamp DNA Mini Kit 51304 Qiagen, USA) in peripheral blood leukocyte by using a Kit, measuring the concentration and purity of the DNA (Thermo Scientific, USA) by using NanoDrop 2000, and obtaining the OD260/OD280 of the genomic DNA of each sample, wherein the concentration is not less than 100 ng/mul, and the total amount is not less than 30 mul.
Then, exome sequences of the above four samples were sequenced. The sequencing platform was Illumina Hiseq2000, and sequencing was performed according to Illumina Standard library construction Specification (see http:// www.illumina.com /), briefly as follows:
1) a DNA Library was prepared using TruSeq DNA Library Prep Kit available from Illumina. The Agilent kit SureSelect Human All Exon V5 was used during Exon capture;
2) performing parallel sequencing on the captured exon regions by using an Illumina HiSeq2000 sequencing platform to read the length of 90bp, wherein the average sequencing depth of each sample is at least 100;
3) the sequencing results were aligned to the ginseng reference genome using a Burrows-Wheeler Aligner (http:// bio-bw. sourceforce. net /) (hg 19). Duplicate reads were removed using SAMtools, adjusted and calibrated by GATK (https:// www.broadinstitute.org/GATK /). SNVs and InDels were then mined using SAMtools (http:// www.samtools.sourceforge.net /) and named with ANNOVAR (http:// www.openbioinformatics.org/ANNOVAR /).
Mutation sites with allele frequencies greater than 1% were knocked out (reference database included dbSNP, 1000 genes, exo-organization Consortium (ExAC)).
5 patients were found to have homozygous or complex heterozygous mutations in the gene CFAP 44: these sites were probably pathogenic by co-segregation of 3 patients and 5 normal SNP screens in both families.
The results are shown in Table 3.
Therefore, the CFAP44 gene is considered to be the most likely pathogenic gene of MMAF by the invention.
Example 2 the causative gene of MMAF described above was confirmed in other cases.
The present invention was incorporated into all MMAF patients and the CFAP44 gene was verified as a causative gene of MMAF. In the verification, the Sanger method is used for sequencing and verifying the mutation of the CFAP44 gene, wherein the sample verification conditions such as family inside, family outside, distribution and the like are considered.
Genes of 5 patients and 5 normal persons in the family (i.e., parents of 3 patients, all of them had a disease) were examined.
The method comprises the following specific steps:
DNA extraction:
peripheral venous blood was extracted from 5 patients and 5 normal persons in the family, respectively, and genomic DNA was extracted and DNA content was measured according to the method of example 1.
2. Primer design and PCR reaction
Primer design was referenced to the human genome sequence database hg19, with primer sequences as shown in table 1.
TABLE 1
Figure BDA0001332506450000071
See table 2 for PCR amplification system.
TABLE 2
Figure BDA0001332506450000072
And (3) PCR reaction conditions:
denaturation at 94 ℃ for 5min and then in each cycle, denaturation at 94 ℃ for 30s, annealing (typically 55 ℃ and set according to the annealing temperature of the different primers) for 30s, extension at 72 ℃ for 1min, for a total of 30 cycles. All cycles were completed, final extension at 72 ℃ for 10min, and PCR products were stored at 4 or-20 ℃.
3) The PCR-amplified products obtained in step 2) from 5 MMAF patients and 5 normal persons in the family (i.e., parents of the 5 patients who had no disease) were subjected to direct DNA sequencing in the same manner as in example 1.
Significant mutation sites were detected in the CFAP44 gene in 5 out of 27 MMAF cases collected by the present invention. Meanwhile, the found mutation sites can not be detected in family normal people. The frequency of these mutant sites in the ExAC database was very low or none (see Table 3), suggesting that the detected sites are likely not SNPs. The CFAP44 gene was therefore considered to be a causative gene for MMAF.
TABLE 3
Figure BDA0001332506450000081
Description of sequence listing
1, SEQ ID NO: cDNA sequence of wild-type CFAP44 gene
ATGAAGGAACCAGATGATCAGGATACTGATGGGGAGAAATCAGTTACATCAAAGAGTGATGGGAAGAAGTCTCTGAGGTCTTCTAAATCAGAATCAAGATCTCCTGTTCAAGAAGATAACACATTTTTAGAAGATGACACAGATGAAACATTTACCAAAGGGGAAGGATCATATTTAGAAGAAGACTCAGATGAGGAACGTTTGGAAGGAAGTTTGAGTTCATTTCAGTATGGTGATTTGCAAAGCACTACAGTACCTCAGCAAACCCCTGCTCCAGCTGTGGAAGAAGCAGAGGAGGAAGTTAAGAAGAAAATATCAGAGAGCTTCTTCTATGATTATATGGAGCTTGCTTCGATGCCTTTTGTGACTCTGGATTCAAACATACCACTGGATCTTCTCACACTTGTACATTCTTTTGGTTATGACTGTAGAAAGCGAGCCAACCTACAACTTCTGGACGACAGTATCGCCATATACATAGCTGGGAACCAACTGATCTTTCTGAATTTGAAAACCAAGGAACAGATCTACCTGCGAAGTAGCAGTGGTGAAGGAATTGGCGTCATTGGGGTTCATCCACATAAAACTTATTTCACAGTAGCTGAAAAAGGGAGTTTTCCAGATATTATCATCTATGAATATCCTTCTCTGAGACCATACAGAGTCCTTCGAGATGGGACTGAGAAGGGATATGCTTATGTGGACTTTAACTACAGCGGTAACTTGCTGGCCTCTGTTGGTAGTAACCCTGACTACACACTGACTATCTGGAACTGGAAAGAAGAACAACCCATACTAAGGACAAAAGCTTTTTCTCAGGAAGTTTTTAAGGTTACTTTCAATCCTGATAAGGAAGAGCAGCTTACTACATCGGGATCAGGCCACATCAAGTTCTGGGAAATGGCTTTTACGTTCACCGGTCTCAAGCTGCAGGGATCACTAGGTCGATTTGGCAAAACAATCACTACTGATATAGAAGGCTACATGGAGCTCCCAGATGGGAAGGTGCTCTCAGGGTCAGAATGGGGCAACATGCTGCTTTGGGAAGGTGGTCTGATCAAAGTGGAGCTCTGTCGAGGGACAAGCAAGTCATGTCACAATGGTCCCATTAACCAGATAATGCTGTATGAGGGTGAAGTTATCACTGTTGGGTCAGATGGATATGTTAGGATATGGGATTTTGAGACAATAGACACTGCTGATGTAATAGATGAGACTGGATTGTTGGAGATTGAGCCTATTAATGAACTTCAAGTAGACAAGAATGTGAATCTCTTCTCTATGATAAAAATGAATGAAACTGGAAATAACTTTTGGTTGGCTCAGGATGCCAATGGAGCCATATGGAAGCTTGACCTTAGTTTTTCAAATATTACCCAGGACCCAGAATGCCTCTTCTCCTTCCATTCTGGAGCTATTGAAGCCGTGGCTGTTTCTCCTCTCACTTATCTCATGGCCACAACTGCCTTGGACTGCTCTGTTCGAATCTATGATTTTGCTAGCAAAACTCCTTTGGCCCAGATGAAATTCAAACAAGGAGGTACTGCCCTTGTTTGGGTACCCCGAATGGTAAACTTCACTGGAGCACAAATTATTGTAGGATTTGAAGATGGAGTTGTTCGAATTCTTGAACTTTATGATCCAAAAGGGCTCACGATTTTTGCGGGACGGAAGAAAATTTTGGATGCTGATATTCAGTTGAAACAGGTTTTCAAACCCCATACTGCTTGTGTCACTGCTTTAGCTTATGAACGTGATGGGGAAATTCTAGCCACAGGGAGTAAAGATCAAACTGTTTTCTTCTTTGAAGTGGAAAGGGATTATAAGCCGATTGGTTATATTAATACTCCTGGACCTGTGTGTCAGTTAATGTGGTCTCCCATGTCTCATCCTGAAAGTACTTTACTAATTATCTGTGAAAATGGCTATATTCTTGAAGCTCCACTTCCAACCATAAAGCAAGAAGAGGATGATCATGATGTAGTCTCCTATGAAATCAAAGACATGTGCATAAAATGTTTCCATTTTTCAAGTGTCAAATCTAAGATTCTGAGATTAATAGAAATTGAAAAGAGGGAGAGACAAAGGGAGTTGAAGGAGAAAATAAGGGAAGAAAGGAGGAACAAGCTAGCAGCAGAGATGGGAGAAGATGGAGAAAAAGAATTTCAGGAGGAGGAAGAGGAGAAAGAGGAGGAGGAGGAGGAAGAAGAGCCATTACCTGAAATATTTATTCCGTCAACCCCCTCTCCCATCCTCTGTGGATTTTACTCAGAGCCAGGGAAGTTCTGGGTTTCTTTGGGTGGCTATGATTCTGGTTTTCTATATCACTGTGAGTTCCCCCCTTGTGATGAAAGCAGTGATTTCAAAGAACAAAAAGATGAACCTATTGATGTCCGTTATCTTGCGGATACAGAGGACAATCCCATCCAAACTATCACTTTCAACATTAACAAAGTTATGATGTTTTGTGGAATGAAAAATGGAGCAATTCGAGTCTATGTCCTAAATCAAAATGATCCTTCATTGACCAGTTTGGTGGACTACTGGCACTTCAATATGCATGACAATAATTATGGATGTATTAAAAGTATTGCTAATAGCTTTGATGATCGTTTCTTGGTGACTGCTGGAGCAGATGGCAATATCTTTGTTTTCAACATTTTTTCTGAATTTATGCTAAGGAAAGACATGAAGGCCAAAGTTCCATCTCCCAGGTTTGGAATTGAAACAGAGCCAATTCCAGAAGACATTGAAGATCCCAAAGCCTACAGTATCGAGAATGCTAGGAGAAAAAGAGAACATGACAAGTTAATGAAAGAAGTGGGAGAAATAAAGGCACGGAAGAGAGAGCAAATCAAAGCTTTGAGGAGTGAATTTTGTAATCTATTAGAAATGAATGAAAAATTACCAAAGCATATGCAGTTTAAACGAACAGATTTTGATGTAGATTCCCAAATCCGTGCTGAGATGCACAGAAAAACAGCTTTCAAAATTCAACAAGTGGAAAAGGAATTAGCTTGGGAAAAAGAGAAACATGAACTCGGCCTAATGAAGCTAAAGAATCGATTTCGAGATCCACTGGAAAGTGATACTATTGTGGTTCATGCCATACTGAGTGACCACAAGATATCCTCTTACAGGCTGGTGCAGCCCTCTAAGTACTCCAAATTCAAACGAGCTAGTCAATCAGAGAGAAAACCAAGCAAATTGGACAGGTTTGAAAAAGAGGGACCTGGAAGAAAGGACAGCCAGAGAGATGCAGGTGGGAGTGTTACCATACAAGAAGAATCAATAATAGAAAAAGGGAAGAAATTTCGGCCTAAAACCCTAAGTGAAATCATCGTGGAAAATCAAATTGAGAAAACGAGAAAACTTATATTAAAAGCTGAAAGGGCACAACTAAAGATTCAACAGCGAAAAAAAGAATGGGAGGAACTATACAAGAGTAAACCTGGTGATGACTATGAAGATCCCAAAGATCTTCAAGCCATCAAAGAAGCCCAGGTGTATATGGGAGATTTCAATCTGAAGACAGCCCCAGACTACAAGATACCTGAGCACATGAGAATAAATGCTGCCAAGAAGGAAGAGGAACTAGGACACCTAGATTCTTTGGTCCATGGAAATAAAAGGCACATGAACAAGTGCATTCTCTCTCTTAGAGACCTTAAAGTGGCTGTTGTTGAGGAAATACAGTGCCTGGTACAAGAACTGAAGAACATTCAGTCGACTCTTCACATATCCAAGCACATACCCATTCCCAAAATTCCTCAGATACACCCAGAAGAAGTTCCAGAAAAGAGATTTCAGTATGATGAAGAAACTCTCCTAAATTTTAAGCAACAGCAAATGAAAAGTAAAGATGAAAAGTCCCCCGGAGTGGAACAGACAGGGTCTGGAGGCCCAGTTGGAGGATTCCTCAAACTCTCTTCTAGAAAGGATGGGGATTTGACAACCCGTGATTCAATATCTAGATCATCAAAGGCATCAACATTCAGCCTAGATATACCAAAGTGTTTGGAATTTGAAAAAGCAGAGCCAACGGATGTGGAGCTGGAAATTATGAAGAGAGACGAGATTAAACACGTGTACATGCAACAGTATTTGGTCAACAGGATCAAAGAACTGGTTGTCACTTTCGATGCAGAACTCCGTCTCCTTAGACATCAGAAACTAAAACTAGATACTCAGATGAAATTATCTGACCTGCACCATGTCACCTTATTTCAAGAAATACTTCTCCTGAAGAATTTTGAAAAACAGGAGAACATACTTCAAGAACGTGTTAATTCCTTAGACAAAGAGGAACAGTACATGCAATGGAAAATAAATGAAACTCTTAAAGAGATGGAAGAGAAAAAGAATGAAATCACCAAACTCCAGGAGCAAGAAAAGGCACTCTATGCTGGTTTTCAAGCAGCCATTGGAGAAAACAATAAATTTGCAAACTTCCTCATGAAGGTCCTAAAGAAGAAGATTAAACGGGTAAAGAAAAAAGAAGTTGAAGGAGATGCTGATGAAGATGAGGAGAGTGAGGAATCAAGTGAAGAAGAATCTAGCTTGGAGAGTGATGAAGATGAGTCTGAATCAGAAGATGAGGTTTTTGATGATTCTATTTGCCCAACAAATTGTGATGTGGCTCTTTTTGAGCTGGCCCTTCACCTTCGAGAGAAAAGGCTGGACATTGAGGAGGCTTTAGTTGAAGAAAAGAAAATTGTTGATAACCTCAAAAAGGAATATGATACATTGTCAAAAAAAGTGAAAATTGTGGCAACTAATCTGAATGCAGCAGAGGAGGCCCTGGAGGCTTATCAGCGAGAGAAGCAGCAGCGGCTGAATGAACTGCTAGTTGTGATTCCGCTCAAGCTCCACCAGATAGAGTATGTGGTATTTGGAGAAATACCTAGCGATCTTTCTGGTACTTTGGTCTTCTCTAACCATGCCTTGAGACGGCTGCAAGAACGAATCCATGAGCTCCAGGAGGAAAATTCCAAGCAGCAAAAACTTAACAAAGAATGGAGAGAGAGACGTAAACAGCTCATCCGAGAAAAGAGAGAAATGACAAAAACCATACACAAAATGGAGGAAACAGTCCGGCAGCTCATGATCAGCAAGTTTGGCCGTGTGGTAAATCTAGAAGCCCTTCAAACGCTTTCTGTTAATACAACACTTGAAGAACTGAAGATCAGAAAACTTCGAAAGGAGCTAGCAAATGCGAAAGAGATGAAGATGTGGGAGGAAAAGATTGCTCAAATGCGATGGGAACTGATGATGAAGACAAAAGAACACACCAGAAAGCTTTATCAGATGAATGATTTGTGTATTGAAAAGAAGAAACTTGATTCTCGGTTGAATACACTACAGAATCAGCAGGGCAATGCCTTCCAGGGCCCTCGGGAAGCAGATGTTGTGGCAAGAGAGGAGGTCACTGAATTGATCCAACTCCAGGCGGAAAGGATTTCGGCCTTAAAGGAGGAGATTGCTCTTTTGCGTAGGAAAGGCAGTCTTATCCTCCCACCCATTCAGTCTCCACGAGAGAAAGAGATACAGCCCGCAGACCTTTGA
2, SEQ ID NO: amino acid sequence of wild-type CFAP44 protein
MKEPDDQDTDGEKSVTSKSDGKKSLRSSKSESRSPVQEDNTFLEDDTDETFTKGEGSYLEEDSDEERLEGSLSSFQYGDLQSTTVPQQTPAPAVEEAEEEVKKKISESFFYDYMELASMPFVTLDSNIPLDLLTLVHSFGYDCRKRANLQLLDDSIAIYIAGNQLIFLNLKTKEQIYLRSSSGEGIGVIGVHPHKTYFTVAEKGSFPDIIIYEYPSLRPYRVLRDGTEKGYAYVDFNYSGNLLASVGSNPDYTLTIWNWKEEQPILRTKAFSQEVFKVTFNPDKEEQLTTSGSGHIKFWEMAFTFTGLKLQGSLGRFGKTITTDIEGYMELPDGKVLSGSEWGNMLLWEGGLIKVELCRGTSKSCHNGPINQIMLYEGEVITVGSDGYVRIWDFETIDTADVIDETGLLEIEPINELQVDKNVNLFSMIKMNETGNNFWLAQDANGAIWKLDLSFSNITQDPECLFSFHSGAIEAVAVSPLTYLMATTALDCSVRIYDFASKTPLAQMKFKQGGTALVWVPRMVNFTGAQIIVGFEDGVVRILELYDPKGLTIFAGRKKILDADIQLKQVFKPHTACVTALAYERDGEILATGSKDQTVFFFEVERDYKPIGYINTPGPVCQLMWSPMSHPESTLLIICENGYILEAPLPTIKQEEDDHDVVSYEIKDMCIKCFHFSSVKSKILRLIEIEKRERQRELKEKIREERRNKLAAEMGEDGEKEFQEEEEEKEEEEEEEEPLPEIFIPSTPSPILCGFYSEPGKFWVSLGGYDSGFLYHCEFPPCDESSDFKEQKDEPIDVRYLADTEDNPIQTITFNINKVMMFCGMKNGAIRVYVLNQNDPSLTSLVDYWHFNMHDNNYGCIKSIANSFDDRFLVTAGADGNIFVFNIFSEFMLRKDMKAKVPSPRFGIETEPIPEDIEDPKAYSIENARRKREHDKLMKEVGEIKARKREQIKALRSEFCNLLEMNEKLPKHMQFKRTDFDVDSQIRAEMHRKTAFKIQQVEKELAWEKEKHELGLMKLKNRFRDPLESDTIVVHAILSDHKISSYRLVQPSKYSKFKRASQSERKPSKLDRFEKEGPGRKDSQRDAGGSVTIQEESIIEKGKKFRPKTLSEIIVENQIEKTRKLILKAERAQLKIQQRKKEWEELYKSKPGDDYEDPKDLQAIKEAQVYMGDFNLKTAPDYKIPEHMRINAAKKEEELGHLDSLVHGNKRHMNKCILSLRDLKVAVVEEIQCLVQELKNIQSTLHISKHIPIPKIPQIHPEEVPEKRFQYDEETLLNFKQQQMKSKDEKSPGVEQTGSGGPVGGFLKLSSRKDGDLTTRDSISRSSKASTFSLDIPKCLEFEKAEPTDVELEIMKRDEIKHVYMQQYLVNRIKELVVTFDAELRLLRHQKLKLDTQMKLSDLHHVTLFQEILLLKNFEKQENILQERVNSLDKEEQYMQWKINETLKEMEEKKNEITKLQEQEKALYAGFQAAIGENNKFANFLMKVLKKKIKRVKKKEVEGDADEDEESEESSEEESSLESDEDESESEDEVFDDSICPTNCDVALFELALHLREKRLDIEEALVEEKKIVDNLKKEYDTLSKKVKIVATNLNAAEEALEAYQREKQQRLNELLVVIPLKLHQIEYVVFGEIPSDLSGTLVFSNHALRRLQERIHELQEENSKQQKLNKEWRERRKQLIREKREMTKTIHKMEETVRQLMISKFGRVVNLEALQTLSVNTTLEELKIRKLRKELANAKEMKMWEEKIAQMRWELMMKTKEHTRKLYQMNDLCIEKKKLDSRLNTLQNQQGNAFQGPREADVVAREEVTELIQLQAERISALKEEIALLRRKGSLILPPIQSPREKEIQPADL
11, SEQ ID NO: amino acid sequence of mutant CFAP44 protein (p.d 979;)
MKEPDDQDTDGEKSVTSKSDGKKSLRSSKSESRSPVQEDNTFLEDDTDETFTKGEGSYLEEDSDEERLEGSLSSFQYGDLQSTTVPQQTPAPAVEEAEEEVKKKISESFFYDYMELASMPFVTLDSNIPLDLLTLVHSFGYDCRKRANLQLLDDSIAIYIAGNQLIFLNLKTKEQIYLRSSSGEGIGVIGVHPHKTYFTVAEKGSFPDIIIYEYPSLRPYRVLRDGTEKGYAYVDFNYSGNLLASVGSNPDYTLTIWNWKEEQPILRTKAFSQEVFKVTFNPDKEEQLTTSGSGHIKFWEMAFTFTGLKLQGSLGRFGKTITTDIEGYMELPDGKVLSGSEWGNMLLWEGGLIKVELCRGTSKSCHNGPINQIMLYEGEVITVGSDGYVRIWDFETIDTADVIDETGLLEIEPINELQVDKNVNLFSMIKMNETGNNFWLAQDANGAIWKLDLSFSNITQDPECLFSFHSGAIEAVAVSPLTYLMATTALDCSVRIYDFASKTPLAQMKFKQGGTALVWVPRMVNFTGAQIIVGFEDGVVRILELYDPKGLTIFAGRKKILDADIQLKQVFKPHTACVTALAYERDGEILATGSKDQTVFFFEVERDYKPIGYINTPGPVCQLMWSPMSHPESTLLIICENGYILEAPLPTIKQEEDDHDVVSYEIKDMCIKCFHFSSVKSKILRLIEIEKRERQRELKEKIREERRNKLAAEMGEDGEKEFQEEEEEKEEEEEEEEPLPEIFIPSTPSPILCGFYSEPGKFWVSLGGYDSGFLYHCEFPPCDESSDFKEQKDEPIDVRYLADTEDNPIQTITFNINKVMMFCGMKNGAIRVYVLNQNDPSLTSLVDYWHFNMHDNNYGCIKSIANSFDDRFLVTAGADGNIFVFNIFSEFMLRKDMKAKVPSPRFGIETEPIPEDIEDPKAYSIENARRKREHDKLMKEVGEIKARKREQIKALRSEFCNLLEMNEKLPKHMQFKRT
12, SEQ ID NO: amino acid sequence of mutant CFAP44 protein (p.M669Vfs 13)
MKEPDDQDTDGEKSVTSKSDGKKSLRSSKSESRSPVQEDNTFLEDDTDETFTKGEGSYLEEDSDEERLEGSLSSFQYGDLQSTTVPQQTPAPAVEEAEEEVKKKISESFFYDYMELASMPFVTLDSNIPLDLLTLVHSFGYDCRKRANLQLLDDSIAIYIAGNQLIFLNLKTKEQIYLRSSSGEGIGVIGVHPHKTYFTVAEKGSFPDIIIYEYPSLRPYRVLRDGTEKGYAYVDFNYSGNLLASVGSNPDYTLTIWNWKEEQPILRTKAFSQEVFKVTFNPDKEEQLTTSGSGHIKFWEMAFTFTGLKLQGSLGRFGKTITTDIEGYMELPDGKVLSGSEWGNMLLWEGGLIKVELCRGTSKSCHNGPINQIMLYEGEVITVGSDGYVRIWDFETIDTADVIDETGLLEIEPINELQVDKNVNLFSMIKMNETGNNFWLAQDANGAIWKLDLSFSNITQDPECLFSFHSGAIEAVAVSPLTYLMATTALDCSVRIYDFASKTPLAQMKFKQGGTALVWVPRMVNFTGAQIIVGFEDGVVRILELYDPKGLTIFAGRKKILDADIQLKQVFKPHTACVTALAYERDGEILATGSKDQTVFFFEVERDYKPIGYINTPGPVCQLMWSPMSHPESTLLIICENGYILEAPLPTIKQEEDDHDVVSYEIKDVHKMFPFFKCQI。
Sequence listing
<110> women and children health care institute (family planning service center); subsidiary Beijing women's obstetrical hospital of capital medical university
<120> novel MMAF (MMAF) pathogenic gene and application thereof
<130>2017
<160>1
<170>PatentIn version 3.3
<210>1
<211>5565
<212>DNA
<213>Homo Sapiens
<400>1
atgaaggaac cagatgatca ggatactgat ggggagaaat cagttacatc aaagagtgat 60
gggaagaagt ctctgaggtc ttctaaatca gaatcaagat ctcctgttca agaagataac 120
acatttttag aagatgacac agatgaaaca tttaccaaag gggaaggatc atatttagaa 180
gaagactcag atgaggaacg tttggaagga agtttgagtt catttcagta tggtgatttg 240
caaagcacta cagtacctca gcaaacccct gctccagctg tggaagaagc agaggaggaa 300
gttaagaaga aaatatcaga gagcttcttc tatgattata tggagcttgc ttcgatgcct 360
tttgtgactc tggattcaaa cataccactg gatcttctca cacttgtaca ttcttttggt 420
tatgactgta gaaagcgagc caacctacaa cttctggacg acagtatcgc catatacata 480
gctgggaacc aactgatctt tctgaatttg aaaaccaagg aacagatcta cctgcgaagt 540
agcagtggtg aaggaattgg cgtcattggg gttcatccac ataaaactta tttcacagta 600
gctgaaaaag ggagttttcc agatattatc atctatgaat atccttctct gagaccatac 660
agagtccttc gagatgggac tgagaaggga tatgcttatg tggactttaa ctacagcggt 720
aacttgctgg cctctgttgg tagtaaccct gactacacac tgactatctg gaactggaaa 780
gaagaacaac ccatactaag gacaaaagct ttttctcagg aagtttttaa ggttactttc 840
aatcctgata aggaagagca gcttactaca tcgggatcag gccacatcaa gttctgggaa 900
atggctttta cgttcaccgg tctcaagctg cagggatcac taggtcgatt tggcaaaaca 960
atcactactg atatagaagg ctacatggag ctcccagatg ggaaggtgct ctcagggtca 1020
gaatggggca acatgctgct ttgggaaggt ggtctgatca aagtggagct ctgtcgaggg 1080
acaagcaagt catgtcacaa tggtcccatt aaccagataa tgctgtatga gggtgaagtt 1140
atcactgttg ggtcagatgg atatgttagg atatgggatt ttgagacaat agacactgct 1200
gatgtaatag atgagactgg attgttggag attgagccta ttaatgaact tcaagtagac 1260
aagaatgtga atctcttctc tatgataaaa atgaatgaaa ctggaaataa cttttggttg 1320
gctcaggatg ccaatggagc catatggaag cttgacctta gtttttcaaa tattacccag 1380
gacccagaat gcctcttctc cttccattct ggagctattg aagccgtggc tgtttctcct 1440
ctcacttatc tcatggccac aactgccttg gactgctctg ttcgaatcta tgattttgct 1500
agcaaaactc ctttggccca gatgaaattc aaacaaggag gtactgccct tgtttgggta 1560
ccccgaatgg taaacttcac tggagcacaa attattgtag gatttgaaga tggagttgtt 1620
cgaattcttg aactttatga tccaaaaggg ctcacgattt ttgcgggacg gaagaaaatt 1680
ttggatgctg atattcagtt gaaacaggtt ttcaaacccc atactgcttg tgtcactgct 1740
ttagcttatg aacgtgatgg ggaaattcta gccacaggga gtaaagatca aactgttttc 1800
ttctttgaag tggaaaggga ttataagccg attggttata ttaatactcc tggacctgtg 1860
tgtcagttaa tgtggtctcc catgtctcat cctgaaagta ctttactaat tatctgtgaa 1920
aatggctata ttcttgaagc tccacttcca accataaagc aagaagagga tgatcatgat 1980
gtagtctcct atgaaatcaa agacatgtgc ataaaatgtt tccatttttc aagtgtcaaa 2040
tctaagattc tgagattaat agaaattgaa aagagggaga gacaaaggga gttgaaggag 2100
aaaataaggg aagaaaggag gaacaagcta gcagcagaga tgggagaaga tggagaaaaa 2160
gaatttcagg aggaggaaga ggagaaagag gaggaggagg aggaagaaga gccattacct 2220
gaaatattta ttccgtcaac cccctctccc atcctctgtg gattttactc agagccaggg 2280
aagttctggg tttctttggg tggctatgat tctggttttc tatatcactg tgagttcccc 2340
ccttgtgatg aaagcagtga tttcaaagaa caaaaagatg aacctattga tgtccgttat 2400
cttgcggata cagaggacaa tcccatccaa actatcactt tcaacattaa caaagttatg 2460
atgttttgtg gaatgaaaaa tggagcaatt cgagtctatg tcctaaatca aaatgatcct 2520
tcattgacca gtttggtgga ctactggcac ttcaatatgc atgacaataa ttatggatgt 2580
attaaaagta ttgctaatag ctttgatgat cgtttcttgg tgactgctgg agcagatggc 2640
aatatctttg ttttcaacat tttttctgaa tttatgctaa ggaaagacat gaaggccaaa 2700
gttccatctc ccaggtttgg aattgaaaca gagccaattc cagaagacat tgaagatccc 2760
aaagcctaca gtatcgagaa tgctaggaga aaaagagaac atgacaagtt aatgaaagaa 2820
gtgggagaaa taaaggcacg gaagagagag caaatcaaag ctttgaggag tgaattttgt 2880
aatctattag aaatgaatga aaaattacca aagcatatgc agtttaaacg aacagatttt 2940
gatgtagatt cccaaatccg tgctgagatg cacagaaaaa cagctttcaa aattcaacaa 3000
gtggaaaagg aattagcttg ggaaaaagag aaacatgaac tcggcctaat gaagctaaag 3060
aatcgatttc gagatccact ggaaagtgat actattgtgg ttcatgccat actgagtgac 3120
cacaagatat cctcttacag gctggtgcag ccctctaagt actccaaatt caaacgagct 3180
agtcaatcag agagaaaacc aagcaaattg gacaggtttg aaaaagaggg acctggaaga 3240
aaggacagcc agagagatgc aggtgggagt gttaccatac aagaagaatc aataatagaa 3300
aaagggaaga aatttcggcc taaaacccta agtgaaatca tcgtggaaaa tcaaattgag 3360
aaaacgagaa aacttatatt aaaagctgaa agggcacaac taaagattca acagcgaaaa 3420
aaagaatggg aggaactata caagagtaaa cctggtgatg actatgaaga tcccaaagat 3480
cttcaagcca tcaaagaagc ccaggtgtat atgggagatt tcaatctgaa gacagcccca 3540
gactacaaga tacctgagca catgagaata aatgctgcca agaaggaaga ggaactagga 3600
cacctagatt ctttggtcca tggaaataaa aggcacatga acaagtgcat tctctctctt 3660
agagacctta aagtggctgt tgttgaggaa atacagtgcc tggtacaaga actgaagaac 3720
attcagtcga ctcttcacat atccaagcac atacccattc ccaaaattcc tcagatacac 3780
ccagaagaag ttccagaaaa gagatttcag tatgatgaag aaactctcct aaattttaag 3840
caacagcaaa tgaaaagtaa agatgaaaag tcccccggag tggaacagac agggtctgga 3900
ggcccagttg gaggattcct caaactctct tctagaaagg atggggattt gacaacccgt 3960
gattcaatat ctagatcatc aaaggcatca acattcagcc tagatatacc aaagtgtttg 4020
gaatttgaaa aagcagagcc aacggatgtg gagctggaaa ttatgaagag agacgagatt 4080
aaacacgtgt acatgcaaca gtatttggtc aacaggatca aagaactggt tgtcactttc 4140
gatgcagaac tccgtctcct tagacatcag aaactaaaac tagatactca gatgaaatta 4200
tctgacctgc accatgtcac cttatttcaa gaaatacttc tcctgaagaa ttttgaaaaa 4260
caggagaaca tacttcaaga acgtgttaat tccttagaca aagaggaaca gtacatgcaa 4320
tggaaaataa atgaaactct taaagagatg gaagagaaaa agaatgaaat caccaaactc 4380
caggagcaag aaaaggcact ctatgctggt tttcaagcag ccattggaga aaacaataaa 4440
tttgcaaact tcctcatgaa ggtcctaaag aagaagatta aacgggtaaa gaaaaaagaa 4500
gttgaaggag atgctgatga agatgaggag agtgaggaat caagtgaaga agaatctagc 4560
ttggagagtg atgaagatga gtctgaatca gaagatgagg tttttgatga ttctatttgc 4620
ccaacaaatt gtgatgtggc tctttttgag ctggcccttc accttcgaga gaaaaggctg 4680
gacattgagg aggctttagt tgaagaaaag aaaattgttg ataacctcaa aaaggaatat 4740
gatacattgt caaaaaaagt gaaaattgtg gcaactaatc tgaatgcagc agaggaggcc 4800
ctggaggctt atcagcgaga gaagcagcag cggctgaatg aactgctagt tgtgattccg 4860
ctcaagctcc accagataga gtatgtggta tttggagaaa tacctagcga tctttctggt 4920
actttggtct tctctaacca tgccttgaga cggctgcaag aacgaatcca tgagctccag 4980
gaggaaaatt ccaagcagca aaaacttaac aaagaatgga gagagagacg taaacagctc 5040
atccgagaaa agagagaaat gacaaaaacc atacacaaaa tggaggaaac agtccggcag 5100
ctcatgatca gcaagtttgg ccgtgtggta aatctagaag cccttcaaac gctttctgtt 5160
aatacaacac ttgaagaact gaagatcaga aaacttcgaa aggagctagc aaatgcgaaa 5220
gagatgaaga tgtgggagga aaagattgct caaatgcgat gggaactgat gatgaagaca 5280
aaagaacaca ccagaaagct ttatcagatg aatgatttgt gtattgaaaa gaagaaactt 5340
gattctcggt tgaatacact acagaatcag cagggcaatg ccttccaggg ccctcgggaa 5400
gcagatgttg tggcaagaga ggaggtcact gaattgatcc aactccaggc ggaaaggatt 5460
tcggccttaa aggaggagat tgctcttttg cgtaggaaag gcagtcttat cctcccaccc 5520
attcagtctc cacgagagaa agagatacag cccgcagacc tttga 5565
<210>2
<211>1854
<212>PRT
<213>Homo Sapiens
<400>2
Met Lys Glu Pro Asp Asp Gln Asp Thr Asp Gly Glu Lys Ser Val Thr
1 5 10 15
Ser Lys Ser Asp Gly Lys Lys Ser Leu Arg Ser Ser Lys Ser Glu Ser
20 25 30
Arg Ser Pro Val Gln Glu Asp Asn Thr Phe Leu Glu Asp Asp Thr Asp
35 40 45
Glu Thr Phe Thr Lys Gly Glu Gly Ser Tyr Leu Glu Glu Asp Ser Asp
50 55 60
Glu Glu Arg Leu Glu Gly Ser Leu Ser Ser Phe Gln Tyr Gly Asp Leu
65 70 75 80
Gln Ser Thr Thr Val Pro Gln Gln Thr Pro Ala Pro Ala Val Glu Glu
85 90 95
Ala Glu Glu Glu Val Lys Lys Lys Ile Ser Glu Ser Phe Phe Tyr Asp
100 105 110
Tyr Met Glu Leu Ala Ser Met Pro Phe Val Thr Leu Asp Ser Asn Ile
115 120 125
Pro Leu Asp Leu Leu Thr Leu Val His Ser Phe Gly Tyr Asp Cys Arg
130 135 140
Lys Arg Ala Asn Leu Gln Leu Leu Asp Asp Ser Ile Ala Ile Tyr Ile
145 150 155 160
Ala Gly Asn Gln Leu Ile Phe Leu Asn Leu Lys Thr Lys Glu Gln Ile
165 170 175
Tyr Leu Arg Ser Ser Ser Gly Glu Gly Ile Gly Val Ile Gly Val His
180 185 190
Pro His Lys Thr Tyr Phe Thr Val Ala Glu Lys Gly Ser Phe Pro Asp
195 200 205
Ile Ile Ile Tyr Glu Tyr Pro Ser Leu Arg Pro Tyr Arg Val Leu Arg
210 215 220
Asp Gly Thr Glu Lys Gly Tyr Ala Tyr Val Asp Phe Asn Tyr Ser Gly
225 230 235 240
Asn Leu Leu Ala Ser Val Gly Ser Asn Pro Asp Tyr Thr Leu Thr Ile
245 250 255
Trp Asn Trp Lys Glu Glu Gln Pro Ile Leu Arg Thr Lys Ala Phe Ser
260 265 270
Gln Glu Val Phe Lys Val Thr Phe Asn Pro Asp Lys Glu Glu Gln Leu
275 280 285
Thr Thr Ser Gly Ser Gly His Ile Lys Phe Trp Glu Met Ala Phe Thr
290 295 300
Phe Thr Gly Leu Lys Leu Gln Gly Ser Leu Gly Arg Phe Gly Lys Thr
305 310 315 320
Ile Thr Thr Asp Ile Glu Gly Tyr Met Glu Leu Pro Asp Gly Lys Val
325 330 335
Leu Ser Gly Ser Glu Trp Gly Asn Met Leu Leu Trp Glu Gly Gly Leu
340 345 350
Ile Lys Val Glu Leu Cys Arg Gly Thr Ser Lys Ser Cys His Asn Gly
355 360 365
Pro Ile Asn Gln Ile Met Leu Tyr Glu Gly Glu Val Ile Thr Val Gly
370 375 380
Ser Asp Gly Tyr Val Arg Ile Trp Asp Phe Glu Thr Ile Asp Thr Ala
385 390 395 400
Asp Val Ile Asp Glu Thr Gly Leu Leu Glu Ile Glu Pro Ile Asn Glu
405 410 415
Leu Gln Val Asp Lys Asn Val Asn Leu Phe Ser Met Ile Lys Met Asn
420425 430
Glu Thr Gly Asn Asn Phe Trp Leu Ala Gln Asp Ala Asn Gly Ala Ile
435 440 445
Trp Lys Leu Asp Leu Ser Phe Ser Asn Ile Thr Gln Asp Pro Glu Cys
450 455 460
Leu Phe Ser Phe His Ser Gly Ala Ile Glu Ala Val Ala Val Ser Pro
465 470 475 480
Leu Thr Tyr Leu Met Ala Thr Thr Ala Leu Asp Cys Ser Val Arg Ile
485 490 495
Tyr Asp Phe Ala Ser Lys Thr Pro Leu Ala Gln Met Lys Phe Lys Gln
500 505 510
Gly Gly Thr Ala Leu Val Trp Val Pro Arg Met Val Asn Phe Thr Gly
515 520 525
Ala Gln Ile Ile Val Gly Phe Glu Asp Gly Val Val Arg Ile Leu Glu
530 535 540
Leu Tyr Asp Pro Lys Gly Leu Thr Ile Phe Ala Gly Arg Lys Lys Ile
545 550 555 560
Leu Asp Ala Asp Ile Gln Leu Lys Gln Val Phe Lys Pro His Thr Ala
565 570 575
Cys Val Thr Ala Leu Ala Tyr Glu Arg Asp Gly Glu Ile Leu Ala Thr
580585 590
Gly Ser Lys Asp Gln Thr Val Phe Phe Phe Glu Val Glu Arg Asp Tyr
595 600 605
Lys Pro Ile Gly Tyr Ile Asn Thr Pro Gly Pro Val Cys Gln Leu Met
610 615 620
Trp Ser Pro Met Ser His Pro Glu Ser Thr Leu Leu Ile Ile Cys Glu
625 630 635 640
Asn Gly Tyr Ile Leu Glu Ala Pro Leu Pro Thr Ile Lys Gln Glu Glu
645 650 655
Asp Asp His Asp Val Val Ser Tyr Glu Ile Lys Asp Met Cys Ile Lys
660 665 670
Cys Phe His Phe Ser Ser Val Lys Ser Lys Ile Leu Arg Leu Ile Glu
675 680 685
Ile Glu Lys Arg Glu Arg Gln Arg Glu Leu Lys Glu Lys Ile Arg Glu
690 695 700
Glu Arg Arg Asn Lys Leu Ala Ala Glu Met Gly Glu Asp Gly Glu Lys
705 710 715 720
Glu Phe Gln Glu Glu Glu Glu Glu Lys Glu Glu Glu Glu Glu Glu Glu
725 730 735
Glu Pro Leu Pro Glu Ile Phe Ile Pro Ser Thr Pro Ser Pro Ile Leu
740745 750
Cys Gly Phe Tyr Ser Glu Pro Gly Lys Phe Trp Val Ser Leu Gly Gly
755 760 765
Tyr Asp Ser Gly Phe Leu Tyr His Cys Glu Phe Pro Pro Cys Asp Glu
770 775 780
Ser Ser Asp Phe Lys Glu Gln Lys Asp Glu Pro Ile Asp Val Arg Tyr
785 790 795 800
Leu Ala Asp Thr Glu Asp Asn Pro Ile Gln Thr Ile Thr Phe Asn Ile
805 810 815
Asn Lys Val Met Met Phe Cys Gly Met Lys Asn Gly Ala Ile Arg Val
820 825 830
Tyr Val Leu Asn Gln Asn Asp Pro Ser Leu Thr Ser Leu Val Asp Tyr
835 840 845
Trp His Phe Asn Met His Asp Asn Asn Tyr Gly Cys Ile Lys Ser Ile
850 855 860
Ala Asn Ser Phe Asp Asp Arg Phe Leu Val Thr Ala Gly Ala Asp Gly
865 870 875 880
Asn Ile Phe Val Phe Asn Ile Phe Ser Glu Phe Met Leu Arg Lys Asp
885 890 895
Met Lys Ala Lys Val Pro Ser Pro Arg Phe Gly Ile Glu Thr Glu Pro
900 905910
Ile Pro Glu Asp Ile Glu Asp Pro Lys Ala Tyr Ser Ile Glu Asn Ala
915 920 925
Arg Arg Lys Arg Glu His Asp Lys Leu Met Lys Glu Val Gly Glu Ile
930 935 940
Lys Ala Arg Lys Arg Glu Gln Ile Lys Ala Leu Arg Ser Glu Phe Cys
945 950 955 960
Asn Leu Leu Glu Met Asn Glu Lys Leu Pro Lys His Met Gln Phe Lys
965 970 975
Arg Thr Asp Phe Asp Val Asp Ser Gln Ile Arg Ala Glu Met His Arg
980 985 990
Lys Thr Ala Phe Lys Ile Gln Gln Val Glu Lys Glu Leu Ala Trp Glu
995 1000 1005
Lys Glu Lys His Glu Leu Gly Leu Met Lys Leu Lys Asn Arg Phe
1010 1015 1020
Arg Asp Pro Leu Glu Ser Asp Thr Ile Val Val His Ala Ile Leu
1025 1030 1035
Ser Asp His Lys Ile Ser Ser Tyr Arg Leu Val Gln Pro Ser Lys
1040 1045 1050
Tyr Ser Lys Phe Lys Arg Ala Ser Gln Ser Glu Arg Lys Pro Ser
1055 1060 1065
Lys Leu Asp Arg Phe Glu Lys Glu Gly Pro Gly Arg Lys Asp Ser
1070 1075 1080
Gln Arg Asp Ala Gly Gly Ser Val Thr Ile Gln Glu Glu Ser Ile
1085 1090 1095
Ile Glu Lys Gly Lys Lys Phe Arg Pro Lys Thr Leu Ser Glu Ile
1100 1105 1110
Ile Val Glu Asn Gln Ile Glu Lys Thr Arg Lys Leu Ile Leu Lys
1115 1120 1125
Ala Glu Arg Ala Gln Leu Lys Ile Gln Gln Arg Lys Lys Glu Trp
1130 1135 1140
Glu Glu Leu Tyr Lys Ser Lys Pro Gly Asp Asp Tyr Glu Asp Pro
1145 1150 1155
Lys Asp Leu Gln Ala Ile Lys Glu Ala Gln Val Tyr Met Gly Asp
1160 1165 1170
Phe Asn Leu Lys Thr Ala Pro Asp Tyr Lys Ile Pro Glu His Met
1175 1180 1185
Arg Ile Asn Ala Ala Lys Lys Glu Glu Glu Leu Gly His Leu Asp
1190 1195 1200
Ser Leu Val His Gly Asn Lys Arg His Met Asn Lys Cys Ile Leu
1205 1210 1215
Ser Leu Arg Asp Leu Lys Val Ala Val Val Glu Glu Ile Gln Cys
12201225 1230
Leu Val Gln Glu Leu Lys Asn Ile Gln Ser Thr Leu His Ile Ser
1235 1240 1245
Lys His Ile Pro Ile Pro Lys Ile Pro Gln Ile His Pro Glu Glu
1250 1255 1260
Val Pro Glu Lys Arg Phe Gln Tyr Asp Glu Glu Thr Leu Leu Asn
1265 1270 1275
Phe Lys Gln Gln Gln Met Lys Ser Lys Asp Glu Lys Ser Pro Gly
1280 1285 1290
Val Glu Gln Thr Gly Ser Gly Gly Pro Val Gly Gly Phe Leu Lys
1295 1300 1305
Leu Ser Ser Arg Lys Asp Gly Asp Leu Thr Thr Arg Asp Ser Ile
1310 1315 1320
Ser Arg Ser Ser Lys Ala Ser Thr Phe Ser Leu Asp Ile Pro Lys
1325 1330 1335
Cys Leu Glu Phe Glu Lys Ala Glu Pro Thr Asp Val Glu Leu Glu
1340 1345 1350
Ile Met Lys Arg Asp Glu Ile Lys His Val Tyr Met Gln Gln Tyr
1355 1360 1365
Leu Val Asn Arg Ile Lys Glu Leu Val Val Thr Phe Asp Ala Glu
1370 1375 1380
Leu Arg Leu Leu Arg His Gln Lys Leu LysLeu Asp Thr Gln Met
1385 1390 1395
Lys Leu Ser Asp Leu His His Val Thr Leu Phe Gln Glu Ile Leu
1400 1405 1410
Leu Leu Lys Asn Phe Glu Lys Gln Glu Asn Ile Leu Gln Glu Arg
1415 1420 1425
Val Asn Ser Leu Asp Lys Glu Glu Gln Tyr Met Gln Trp Lys Ile
1430 1435 1440
Asn Glu Thr Leu Lys Glu Met Glu Glu Lys Lys Asn Glu Ile Thr
1445 1450 1455
Lys Leu Gln Glu Gln Glu Lys Ala Leu Tyr Ala Gly Phe Gln Ala
1460 1465 1470
Ala Ile Gly Glu Asn Asn Lys Phe Ala Asn Phe Leu Met Lys Val
1475 1480 1485
Leu Lys Lys Lys Ile Lys Arg Val Lys Lys Lys Glu Val Glu Gly
1490 1495 1500
Asp Ala Asp Glu Asp Glu Glu Ser Glu Glu Ser Ser Glu Glu Glu
1505 1510 1515
Ser Ser Leu Glu Ser Asp Glu Asp Glu Ser Glu Ser Glu Asp Glu
1520 1525 1530
Val Phe Asp Asp Ser Ile Cys Pro Thr Asn Cys Asp Val Ala Leu
1535 1540 1545
Phe Glu Leu Ala Leu His Leu Arg Glu Lys Arg Leu Asp Ile Glu
1550 1555 1560
Glu Ala Leu Val Glu Glu Lys Lys Ile Val Asp Asn Leu Lys Lys
1565 1570 1575
Glu Tyr Asp Thr Leu Ser Lys Lys Val Lys Ile Val Ala Thr Asn
1580 1585 1590
Leu Asn Ala Ala Glu Glu Ala Leu Glu Ala Tyr Gln Arg Glu Lys
1595 1600 1605
Gln Gln Arg Leu Asn Glu Leu Leu Val Val Ile Pro Leu Lys Leu
1610 1615 1620
His Gln Ile Glu Tyr Val Val Phe Gly Glu Ile Pro Ser Asp Leu
1625 1630 1635
Ser Gly Thr Leu Val Phe Ser Asn His Ala Leu Arg Arg Leu Gln
1640 1645 1650
Glu Arg Ile His Glu Leu Gln Glu Glu Asn Ser Lys Gln Gln Lys
1655 1660 1665
Leu Asn Lys Glu Trp Arg Glu Arg Arg Lys Gln Leu Ile Arg Glu
1670 1675 1680
Lys Arg Glu Met Thr Lys Thr Ile His Lys Met Glu Glu Thr Val
1685 1690 1695
Arg Gln Leu Met Ile Ser Lys Phe Gly Arg Val Val Asn Leu Glu
1700 1705 1710
Ala Leu Gln Thr Leu Ser Val Asn Thr Thr Leu Glu Glu Leu Lys
1715 1720 1725
Ile Arg Lys Leu Arg Lys Glu Leu Ala Asn Ala Lys Glu Met Lys
1730 1735 1740
Met Trp Glu Glu Lys Ile Ala Gln Met Arg Trp Glu Leu Met Met
1745 1750 1755
Lys Thr Lys Glu His Thr Arg Lys Leu Tyr Gln Met Asn Asp Leu
1760 1765 1770
Cys Ile Glu Lys Lys Lys Leu Asp Ser Arg Leu Asn Thr Leu Gln
1775 1780 1785
Asn Gln Gln Gly Asn Ala Phe Gln Gly Pro Arg Glu Ala Asp Val
1790 1795 1800
Val Ala Arg Glu Glu Val Thr Glu Leu Ile Gln Leu Gln Ala Glu
1805 1810 1815
Arg Ile Ser Ala Leu Lys Glu Glu Ile Ala Leu Leu Arg Arg Lys
1820 1825 1830
Gly Ser Leu Ile Leu Pro Pro Ile Gln Ser Pro Arg Glu Lys Glu
1835 1840 1845
Ile Gln Pro Ala Asp Leu
1850
<210>3
<211>20
<212>DNA
<213> Artificial sequence
<400>3
tcgaggtcag ccttctttgt 20
<210>4
<211>20
<212>DNA
<213> Artificial sequence
<400>4
caactagcat ggtccccagt 20
<210>5
<211>20
<212>DNA
<213> Artificial sequence
<400>5
aactgaggca agtgctgtga 20
<210>6
<211>20
<212>DNA
<213> Artificial sequence
<400>6
tgcacagaaa gctcaggaaa 20
<210>7
<211>20
<212>DNA
<213> Artificial sequence
<400>7
tttcatgaca tcctggttgg 20
<210>8
<211>20
<212>DNA
<213> Artificial sequence
<400>8
acagcagcat ccagtcctct 20
<210>9
<211>20
<212>DNA
<213> Artificial sequence
<400>9
gcagagtttc cttggcagtc 20
<210>10
<211>20
<212>DNA
<213> Artificial sequence
<400>10
ttccagcctt tattgccatc 20
<210>11
<211>978
<212>PRT
<213>Homo Sapiens
<400>11
Met Lys Glu Pro Asp Asp Gln Asp Thr Asp Gly Glu Lys Ser Val Thr
1 5 10 15
Ser Lys Ser Asp Gly Lys Lys Ser Leu Arg Ser Ser Lys Ser Glu Ser
20 25 30
Arg Ser Pro Val Gln Glu Asp Asn Thr Phe Leu Glu Asp Asp Thr Asp
35 40 45
Glu Thr Phe Thr Lys Gly Glu Gly Ser Tyr Leu Glu Glu Asp Ser Asp
50 55 60
Glu Glu Arg Leu Glu Gly Ser Leu Ser Ser Phe Gln Tyr Gly Asp Leu
65 70 75 80
Gln Ser Thr Thr Val Pro Gln Gln Thr Pro Ala Pro Ala Val Glu Glu
85 90 95
Ala Glu Glu Glu Val Lys Lys Lys Ile Ser Glu Ser Phe Phe Tyr Asp
100 105 110
Tyr Met Glu Leu Ala Ser Met Pro Phe Val Thr Leu Asp Ser Asn Ile
115 120 125
Pro Leu Asp Leu Leu Thr Leu Val His Ser Phe Gly Tyr Asp Cys Arg
130 135 140
Lys Arg Ala Asn Leu Gln Leu Leu Asp Asp Ser Ile Ala Ile Tyr Ile
145 150 155 160
Ala Gly Asn Gln Leu Ile Phe Leu Asn Leu Lys Thr Lys Glu Gln Ile
165 170 175
Tyr Leu Arg Ser Ser Ser Gly Glu Gly Ile Gly Val Ile Gly Val His
180 185 190
Pro His Lys Thr Tyr Phe Thr Val Ala Glu Lys Gly Ser Phe Pro Asp
195 200 205
Ile Ile Ile Tyr Glu Tyr Pro Ser Leu Arg Pro Tyr Arg Val Leu Arg
210 215 220
Asp Gly Thr Glu Lys Gly Tyr Ala Tyr Val Asp Phe Asn Tyr Ser Gly
225 230 235 240
Asn Leu Leu Ala Ser Val Gly Ser Asn Pro Asp Tyr Thr Leu Thr Ile
245 250 255
Trp Asn Trp Lys Glu Glu Gln Pro Ile Leu Arg Thr Lys Ala Phe Ser
260 265 270
Gln Glu Val Phe Lys Val Thr Phe Asn Pro Asp Lys Glu Glu Gln Leu
275 280 285
Thr Thr Ser Gly Ser Gly His Ile Lys Phe Trp Glu Met Ala Phe Thr
290 295 300
Phe Thr Gly Leu Lys Leu Gln Gly Ser Leu Gly Arg Phe Gly Lys Thr
305 310 315 320
Ile Thr Thr Asp Ile Glu Gly Tyr Met Glu Leu Pro Asp Gly Lys Val
325 330 335
Leu Ser Gly Ser Glu Trp Gly Asn Met Leu Leu Trp Glu Gly Gly Leu
340 345 350
Ile Lys Val Glu Leu Cys Arg Gly Thr Ser Lys Ser Cys His Asn Gly
355 360 365
Pro Ile Asn Gln Ile Met Leu Tyr Glu Gly Glu Val Ile Thr Val Gly
370 375 380
Ser Asp Gly Tyr Val Arg Ile Trp Asp Phe Glu Thr Ile Asp Thr Ala
385 390 395 400
Asp Val Ile Asp Glu Thr Gly Leu Leu Glu Ile Glu Pro Ile Asn Glu
405 410 415
Leu Gln Val Asp Lys Asn Val Asn Leu Phe Ser Met Ile Lys Met Asn
420 425 430
Glu Thr Gly Asn Asn Phe Trp Leu Ala Gln Asp Ala Asn Gly Ala Ile
435 440 445
Trp Lys Leu Asp Leu Ser Phe Ser Asn Ile Thr Gln Asp Pro Glu Cys
450 455 460
Leu Phe Ser Phe His Ser Gly Ala Ile Glu Ala Val Ala Val Ser Pro
465 470 475 480
Leu Thr Tyr Leu Met Ala Thr Thr Ala Leu Asp Cys Ser Val Arg Ile
485 490 495
Tyr Asp Phe Ala Ser Lys Thr Pro Leu Ala Gln Met Lys Phe Lys Gln
500 505 510
Gly Gly Thr Ala Leu Val Trp Val Pro Arg Met Val Asn Phe Thr Gly
515 520 525
Ala Gln Ile Ile Val Gly Phe Glu Asp Gly Val Val Arg Ile Leu Glu
530 535 540
Leu Tyr Asp Pro Lys Gly Leu Thr Ile Phe Ala Gly Arg Lys Lys Ile
545 550 555 560
Leu Asp Ala Asp Ile Gln Leu Lys Gln Val Phe Lys Pro His Thr Ala
565 570 575
Cys Val Thr Ala Leu Ala Tyr Glu Arg Asp Gly Glu Ile Leu Ala Thr
580 585 590
Gly Ser Lys Asp Gln Thr Val Phe Phe Phe Glu Val Glu Arg Asp Tyr
595 600 605
Lys Pro Ile Gly Tyr Ile Asn Thr Pro Gly Pro Val Cys Gln Leu Met
610 615 620
Trp Ser Pro Met Ser His Pro Glu Ser Thr Leu Leu Ile Ile Cys Glu
625 630 635 640
Asn Gly Tyr Ile Leu Glu Ala Pro Leu Pro Thr Ile Lys Gln Glu Glu
645 650 655
Asp Asp His Asp Val Val Ser Tyr Glu Ile Lys Asp Met Cys Ile Lys
660 665 670
Cys Phe His Phe Ser Ser Val Lys Ser Lys Ile Leu Arg Leu Ile Glu
675 680 685
Ile Glu Lys Arg Glu Arg Gln Arg Glu Leu Lys Glu Lys Ile Arg Glu
690 695 700
Glu Arg Arg Asn Lys Leu Ala Ala Glu Met Gly Glu Asp Gly Glu Lys
705 710 715 720
Glu Phe Gln Glu Glu Glu Glu Glu Lys Glu Glu Glu Glu Glu Glu Glu
725 730 735
Glu Pro Leu Pro Glu Ile Phe Ile Pro Ser Thr Pro Ser Pro Ile Leu
740 745 750
Cys Gly Phe Tyr Ser Glu Pro Gly Lys Phe Trp Val Ser Leu Gly Gly
755 760 765
Tyr Asp Ser Gly Phe Leu Tyr His Cys Glu Phe Pro Pro Cys Asp Glu
770 775 780
Ser Ser Asp Phe Lys Glu Gln Lys Asp Glu Pro Ile Asp Val Arg Tyr
785 790 795 800
Leu Ala Asp Thr Glu Asp Asn Pro Ile Gln Thr Ile Thr Phe Asn Ile
805 810 815
Asn Lys Val Met Met Phe Cys Gly Met Lys Asn Gly Ala Ile Arg Val
820 825 830
Tyr Val Leu Asn Gln Asn Asp Pro Ser Leu Thr Ser Leu Val Asp Tyr
835 840 845
Trp His Phe Asn Met His Asp Asn Asn Tyr Gly Cys Ile Lys Ser Ile
850 855 860
Ala Asn Ser Phe Asp Asp Arg Phe Leu Val Thr Ala Gly Ala Asp Gly
865 870 875 880
Asn Ile Phe Val Phe Asn Ile Phe Ser Glu Phe Met Leu Arg Lys Asp
885 890 895
Met Lys Ala Lys Val Pro Ser Pro Arg Phe Gly Ile Glu Thr Glu Pro
900 905 910
Ile Pro Glu Asp Ile Glu Asp Pro Lys Ala Tyr Ser Ile Glu Asn Ala
915 920 925
Arg Arg Lys Arg Glu His Asp Lys Leu Met Lys Glu Val Gly Glu Ile
930 935 940
Lys Ala Arg Lys Arg Glu Gln Ile Lys Ala Leu Arg Ser Glu Phe Cys
945 950 955 960
Asn Leu Leu Glu Met Asn Glu Lys Leu Pro Lys His Met Gln Phe Lys
965 970 975
Arg Thr
<210>12
<211>680
<212>PRT
<213>Homo Sapiens
<400>12
Met Lys Glu Pro Asp Asp Gln Asp Thr Asp Gly Glu Lys Ser Val Thr
1 5 10 15
Ser Lys Ser Asp Gly Lys Lys Ser Leu Arg Ser Ser Lys Ser Glu Ser
20 25 30
Arg Ser Pro Val Gln Glu Asp Asn Thr Phe Leu Glu Asp Asp Thr Asp
35 40 45
Glu Thr Phe Thr Lys Gly Glu Gly Ser Tyr Leu Glu Glu Asp Ser Asp
50 55 60
Glu Glu Arg Leu Glu Gly Ser Leu Ser Ser Phe Gln Tyr Gly Asp Leu
65 70 75 80
Gln Ser Thr Thr Val Pro Gln Gln Thr Pro Ala Pro Ala Val Glu Glu
85 90 95
Ala Glu Glu Glu Val Lys Lys Lys Ile Ser Glu Ser Phe Phe Tyr Asp
100 105 110
Tyr Met Glu Leu Ala Ser Met Pro Phe Val Thr Leu Asp Ser Asn Ile
115 120 125
Pro Leu Asp Leu Leu Thr Leu Val His Ser Phe Gly Tyr Asp Cys Arg
130 135 140
Lys Arg Ala Asn Leu Gln Leu Leu Asp Asp Ser Ile Ala Ile Tyr Ile
145 150 155 160
Ala Gly Asn Gln Leu Ile Phe Leu Asn Leu Lys Thr Lys Glu Gln Ile
165 170 175
Tyr Leu Arg Ser Ser Ser Gly Glu Gly Ile Gly Val Ile Gly Val His
180 185 190
Pro His Lys Thr Tyr Phe Thr Val Ala Glu Lys Gly Ser Phe Pro Asp
195 200 205
Ile Ile Ile Tyr Glu Tyr Pro Ser Leu Arg Pro Tyr Arg Val Leu Arg
210 215 220
Asp Gly Thr Glu Lys Gly Tyr Ala Tyr Val Asp Phe Asn Tyr Ser Gly
225 230 235 240
Asn Leu Leu Ala Ser Val Gly Ser Asn Pro Asp Tyr Thr Leu Thr Ile
245 250 255
Trp Asn Trp Lys Glu Glu Gln Pro Ile Leu Arg Thr Lys Ala Phe Ser
260 265 270
Gln Glu Val Phe Lys Val Thr Phe Asn Pro Asp Lys Glu Glu Gln Leu
275 280 285
Thr Thr Ser Gly Ser Gly His Ile Lys Phe Trp Glu Met Ala Phe Thr
290 295 300
Phe Thr Gly Leu Lys Leu Gln Gly Ser Leu Gly Arg Phe Gly Lys Thr
305 310 315 320
Ile Thr Thr Asp Ile Glu Gly Tyr Met Glu Leu Pro Asp Gly Lys Val
325 330 335
Leu Ser Gly Ser Glu Trp Gly Asn Met Leu Leu Trp Glu Gly Gly Leu
340 345 350
Ile Lys Val Glu Leu Cys Arg Gly Thr Ser Lys Ser Cys His Asn Gly
355 360 365
Pro Ile Asn Gln Ile Met Leu Tyr Glu Gly Glu Val Ile Thr Val Gly
370 375 380
Ser Asp Gly Tyr Val Arg Ile Trp Asp Phe Glu Thr Ile Asp Thr Ala
385 390 395 400
Asp Val Ile Asp Glu Thr Gly Leu Leu Glu Ile Glu Pro Ile Asn Glu
405 410 415
Leu Gln Val Asp Lys Asn Val Asn Leu Phe Ser Met Ile Lys Met Asn
420 425 430
Glu Thr Gly Asn Asn Phe Trp Leu Ala Gln Asp Ala Asn Gly Ala Ile
435 440 445
Trp Lys Leu Asp Leu Ser Phe Ser Asn Ile Thr Gln Asp Pro Glu Cys
450 455 460
Leu Phe Ser Phe His Ser Gly Ala Ile Glu Ala Val Ala Val Ser Pro
465 470 475 480
Leu Thr Tyr Leu Met Ala Thr Thr Ala Leu Asp Cys Ser Val Arg Ile
485 490 495
Tyr Asp Phe Ala Ser Lys Thr Pro Leu Ala Gln Met Lys Phe Lys Gln
500 505 510
Gly Gly Thr Ala Leu Val Trp Val Pro Arg Met Val Asn Phe Thr Gly
515 520 525
Ala Gln Ile Ile Val Gly Phe Glu Asp Gly Val Val Arg Ile Leu Glu
530 535 540
Leu Tyr Asp Pro Lys Gly Leu Thr Ile Phe Ala Gly Arg Lys Lys Ile
545 550 555 560
Leu Asp Ala Asp Ile Gln Leu Lys Gln Val Phe Lys Pro His Thr Ala
565 570 575
Cys Val Thr Ala Leu Ala Tyr Glu Arg Asp Gly Glu Ile Leu Ala Thr
580 585 590
Gly Ser Lys Asp Gln Thr Val Phe Phe Phe Glu Val Glu Arg Asp Tyr
595 600 605
Lys Pro Ile Gly Tyr Ile Asn Thr Pro Gly Pro Val Cys Gln Leu Met
610 615 620
Trp Ser Pro Met Ser His Pro Glu Ser Thr Leu Leu Ile Ile Cys Glu
625 630 635 640
Asn Gly Tyr Ile Leu Glu Ala Pro Leu Pro Thr Ile Lys Gln Glu Glu
645 650 655
Asp Asp His Asp Val Val Ser Tyr Glu Ile Lys Asp Val His Lys Met
660 665 670
Phe Pro Phe Phe Lys Cys Gln Ile
675 680

Claims (5)

  1. A biomarker for MMAF characterized by the mutated CFAP44 gene or CFAP44 protein, said biomarker being one of the mutated CFAP44 gene or CFAP44 protein selected from the group consisting of:
    missense mutations in exon 14 (c.1769T > A; p.L590Q);
    a nonsense mutation in exon 22 (c.2935_2944 del; p.D979);
    missense mutations in exon 23 (c.3262G > A; p.G1088S);
    missense mutations in exon 14 (c.1718C > A; p.P573H);
    frame-shift mutations in exon 16 (c.2005_2006 del; p.M669Vfs 13).
  2. 2. A mutated CFAP44 gene, characterized by one of the following mutations in the sequence of SEQ ID NO: 1:
    a missense mutation in exon 14 (c.1769T > A);
    a nonsense mutation in exon 22 (c.2935 — 2944 del);
    a missense mutation in exon 23 (c.3262g > a);
    missense mutation in exon 14 (c.1718c > a);
    a frameshift mutation in exon 16 (c.2005_2006 del).
  3. 3. A mutant CFAP44 protein characterized by one of the following mutations in the sequence of SEQ ID NO: 2:
    missense mutation in exon 14 (p.l590q);
    nonsense mutations in exon 22 (p.d 979);
    missense mutation in exon 23 (p.g1088s);
    missense mutation in exon 14 (p.p573h);
    a frameshift mutation in exon 16 (p.M669Vfs 13).
  4. 4. A mutant CFAP44 protein characterized by having a nonsense mutation in exon 22 (p.d 979) in the sequence of SEQ ID No. 2, said mutant CFAP44 protein sequence being SEQ ID No. 11;
    the mutant CFAP44 protein is a sequence shown in SEQ ID NO. 2 and has a frame shift mutation (p.M669Vfs 13) in an exon 16, and the sequence of the mutant CFAP44 protein is SEQ ID NO. 12.
  5. 5. The kit for detecting the mutant CFAP44 gene or CFAP44 protein is characterized by comprising at least one group of primers selected from the following group:
    3 and 4;
    5 and 6 SEQ ID NO;
    7 and 8 SEQ ID NO;
    SEQ ID NO 9 and SEQ ID NO 10.
CN201710495512.3A 2017-06-26 2017-06-26 MMAF novel pathogenic gene and application thereof Active CN107176994B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710495512.3A CN107176994B (en) 2017-06-26 2017-06-26 MMAF novel pathogenic gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710495512.3A CN107176994B (en) 2017-06-26 2017-06-26 MMAF novel pathogenic gene and application thereof

Publications (2)

Publication Number Publication Date
CN107176994A CN107176994A (en) 2017-09-19
CN107176994B true CN107176994B (en) 2020-04-24

Family

ID=59845273

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710495512.3A Active CN107176994B (en) 2017-06-26 2017-06-26 MMAF novel pathogenic gene and application thereof

Country Status (1)

Country Link
CN (1) CN107176994B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107475423B (en) * 2017-09-22 2020-02-14 厦门市妇幼保健院（厦门市计划生育服务中心） New pathogenic gene of headless spermatozoon disease and application thereof
CN107523628B (en) * 2017-09-22 2020-02-14 厦门市妇幼保健院（厦门市计划生育服务中心） MMAF (MMAF-mediated acute respiratory syndrome) pathogenic new gene and application thereof
CN107475420A (en) * 2017-09-22 2017-12-15 厦门市妇幼保健院（厦门市计划生育服务中心） The pathogenic new gene of sperm disease without a head and its application

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Biallelic Mutations in CFAP43 and CFAP44Cause Male Infertility with Multiple MorphologicalAbnormalities of the Sperm Flagella;Tang, Shuyan;《AMERICAN JOURNAL OF HUMAN GENETICS》;20170601;第100卷(第6期);第854-864页 *
WD repeat domain 52 isoform 1 [Homo sapiens];Strausberg,R.L.;《GenBank》;20090829;第1-2页 *
中国专家发现男性不育新致病基因;中国新闻网;《上海医药》;20170610;第38卷(第11期);第59页 *

Also Published As

Publication number Publication date
CN107176994A (en) 2017-09-19

Similar Documents

Publication Publication Date Title
Veltsos et al. Early sex-chromosome evolution in the diploid dioecious plant Mercurialis annua
CN107176994B (en) MMAF novel pathogenic gene and application thereof
KR20190025814A (en) Detection of chromosome interactions associated with breast cancer
CN107164520A (en) A kind of new Disease-causing gene of severe asthenospermia and its application
CN104120133A (en) Gene mutant and application thereof
CN111423503B (en) Novel mutant protein related to long QT syndrome, novel mutant gene and application thereof
CN102618549A (en) NCSTN mutant gene, and its identification method and tool
AU2016351311B2 (en) SCAP gene mutant and the application thereof
CN108004313B (en) Early-onset coronary heart disease pathogenic gene, reagent, preparation or kit for in vitro detection of early-onset coronary heart disease pathogenic gene and application of early-onset coronary heart disease pathogenic gene
CN104745592B (en) CYP4V2 gene mutant and application thereof
CN107523628B (en) MMAF (MMAF-mediated acute respiratory syndrome) pathogenic new gene and application thereof
CN107475423B (en) New pathogenic gene of headless spermatozoon disease and application thereof
KR101985864B1 (en) Composition for detecting Breast Cancer and Ovarian Cancer and uses thereof
Prinsley et al. The genetics of cholesteatoma study. Loss‐of‐function variants in an affected family
CN108504660A (en) ADCY10 gene mutation bodies and its application
CN107475420A (en) The pathogenic new gene of sperm disease without a head and its application
CN112442528B (en) LOXHD1 gene mutant and application thereof
CN109097465B (en) Application of SNP (single nucleotide polymorphism) site of CLIP3 gene
JPH11510059A (en) Genetic diagnostic co-dominance test
CN109134639B (en) Nucleic acid related to tuberous sclerosis type 2 and application thereof
Sha et al. Use of targeted sequence capture and high-throughput sequencing identifies a novel PKD1 mutation involved in adult polycystic kidney disease
CN110628898A (en) BAZ1B susceptibility SNP locus detection reagent and kit prepared by same
CN107523629A (en) Sperm disease Disease-causing gene new mutation without a head and its application
CN117471107B (en) HR mutant gene, protein, reagent and kit for detecting congenital hairless disease and application thereof
CN105802974B (en) BCS1L gene mutant and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant