CN107523628B - MMAF (MMAF-mediated acute respiratory syndrome) pathogenic new gene and application thereof - Google Patents
MMAF (MMAF-mediated acute respiratory syndrome) pathogenic new gene and application thereof Download PDFInfo
- Publication number
- CN107523628B CN107523628B CN201710866969.0A CN201710866969A CN107523628B CN 107523628 B CN107523628 B CN 107523628B CN 201710866969 A CN201710866969 A CN 201710866969A CN 107523628 B CN107523628 B CN 107523628B
- Authority
- CN
- China
- Prior art keywords
- leu
- glu
- lys
- ser
- val
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
- G01N2333/47—Assays involving proteins of known structure or function as defined in the subgroups
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/36—Gynecology or obstetrics
- G01N2800/367—Infertility, e.g. sperm disorder, ovulatory dysfunction
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Biomedical Technology (AREA)
- Urology & Nephrology (AREA)
- Microbiology (AREA)
- Pathology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Hematology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cell Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Peptides Or Proteins (AREA)
Abstract
A new MMAF pathogenic gene and application thereof relate to markers of various morphological abnormal diseases at the tail of a sperm and application thereof. More specifically, a new MMAF pathogenic gene CFAP43 is found for the first time through large-scale whole exome sequencing screening. The MMAF multiple diseased families and diseased individuals are taken as research objects, exome sequencing and comparison are carried out on the diseased individuals in the families, and different gene mutations of CFAP43 genes of different patients are found. The mutations can be used for detecting various morphological abnormalities of the tail of the sperm.
Description
Technical Field
The invention relates to genes, in particular to a novel MMAF (MMAF) pathogenic gene and application thereof.
Background
Multiple morphological abnormalities of the tail of the sperm (MMAF) are a recessive inherited teratospermia that causes male infertility, a rare genetic disease whose primary clinical features are the sum of five abnormalities of the tail of the sperm, including short tail, no tail, curly tail, curved tail and irregular tail width. Early studies also reported that the disease was fibrous sheath Dysplasia (DFS) and brachyury (stub tails). Early foreign molecular pathogenesis studies found that the DNAH1 gene was mutated (Ben Khelifa M, Coutton C, Zouari R, Karaouzene T, Rendu J, Bidart M, Yansine S, Pierre V, Delaroche J, Hennebicq S, Grunwald D, Escalier D, Pernet-Gallay K, Jouk PS, Thierry-Mieg N, Toure A, et al.
At present, the gene mutation spectrum of MMAF is not completely discovered, and the relationship between genotype and phenotype is not clear. At present, the research on single-gene diseases starts to adopt a large number of methods of whole-exome sequencing (whole-exome sequencing) and whole-genome sequencing (whole-genome sequencing), and the two methods are successfully applied to find the pathogenic genes of rare single-gene diseases. The whole exome sequencing and whole genome sequencing technology is proved to be a powerful and effective means for reducing rare single-gene disease candidate genes and even discovering pathogenic genes thereof. The success rate of screening for disease-related variations is greatly enhanced by sequencing only the whole exome or genome of a few rare individuals, including patients and normal controls. Therefore, the research on the MMAF in the field is not clear, the reason for causing the disease is not clear, and the research on the pathogenic mechanism of the MMAF is urgently needed to find out a new pathogenic gene and a mutation site.
Disclosure of Invention
It is a first object of the invention to provide MMAF biomarkers.
A second object of the present invention is to provide a method of detecting MMAF.
The third objective of the invention is to provide a primer pair used for detecting CFAP43 gene or CFAP43 protein mutation by PCR.
It is a fourth object of the present invention to provide a nucleic acid probe complementary to the mutant CFAP43 gene.
The fifth object of the present invention is to provide a kit for detecting a mutant CFAP43 gene or CFAP43 protein.
The sixth purpose of the present invention is to provide a kit for detecting a mutant CFAP43 gene.
The invention determines the pathogenic new gene of MMAF by exome sequencing method.
The MMAF biomarker is a mutated CFAP43 gene or CFAP43 protein, the biomarker having a mutated CFAP43 gene or CFAP43 protein selected from the group consisting of:
a splice site deletion mutation in exon 30 (c.3661-2A >);
a nonsense mutation in exon 22 (c.2802T > A; p.C934);
missense mutations in exon 3 (c.386C > A; p.S129Y).
The mutated CFAP43 gene has the following mutations in the sequence of SEQ ID NO: 1:
a splice site deletion mutation in exon 30 (c.3661-2A >);
a nonsense mutation in exon 22 (c.2802t > a);
missense mutation in exon 3 (c.386C > A).
The mutated CFAP43 protein is a sequence of SEQ ID NO:2 and has the following mutations:
nonsense mutations in exon 22 (p.c 934);
missense mutation in exon 3 (p.s129y).
The sequence of the mutant CFAP43 protein is SEQ ID NO 9.
The method for detecting MMAF comprises the steps of detecting whether a mutation site exists in CFAP43 gene or CFAP43 protein of a subject, and if the mutation site exists, the subject is identified to be suffering from MMAF or susceptible to MMAF, and the mutation site is selected from any one or combination of the following:
a splice site deletion mutation in exon 30 (c.3661-2A >);
a nonsense mutation in exon 22 (c.2802T > A; p.C934);
missense mutations in exon 3 (c.386C > A; p.S129Y).
The CFAP43 protein is represented by a sequence shown in SEQ ID NO. 2.
The CFAP43 gene is represented by the sequence of SEQ ID NO. 1.
The method for detecting MMAF comprises the following steps of amplifying at least one group of primers:
3 and 4;
5 and 6 SEQ ID NO;
SEQ ID NO 7 and SEQ ID NO 8.
In the method for detecting MMAF, mutation sites are detected by a technique selected from the following: sequencing, electrophoresis, nucleic acid hybridization, in situ hybridization, PCR, reverse transcriptase chain reaction, and denaturing high performance liquid chromatography.
The primer pair used in the detection of the CFAP43 gene or CFAP43 protein mutation by PCR, wherein the mutation is selected from any one or the combination of the following:
a splice site deletion mutation in exon 30 (c.3661-2A >);
a nonsense mutation in exon 22 (c.2802T > A; p.C934);
missense mutations in exon 3 (c.386C > A; p.S129Y);
wherein the primer pairs are designed based on a position selected from the group consisting of: 3661-2, 2802 and 386, numbering based on the cDNA sequence of CFAP43, 3661-2 indicates that position 3661 of the cDNA sequence is preceded by an intron sequence in the genomic DNA, and position 2 of the intron sequence is mutated.
The nucleic acid probe complementary to a mutant CFAP43 gene, wherein the mutation is selected from any one or a combination of the following:
a splice site deletion mutation in exon 30 (c.3661-2A >);
a nonsense mutation in exon 22 (c.2802T > A; p.C934);
missense mutations in exon 3 (c.386C > A; p.S129Y);
the complementary region of the probe to the mutant CFAP43 gene includes a position selected from the group consisting of: 3661-2, 2802 and 386, numbering based on the cDNA sequence of CFAP43, 3661-2 indicates that position 3661 of the cDNA sequence is preceded by an intron sequence in the genomic DNA, and position 2 of the intron sequence is mutated.
The kit for detecting the mutant CFAP43 gene or CFAP43 protein comprises at least one group of primer pairs, wherein the mutation is selected from any one or the combination of the following:
a splice site deletion mutation in exon 30 (c.3661-2A >);
a nonsense mutation in exon 22 (c.2802T > A; p.C934);
missense mutations in exon 3 (c.386C > A; p.S129Y);
wherein the primer pairs are designed based on the following positions respectively, so that the amplification products cover the positions: 3661-2, 2802 and 386, numbering based on the cDNA sequence of CFAP43, 3661-2 indicates that position 3661 of the cDNA sequence is preceded by an intron sequence in the genomic DNA, and position 2 of the intron sequence is mutated.
The kit for detecting the mutant CFAP43 gene or CFAP43 protein comprises at least one group of primers selected from the following group:
3 and 4;
5 and 6 SEQ ID NO;
SEQ ID NO 7 and SEQ ID NO 8.
The kit for detecting the mutant CFAP43 gene comprises at least one nucleic acid probe, wherein the mutation is selected from any one or the combination of the following:
3661-2 shows that position 3661 of the cDNA sequence is preceded by an intron sequence in the genomic DNA, and position 2 of the intron sequence is mutated.
The probe is complementary to a region of the mutant CFAP43 gene comprising a position selected from the group consisting of: 3661-2, 2802 and 386, numbering based on the cDNA sequence of CFAP43, 3661-2 indicates that position 3661 of the cDNA sequence is preceded by an intron sequence in the genomic DNA, and position 2 of the intron sequence is mutated.
The invention lays an important foundation for the research of the pathogenesis of the MMAF and provides a brand new theoretical basis for the treatment of patients with the MMAF.
Detailed Description
In the present invention, mutations are expressed using methods commonly used in the art. For example, in the mutation (c.386C > A; p.S129Y), c represents cDNA, p represents protein, and a mutation at the DNA level corresponds to a mutation at the protein level; in the nonsense mutation (c.2802T > A; p.C934), p.C934 indicates that the 934 th amino acid C is mutated into a stop codon, and the formed mutant protein has only 933 amino acids, as shown in SEQ ID NO: 9.
The cDNA sequence of the wild-type CFAP43 gene is shown in SEQ ID NO. 1.
2, SEQ ID NO: amino acid sequence of wild-type CFAP43 protein.
For reference to gene sequences in the present invention, it will be understood by those skilled in the art that the actual inclusion of either or both of the complementary double strands is intended. For convenience, in the present invention, although one strand is given in most cases, the other strand complementary thereto is also disclosed in practice. For example, reference is made to the cDNA sequence of the CFAP43 gene, including in fact that sequence and its complement. For example, reference to SEQ ID NO 1 actually includes the complementary sequence thereof. One skilled in the art will also appreciate that one strand may be used to detect the other strand and vice versa.
The gene sequence in the present invention includes a DNA form or an RNA form, and one is disclosed, meaning that the other is also disclosed. For example, reference is made to the cDNA sequence of the CFAP43 gene, and indeed to the corresponding RNA sequence.
Specific examples are given below.
Example 1: determining the pathogenic gene of MMAF.
27 cases of MMAF were collected, and all patients showed infertility, with tail malformations including short tail, no tail, curly tail, and irregular tail width, which are typical MMAF disease features.
The invention carries out whole exome sequencing on all patients, and comprises the following specific steps:
sample preparation: collecting peripheral blood of the patient and a parent mother, extracting genomic DNA (QIAamp DNA Mini Kit 51304 Qiagen, USA) in peripheral blood leukocyte by using a Kit, measuring the concentration and purity of the DNA (Thermo Scientific, USA) by using NanoDrop 2000, and obtaining the OD260/OD280 of the genomic DNA of each sample, wherein the concentration is not less than 100 ng/mul, and the total amount is not less than 30 mul.
Then, exome sequences of the above four samples were sequenced. The sequencing platform was Illumina Hiseq2000, and sequencing was performed according to Illumina Standard library construction Specification (see http:// www.illumina.com /), briefly as follows:
1) a DNA Library was prepared using TruSeq DNA Library Prep Kit available from Illumina. The Agilent kit SureSelect Human All Exon V5 was used during Exon capture;
2) performing parallel sequencing on the captured exon regions by using an Illumina HiSeq2000 sequencing platform to read the length of 90bp, wherein the average sequencing depth of each sample is at least 100;
3) the sequencing results were aligned to the ginseng reference genome using a Burrows-Wheeler Aligner (http:// bio-bw. sourceforce. net /) (hg 19). Duplicate reads were removed using SAMtools, adjusted and calibrated by GATK (https:// www.broadinstitute.org/GATK /). SNVs and InDels were then mined using SAMtools (http:// www.samtools.sourceforge.net /) and named with ANNOVAR (http:// www.openbioinformatics.org/ANNOVAR /).
Mutation sites with allele frequencies greater than 1% were knocked out (reference database included dbSNP, 1000 genes, exterior Aggregation Consortium (ExAC)).
Of these 2 patients had homozygous or complex heterozygous mutations in the gene CFAP 43: these sites were probably pathogenic by co-segregation of 2 patients and 3 normal SNP screens in both families.
The results are shown in Table 1.
Therefore, the CFAP43 gene is considered to be the most likely pathogenic gene of MMAF by the invention.
Example 2: in other cases, the above-mentioned causative gene of MMAF was confirmed.
The present invention was incorporated into all MMAF patients and the CFAP43 gene was verified as a causative gene of MMAF. In the verification, the Sanger method is used for sequencing and verifying the mutation of the CFAP43 gene, wherein the sample verification conditions such as family inside, family outside, distribution and the like are considered.
Genes were examined for 2 patients and 3 normal persons in the family (i.e., parents of 1 patient among them, who had no disease).
The method comprises the following specific steps:
DNA extraction:
peripheral venous blood was extracted from 2 patients and 3 normal persons in the family, respectively, and genomic DNA was extracted and DNA content was measured according to the method of example 1.
2. Primer design and PCR reaction
Primer design was referenced to the human genome sequence database hg19, see table 1 for details.
a) The primer sequence is as follows:
TABLE 1
b) Reaction system:
PCR amplification System:
c) and (3) PCR reaction conditions:
denaturation at 94 ℃ for 5min and then in each cycle, denaturation at 94 ℃ for 30s, annealing (typically 55 ℃ and set according to the annealing temperature of the different primers) for 30s, extension at 72 ℃ for 1min, for a total of 30 cycles. All cycles were completed, final extension at 72 ℃ for 10min, and PCR products were stored at 4 or-20 ℃.
3) The PCR-amplified products obtained in step 2 from 2 MMAF patients and 3 normal persons in the family (i.e., parents of the 1 patient who had no disease) were directly subjected to DNA sequencing in the same manner as in example 1.
Meaningful mutation sites were detected in CFAP43 gene in 2 of 27 MMAF cases collected by the present invention. Meanwhile, the found mutation sites can not be detected in family normal people. These mutation sites had very low or no frequency in the ExAC database (see Table 2), suggesting that the detected sites are likely not SNPs. Therefore, the CFAP43 gene is considered to be a new pathogenic gene of MMAF.
TABLE 2
Description of sequence listing
1, SEQ ID NO: cDNA sequence of wild-type CFAP43 gene
ATGGCGCAAGGCCGGGAGCGCGACGAAGGCCCCCACTCCGCCGGCGGCGCGTCCTTGTCCGTGAGATGGGTGCAAGGATTCCCTAAGCAGAATGTTCATTTTGTCAACGACAACACCATTTGCTACCCTTGTGGGAATTATGTAATATTTATTAATATTGAAACCAAGAAAAAGACTGTACTGCAGTGTAGTAATGGAATTGTGGGCGTCATGGCAACTAACATCCCCTGTGAAGTTGTGGCTTTTTCTGACCGGAAGCTAAAACCTCTCATCTACGTATACAGCTTTCCAGGATTGACCAGAAGGACCAAATTGAAAGGCAACATTCTCCTGGACTACACTTTACTTTCATTCAGTTACTGTGGCACCTACCTGGCTAGTTACTCCTCTCTCCCAGAATTTGAACTGGCCCTTTGGAACTGGGAATCGAGTATCATTTTGTGTAAGAAATCACAGCCTGGAATGGATGTGAACCAAATGTCTTTTAACCCCATGAACTGGCGCCAGCTGTGCTTATCAAGTCCAAGTACAGTGAGCGTGTGGACCATTGAAAGAAGTAACCAGGAGCATTGTTTCAGAGCAAGGTCGGTGAAATTACCTCTAGAAGATGGGTCATTTTTTAATGAAACGGATGTCGTTTTCCCCCAGTCGTTGCCGAAAGATCTCATCTATGGTCCCGTGCTGCCACTGTCAGCCATTGCCGGGCTGGTAGGCAAAGAGGCAGAGACTTTCCGGCCGAAAGATGATCTATATCCTTTGCTTCACCCGACTATGCATTGCTGGACTCCAACAAGTGACTTGTACATTGGCTGTGAAGAGGGTCATCTTTTAATGATTAATGGAGACACCTTGCAAGTGACTGTACTTAATAAGATAGAAGAGGAATCGCCATTGGACAGAAGAAATTTTATCAGTCCAGTAACCTTGGTATATCAGAAGGAGGGCGTGCTGGCTTCTGGAATTGATGGCTTTGTGTATTCTTTTATTATTAAAGATAGAAGTTACATGATCGAGGATTTTCTTGAGATTGAAAGACCTGTAGAACATATGACATTTTCTCCCAATTATACAGTGTTGCTGATTCAAACAGACAAGGGATCTGTTTATATCTACACTTTTGGTAAGGAGCCAACCTTAAATAAAGTCCTAGATGCTTGTGATGGGAAATTTCAGGCAATTGACTTTATCACACCTGGAACCCAATACTTCATGACACTTACATATTCAGGGGAAATTTGTGTTTGGTGGCTGGAGGATTGTGCTTGTGTAAGCAAGATTTATCTGAATACCCTAGCAACGGTTCTGGCTTGCTGTCCATCCTCCCTCTCTGCAGCCGTGGGCACGGAGGATGGCTCGGTCTACTTCATCAGCGTATATGATAAGGAATCCCCTCAGGTCGTGCACAAGGCCTTTCTCTCGGAATCGTCCGTGCAGCACGTCGTTTATGATCAGCAAGGAATATTTCTGTTAGTTGGAACAGCAGAAGGAAAAGTCTTTATTATCAATGCCAACTCCTCAAGCTCATTTCAGATTATTGGATTCACAGAGGTGGCCAAAGACATTTTACAGATATCCACAGTGTCTCTTTTAGAAACAGACATAGTGGAAGTGATGGTGCTTTCCTCGCTTCCAGAAGCAGGGAGAAGCAGGTTGGAGATGTTCACACTGCCTACATTACTGCCACAAGTTTCCACAACCTTTGCTGATGAAAGAGGAAGGCTGAAAGATGAAATCATTCATAAGTACCTGTATGAGTTGGAGCACGCTCTGTCCTCTGCAGTCTTGGGCTTTCAAAGTAACCAAATATATGGCTTCTGTAGTCAAGTGCCATACATCTGTAGCTACCTTCTTCCTGAAGAAGAACATACCGGTATCTACATTCTTAAACCATACAAAAAAGTACAAAGCAGACAGTATGGACCTGGACTGCTCTATCTGTCTTCACATGGATTGTGGCTCATAACAATAGCTAAATGTGGAATTCTGTGTATCCGAGACGTTTATACTTTGGAAACATTTGCTTGGTGTCGGAGTCATTCTCACCAGGGTCATGGGATTCAGTCAATGAGAATTTCAATGGATGGACAAAACATTCTGGTGAATGGGAGAGATGATGGCACCCTTGTCTACCTAAAGTGGAAGCGATTTGGAGGACACCTAGCCAGTGAAATTCTGGACTATTACCAGAAACTATTAATTTCCCTGAGCAGCGCCATGGACAAGGAGAATCATTATTTAAGCACAACACCAAAAGTTTCCGTAGATTTGGGATCCGATTCTGAACACACAAAACAGAAGGCAAGCACTGACTTATCACAAGATGAATTAGTTCTAACCGATGTTAAGAAGGAAATTCCTTGGATACAACAAAAAAGCCAAGAGGCCATCAAAAAGGAGGTTAATCTGTTTTCCAAGAAAAGGAAAGAGATAAAACAAGGAATCAAATCACTTTCCAAAACTATTCTGAATATGATGGAAGAAAATGACAAACTAGAAAATATTGCAAAATTAGACCAACAGGAATTTGGTCTGGATCTTGAGGAACTAGAAAGGCTTCATGATGAAAGTCAGGAAGAAGTGGCAAAGATGATAAAGGATGTAGAGATGCATAACTTAGCCAAGAGCTATTTGGCTGAACTTATCAAAGAAGAATGTTGGAATTCGATGGCTGTGAAAGGTCGAGCTCTTAAGTGTTTTCATATCCCCTGTGTGGTTGAAAACTTCCCGATGAAAGCGCGCACGGTTGAAGAGCTGAAAGAATTGGAAAGAGTTTTACAGCAAAAGAAGATTGAAGCAGAGTGTCTTAAACTACGGAAGGAAATTGTAGAGGCTCAGTCTGGAGTTAAGTTGATTAAACAGCGTCATGAAGAGGATGATGAAGAAGAGGAAGAGGAAGACAAGACAGTAAAATATAGCAATTTGCCCAATTACCTGCTTGGTAGTCTGAGTACTGATTTTGGGGTAGATACCTCTTTATTGTCAAGCCAATTGGAGCTTCATTCCAGAGAAGAGAAAATCAACCAAATTATATTATTGAAAGATATCATTTACAAGGTAAAAACTGTTTTCAATAATGAGTTTGACGCTGCATATAAACAAAAAGAGTTTGAAATTGCACGCGTGAAGGAAAGAAATGTTCGAATTCGAGAAATTATTTTAGATCTGGAATTGGAAGAAGCAGTCTGGCAACCAGAATTTGAAGACTGTGAGAAGCCAGAGAGAACGCTTGTTGTGCAAGATGAGGAGATTACAGCCCACAAACACATTAAGCCGTGGCACAAAGCCAAAGAATTGATCGTGAATCATGAAAAGGAGCACTGGCTTCTGATACAGGATGCCAGTACAAGACTCCGAGCTCTGATGGACATGATGGGAGGAGTTCTGGAAGTCAAGAAGGAAGATATTTTGAGAATGGTGATTCCTCAACCTGCTTTCATGGCAAAACCTGATGCTGTGTGGACTGAAGAAGAAAGAAAACAATTCAAAGATTATGAGAAAAAAGTAAAGGAGTTAAATGAAGAAAGAGATAAGTATAGAAAGTCATTAGAAGCAGAACTGAAGAAACTTCAAAACTCTATTCAAGAAAGCACACAGGCCTTTGATGAACATTTGAAAAGACTTTTTGAAAGGAGAGTGAAGGCAGAGATGGTTACCAACCAGGAGGAACTGAAAATAAGTAACCTTGCATTTTCTTTATTGTTGGATGAAGAATTAAGCTCTAGAGAAAAATTCCTGAACAACTACCTTACAAGGAAACAGCACGAGAAAAGCCAGACTTCAGAAGCTGTTCGGAAATCTAGAGAAGACCTGGATGTGTGCAAGGAGCACTATGACAACTTACTGGCAGAAGACAAAGTTATGGATCGCAGCTTTAAAAAGGAATTTTCTGAAATTCCTGGTCATCAAGTGGATATACTCTACAAACTTTTTAAACGCCGACCAAGGATTTCCAAACAGAAAACGCACTCAGAAACAACCAGCGTTGTCCCTTTCGGAGAACTACCAGGATCTGGCAAGTTGAATAAGGATGCCTTTGCCCAGTTAATGAAAGCTATGGATGAGTTGGACAATATTAGTAACATGCCAGAAGGCTTGGACCCTTTGGTCTGGAATCATTTCTGCATGACAAGACGAGCAAAAGTGGAAAATGAACAGAAAGTAAAGCAGAAAGCAGCTGACTTATTGGAAATGGCAACTTTCCTCCAGAAGAGAGTTGAGGAGGAAGAGAAGGTGCAACAGGAGATTGAGAGAGTGTTCCATGAACTCATCCTATTACAGGAAGAGAAAGTGAGATTCCAGTTGAATTTGACAATCCAAATTCTTCTTAAACAAGGACAAGTAGAACTGGAAAATTTCCAGCTAGTACTGGAGTATTCTGATGCAATTCTCATCAACAAGAACATAATTGAAGACTTGAATTCTGTGATTCGGACTCAAGGACAAAAGAAAGTTGCTAGCATGATGGAAAGTAAAGATGTACACAAAAGAATACTTCAGATTGAGTGGGAACATAAGAAAATGGAGATGGAAAGGGAAGATCTAAATCAGAAGGCTTGGGATATTCAGATGCTATTTTTTTCAAGAGATCGTCAAAAGTACCTAAATGAACCAAACTATGAGGCTCTGATTAGTATTCAGATTGGAATAATGGAACAAACCATTGCTGTTTTAGATAAGATGCACAAAAAGAATGTGGAAAACTGCAAGAAACTACTCAAAAAACTTGGAAAGTTCAGCAATCAAAAAGATATAGCAAATTATGCCCTAAGCTGCAATCTACGAGAAGAGTTGGTAGCTGTCTCAGAGAGAAAAGACATCTGTAATGCAATGGGGTCTAAACTGACTTGTGAAAAGATTGTCAAAGAACGGTATGAAAACATGATGCAACAGCAGAAGTTAACAAATATTTCAAAACAACAAGCTGAACAGATTTCAATACTACAGACTGAAGTTGAAAGATTAAGAATGAAAACATTTCCTGCTCTTGTTCAAATGTAA
2, SEQ ID NO: amino acid sequence of wild-type CFAP43 protein
MAQGRERDEGPHSAGGASLSVRWVQGFPKQNVHFVNDNTICYPCGNYVIFINIETKKKTVLQCSNGIVGVMATNIPCEVVAFSDRKLKPLIYVYSFPGLTRRTKLKGNILLDYTLLSFSYCGTYLASYSSLPEFELALWNWESSIILCKKSQPGMDVNQMSFNPMNWRQLCLSSPSTVSVWTIERSNQEHCFRARSVKLPLEDGSFFNETDVVFPQSLPKDLIYGPVLPLSAIAGLVGKEAETFRPKDDLYPLLHPTMHCWTPTSDLYIGCEEGHLLMINGDTLQVTVLNKIEEESPLDRRNFISPVTLVYQKEGVLASGIDGFVYSFIIKDRSYMIEDFLEIERPVEHMTFSPNYTVLLIQTDKGSVYIYTFGKEPTLNKVLDACDGKFQAIDFITPGTQYFMTLTYSGEICVWWLEDCACVSKIYLNTLATVLACCPSSLSAAVGTEDGSVYFISVYDKESPQVVHKAFLSESSVQHVVYDQQGIFLLVGTAEGKVFIINANSSSSFQIIGFTEVAKDILQISTVSLLETDIVEVMVLSSLPEAGRSRLEMFTLPTLLPQVSTTFADERGRLKDEIIHKYLYELEHALSSAVLGFQSNQIYGFCSQVPYICSYLLPEEEHTGIYILKPYKKVQSRQYGPGLLYLSSHGLWLITIAKCGILCIRDVYTLETFAWCRSHSHQGHGIQSMRISMDGQNILVNGRDDGTLVYLKWKRFGGHLASEILDYYQKLLISLSSAMDKENHYLSTTPKVSVDLGSDSEHTKQKASTDLSQDELVLTDVKKEIPWIQQKSQEAIKKEVNLFSKKRKEIKQGIKSLSKTILNMMEENDKLENIAKLDQQEFGLDLEELERLHDESQEEVAKMIKDVEMHNLAKSYLAELIKEECWNSMAVKGRALKCFHIPCVVENFPMKARTVEELKELERVLQQKKIEAECLKLRKEIVEAQSGVKLIKQRHEEDDEEEEEEDKTVKYSNLPNYLLGSLSTDFGVDTSLLSSQLELHSREEKINQIILLKDIIYKVKTVFNNEFDAAYKQKEFEIARVKERNVRIREIILDLELEEAVWQPEFEDCEKPERTLVVQDEEITAHKHIKPWHKAKELIVNHEKEHWLLIQDASTRLRALMDMMGGVLEVKKEDILRMVIPQPAFMAKPDAVWTEEERKQFKDYEKKVKELNEERDKYRKSLEAELKKLQNSIQESTQAFDEHLKRLFERRVKAEMVTNQEELKISNLAFSLLLDEELSSREKFLNNYLTRKQHEKSQTSEAVRKSREDLDVCKEHYDNLLAEDKVMDRSFKKEFSEIPGHQVDILYKLFKRRPRISKQKTHSETTSVVPFGELPGSGKLNKDAFAQLMKAMDELDNISNMPEGLDPLVWNHFCMTRRAKVENEQKVKQKAADLLEMATFLQKRVEEEEKVQQEIERVFHELILLQEEKVRFQLNLTIQILLKQGQVELENFQLVLEYSDAILINKNIIEDLNSVIRTQGQKKVASMMESKDVHKRILQIEWEHKKMEMEREDLNQKAWDIQMLFFSRDRQKYLNEPNYEALISIQIGIMEQTIAVLDKMHKKNVENCKKLLKKLGKFSNQKDIANYALSCNLREELVAVSERKDICNAMGSKLTCEKIVKERYENMMQQQKLTNISKQQAEQISILQTEVERLRMKTFPALVQM
9 of SEQ ID NO: amino acid sequence of mutant CFAP43 protein (p.c934;)
MAQGRERDEGPHSAGGASLSVRWVQGFPKQNVHFVNDNTICYPCGNYVIFINIETKKKTVLQCSNGIVGVMATNIPCEVVAFSDRKLKPLIYVYSFPGLTRRTKLKGNILLDYTLLSFSYCGTYLASYSSLPEFELALWNWESSIILCKKSQPGMDVNQMSFNPMNWRQLCLSSPSTVSVWTIERSNQEHCFRARSVKLPLEDGSFFNETDVVFPQSLPKDLIYGPVLPLSAIAGLVGKEAETFRPKDDLYPLLHPTMHCWTPTSDLYIGCEEGHLLMINGDTLQVTVLNKIEEESPLDRRNFISPVTLVYQKEGVLASGIDGFVYSFIIKDRSYMIEDFLEIERPVEHMTFSPNYTVLLIQTDKGSVYIYTFGKEPTLNKVLDACDGKFQAIDFITPGTQYFMTLTYSGEICVWWLEDCACVSKIYLNTLATVLACCPSSLSAAVGTEDGSVYFISVYDKESPQVVHKAFLSESSVQHVVYDQQGIFLLVGTAEGKVFIINANSSSSFQIIGFTEVAKDILQISTVSLLETDIVEVMVLSSLPEAGRSRLEMFTLPTLLPQVSTTFADERGRLKDEIIHKYLYELEHALSSAVLGFQSNQIYGFCSQVPYICSYLLPEEEHTGIYILKPYKKVQSRQYGPGLLYLSSHGLWLITIAKCGILCIRDVYTLETFAWCRSHSHQGHGIQSMRISMDGQNILVNGRDDGTLVYLKWKRFGGHLASEILDYYQKLLISLSSAMDKENHYLSTTPKVSVDLGSDSEHTKQKASTDLSQDELVLTDVKKEIPWIQQKSQEAIKKEVNLFSKKRKEIKQGIKSLSKTILNMMEENDKLENIAKLDQQEFGLDLEELERLHDESQEEVAKMIKDVEMHNLAKSYLAELIKEECWNSMAVKGRALKCFHIPCVVENFPMKARTVEELKELERVLQQKKIEAE。
Sequence listing
<110> Xiamen city women and children health care institute (Xiamen city family planning service center), the first hospital affiliated to Jinzhou medical university, the Beijing women's hospital affiliated to capital medical university, the tobacco station Yu Jian Top hospital, Xiameno Nuo kang biological technology Co Ltd
<120> MMAF pathogenic new gene and application thereof
<130>2017
<160>9
<170>SIPOSequenceListing 1.0
<210>1
<211>4998
<212>DNA
<213>Homo Sapiens
<400>1
atggcgcaag gccgggagcg cgacgaaggc ccccactccg ccggcggcgc gtccttgtcc 60
gtgagatggg tgcaaggatt ccctaagcag aatgttcatt ttgtcaacga caacaccatt 120
tgctaccctt gtgggaatta tgtaatattt attaatattg aaaccaagaa aaagactgta 180
ctgcagtgta gtaatggaat tgtgggcgtc atggcaacta acatcccctg tgaagttgtg 240
gctttttctg accggaagct aaaacctctc atctacgtat acagctttcc aggattgacc 300
agaaggacca aattgaaagg caacattctc ctggactaca ctttactttc attcagttac 360
tgtggcacct acctggctag ttactcctct ctcccagaat ttgaactggc cctttggaac 420
tgggaatcga gtatcatttt gtgtaagaaa tcacagcctg gaatggatgt gaaccaaatg 480
tcttttaacc ccatgaactg gcgccagctg tgcttatcaa gtccaagtac agtgagcgtg 540
tggaccattg aaagaagtaa ccaggagcat tgtttcagag caaggtcggt gaaattacct 600
ctagaagatg ggtcattttt taatgaaacg gatgtcgttt tcccccagtc gttgccgaaa 660
gatctcatct atggtcccgt gctgccactg tcagccattg ccgggctggt aggcaaagag 720
gcagagactt tccggccgaa agatgatcta tatcctttgc ttcacccgac tatgcattgc 780
tggactccaa caagtgactt gtacattggc tgtgaagagg gtcatctttt aatgattaat 840
ggagacacct tgcaagtgac tgtacttaat aagatagaag aggaatcgcc attggacaga 900
agaaatttta tcagtccagt aaccttggta tatcagaagg agggcgtgct ggcttctgga 960
attgatggct ttgtgtattc ttttattatt aaagatagaa gttacatgat cgaggatttt 1020
cttgagattg aaagacctgt agaacatatg acattttctc ccaattatac agtgttgctg 1080
attcaaacag acaagggatc tgtttatatc tacacttttg gtaaggagcc aaccttaaat 1140
aaagtcctag atgcttgtga tgggaaattt caggcaattg actttatcac acctggaacc 1200
caatacttca tgacacttac atattcaggg gaaatttgtg tttggtggct ggaggattgt 1260
gcttgtgtaa gcaagattta tctgaatacc ctagcaacgg ttctggcttg ctgtccatcc 1320
tccctctctg cagccgtggg cacggaggat ggctcggtct acttcatcag cgtatatgat 1380
aaggaatccc ctcaggtcgt gcacaaggcc tttctctcgg aatcgtccgt gcagcacgtc 1440
gtttatgatc agcaaggaat atttctgtta gttggaacag cagaaggaaa agtctttatt 1500
atcaatgcca actcctcaag ctcatttcag attattggat tcacagaggt ggccaaagac 1560
attttacaga tatccacagt gtctctttta gaaacagaca tagtggaagt gatggtgctt 1620
tcctcgcttc cagaagcagg gagaagcagg ttggagatgt tcacactgcc tacattactg 1680
ccacaagttt ccacaacctt tgctgatgaa agaggaaggc tgaaagatga aatcattcat 1740
aagtacctgt atgagttgga gcacgctctg tcctctgcag tcttgggctt tcaaagtaac 1800
caaatatatg gcttctgtag tcaagtgcca tacatctgta gctaccttct tcctgaagaa 1860
gaacataccg gtatctacat tcttaaacca tacaaaaaag tacaaagcag acagtatgga 1920
cctggactgc tctatctgtc ttcacatgga ttgtggctca taacaatagc taaatgtgga 1980
attctgtgta tccgagacgt ttatactttg gaaacatttg cttggtgtcg gagtcattct 2040
caccagggtc atgggattca gtcaatgaga atttcaatgg atggacaaaa cattctggtg 2100
aatgggagag atgatggcac ccttgtctac ctaaagtgga agcgatttgg aggacaccta 2160
gccagtgaaa ttctggacta ttaccagaaa ctattaattt ccctgagcag cgccatggac 2220
aaggagaatc attatttaag cacaacacca aaagtttccg tagatttggg atccgattct 2280
gaacacacaa aacagaaggc aagcactgac ttatcacaag atgaattagt tctaaccgat 2340
gttaagaagg aaattccttg gatacaacaa aaaagccaag aggccatcaa aaaggaggtt 2400
aatctgtttt ccaagaaaag gaaagagata aaacaaggaa tcaaatcact ttccaaaact 2460
attctgaata tgatggaaga aaatgacaaa ctagaaaata ttgcaaaatt agaccaacag 2520
gaatttggtc tggatcttga ggaactagaa aggcttcatg atgaaagtca ggaagaagtg 2580
gcaaagatga taaaggatgt agagatgcat aacttagcca agagctattt ggctgaactt 2640
atcaaagaag aatgttggaa ttcgatggct gtgaaaggtc gagctcttaa gtgttttcat 2700
atcccctgtg tggttgaaaa cttcccgatg aaagcgcgca cggttgaaga gctgaaagaa 2760
ttggaaagag ttttacagca aaagaagatt gaagcagagt gtcttaaact acggaaggaa 2820
attgtagagg ctcagtctgg agttaagttg attaaacagc gtcatgaaga ggatgatgaa 2880
gaagaggaag aggaagacaa gacagtaaaa tatagcaatt tgcccaatta cctgcttggt 2940
agtctgagta ctgattttgg ggtagatacc tctttattgt caagccaatt ggagcttcat 3000
tccagagaag agaaaatcaa ccaaattata ttattgaaag atatcattta caaggtaaaa 3060
actgttttca ataatgagtt tgacgctgca tataaacaaa aagagtttga aattgcacgc 3120
gtgaaggaaa gaaatgttcg aattcgagaa attattttag atctggaatt ggaagaagca 3180
gtctggcaac cagaatttga agactgtgag aagccagaga gaacgcttgt tgtgcaagat 3240
gaggagatta cagcccacaa acacattaag ccgtggcaca aagccaaaga attgatcgtg 3300
aatcatgaaa aggagcactg gcttctgata caggatgcca gtacaagact ccgagctctg 3360
atggacatga tgggaggagt tctggaagtc aagaaggaag atattttgag aatggtgatt 3420
cctcaacctg ctttcatggc aaaacctgat gctgtgtgga ctgaagaaga aagaaaacaa 3480
ttcaaagatt atgagaaaaa agtaaaggag ttaaatgaag aaagagataa gtatagaaag 3540
tcattagaag cagaactgaa gaaacttcaa aactctattc aagaaagcac acaggccttt 3600
gatgaacatt tgaaaagact ttttgaaagg agagtgaagg cagagatggt taccaaccag 3660
gaggaactga aaataagtaa ccttgcattt tctttattgt tggatgaaga attaagctct 3720
agagaaaaat tcctgaacaa ctaccttaca aggaaacagc acgagaaaag ccagacttca 3780
gaagctgttc ggaaatctag agaagacctg gatgtgtgca aggagcacta tgacaactta 3840
ctggcagaag acaaagttat ggatcgcagc tttaaaaagg aattttctga aattcctggt 3900
catcaagtgg atatactcta caaacttttt aaacgccgac caaggatttc caaacagaaa 3960
acgcactcag aaacaaccag cgttgtccct ttcggagaac taccaggatc tggcaagttg 4020
aataaggatg cctttgccca gttaatgaaa gctatggatg agttggacaa tattagtaac 4080
atgccagaag gcttggaccc tttggtctgg aatcatttct gcatgacaag acgagcaaaa 4140
gtggaaaatg aacagaaagt aaagcagaaa gcagctgact tattggaaat ggcaactttc 4200
ctccagaaga gagttgagga ggaagagaag gtgcaacagg agattgagag agtgttccat 4260
gaactcatcc tattacagga agagaaagtg agattccagt tgaatttgac aatccaaatt 4320
cttcttaaac aaggacaagt agaactggaa aatttccagc tagtactgga gtattctgat 4380
gcaattctca tcaacaagaa cataattgaa gacttgaatt ctgtgattcg gactcaagga 4440
caaaagaaag ttgctagcat gatggaaagt aaagatgtac acaaaagaat acttcagatt 4500
gagtgggaac ataagaaaat ggagatggaa agggaagatc taaatcagaa ggcttgggat 4560
attcagatgc tatttttttc aagagatcgt caaaagtacc taaatgaacc aaactatgag 4620
gctctgatta gtattcagat tggaataatg gaacaaacca ttgctgtttt agataagatg 4680
cacaaaaaga atgtggaaaa ctgcaagaaa ctactcaaaa aacttggaaa gttcagcaat 4740
caaaaagata tagcaaatta tgccctaagc tgcaatctac gagaagagtt ggtagctgtc 4800
tcagagagaa aagacatctg taatgcaatg gggtctaaac tgacttgtga aaagattgtc 4860
aaagaacggt atgaaaacat gatgcaacag cagaagttaa caaatatttc aaaacaacaa 4920
gctgaacaga tttcaatact acagactgaa gttgaaagat taagaatgaa aacatttcct 4980
gctcttgttc aaatgtaa 4998
<210>2
<211>1665
<212>PRT
<213>Homo Sapiens
<400>2
Met Ala Gln Gly Arg Glu Arg Asp Glu Gly Pro His Ser Ala Gly Gly
1 5 10 15
Ala Ser Leu Ser Val Arg Trp Val Gln Gly Phe Pro Lys Gln Asn Val
20 25 30
His Phe Val Asn Asp Asn Thr Ile Cys Tyr Pro Cys Gly Asn Tyr Val
35 40 45
Ile Phe Ile Asn Ile Glu Thr Lys Lys Lys Thr Val Leu Gln Cys Ser
50 55 60
Asn Gly Ile Val Gly Val Met Ala Thr Asn Ile Pro Cys Glu Val Val
65 70 75 80
Ala Phe Ser Asp Arg Lys Leu Lys Pro Leu Ile Tyr Val Tyr Ser Phe
85 90 95
Pro Gly Leu Thr Arg Arg Thr Lys Leu Lys Gly Asn Ile Leu Leu Asp
100 105 110
Tyr Thr Leu Leu Ser Phe Ser Tyr Cys Gly Thr Tyr Leu Ala Ser Tyr
115 120125
Ser Ser Leu Pro Glu Phe Glu Leu Ala Leu Trp Asn Trp Glu Ser Ser
130 135 140
Ile Ile Leu Cys Lys Lys Ser Gln Pro Gly Met Asp Val Asn Gln Met
145 150 155 160
Ser Phe Asn Pro Met Asn Trp Arg Gln Leu Cys Leu Ser Ser Pro Ser
165 170 175
Thr Val Ser Val Trp Thr Ile Glu Arg Ser Asn Gln Glu His Cys Phe
180 185 190
Arg Ala Arg Ser Val Lys Leu Pro Leu Glu Asp Gly Ser Phe Phe Asn
195 200 205
Glu Thr Asp Val Val Phe Pro Gln Ser Leu Pro Lys Asp Leu Ile Tyr
210 215 220
Gly Pro Val Leu Pro Leu Ser Ala Ile Ala Gly Leu Val Gly Lys Glu
225 230 235 240
Ala Glu Thr Phe Arg Pro Lys Asp Asp Leu Tyr Pro Leu Leu His Pro
245 250 255
Thr Met His Cys Trp Thr Pro Thr Ser Asp Leu Tyr Ile Gly Cys Glu
260 265 270
Glu Gly His Leu Leu Met Ile Asn Gly Asp Thr Leu Gln Val Thr Val
275 280285
Leu Asn Lys Ile Glu Glu Glu Ser Pro Leu Asp Arg Arg Asn Phe Ile
290 295 300
Ser Pro Val Thr Leu Val Tyr Gln Lys Glu Gly Val Leu Ala Ser Gly
305 310 315 320
Ile Asp Gly Phe Val Tyr Ser Phe Ile Ile Lys Asp Arg Ser Tyr Met
325 330 335
Ile Glu Asp Phe Leu Glu Ile Glu Arg Pro Val Glu His Met Thr Phe
340 345 350
Ser Pro Asn Tyr Thr Val Leu Leu Ile Gln Thr Asp Lys Gly Ser Val
355 360 365
Tyr Ile Tyr Thr Phe Gly Lys Glu Pro Thr Leu Asn Lys Val Leu Asp
370 375 380
Ala Cys Asp Gly Lys Phe Gln Ala Ile Asp Phe Ile Thr Pro Gly Thr
385 390 395 400
Gln Tyr Phe Met Thr Leu Thr Tyr Ser Gly Glu Ile Cys Val Trp Trp
405 410 415
Leu Glu Asp Cys Ala Cys Val Ser Lys Ile Tyr Leu Asn Thr Leu Ala
420 425 430
Thr Val Leu Ala Cys Cys Pro Ser Ser Leu Ser Ala Ala Val Gly Thr
435 440 445
Glu Asp Gly Ser Val Tyr Phe Ile Ser Val Tyr Asp Lys Glu Ser Pro
450 455 460
Gln Val Val His Lys Ala Phe Leu Ser Glu Ser Ser Val Gln His Val
465 470 475 480
Val Tyr Asp Gln Gln Gly Ile Phe Leu Leu Val Gly Thr Ala Glu Gly
485 490 495
Lys Val Phe Ile Ile Asn Ala Asn Ser Ser Ser Ser Phe Gln Ile Ile
500 505 510
Gly Phe Thr Glu Val Ala Lys Asp Ile Leu Gln Ile Ser Thr Val Ser
515 520 525
Leu Leu Glu Thr Asp Ile Val Glu Val Met Val Leu Ser Ser Leu Pro
530 535 540
Glu Ala Gly Arg Ser Arg Leu Glu Met Phe Thr Leu Pro Thr Leu Leu
545 550 555 560
Pro Gln Val Ser Thr Thr Phe Ala Asp Glu Arg Gly Arg Leu Lys Asp
565 570 575
Glu Ile Ile His Lys Tyr Leu Tyr Glu Leu Glu His Ala Leu Ser Ser
580 585 590
Ala Val Leu Gly Phe Gln Ser Asn Gln Ile Tyr Gly Phe Cys Ser Gln
595 600 605
Val Pro Tyr Ile Cys Ser Tyr Leu Leu Pro Glu Glu Glu His Thr Gly
610 615 620
Ile Tyr Ile Leu Lys Pro Tyr Lys Lys Val Gln Ser Arg Gln Tyr Gly
625 630 635 640
Pro Gly Leu Leu Tyr Leu Ser Ser His Gly Leu Trp Leu Ile Thr Ile
645 650 655
Ala Lys Cys Gly Ile Leu Cys Ile Arg Asp Val Tyr Thr Leu Glu Thr
660 665 670
Phe Ala Trp Cys Arg Ser His Ser His Gln Gly His Gly Ile Gln Ser
675 680 685
Met Arg Ile Ser Met Asp Gly Gln Asn Ile Leu Val Asn Gly Arg Asp
690 695 700
Asp Gly Thr Leu Val Tyr Leu Lys Trp Lys Arg Phe Gly Gly His Leu
705 710 715 720
Ala Ser Glu Ile Leu Asp Tyr Tyr Gln Lys Leu Leu Ile Ser Leu Ser
725 730 735
Ser Ala Met Asp Lys Glu Asn His Tyr Leu Ser Thr Thr Pro Lys Val
740 745 750
Ser Val Asp Leu Gly Ser Asp Ser Glu His Thr Lys Gln Lys Ala Ser
755 760 765
Thr Asp Leu Ser Gln Asp Glu Leu Val Leu Thr Asp Val Lys Lys Glu
770 775 780
Ile Pro Trp Ile Gln Gln Lys Ser Gln Glu Ala Ile Lys Lys Glu Val
785 790 795 800
Asn Leu Phe Ser Lys Lys Arg Lys Glu Ile Lys Gln Gly Ile Lys Ser
805 810 815
Leu Ser Lys Thr Ile Leu Asn Met Met Glu Glu Asn Asp Lys Leu Glu
820 825 830
Asn Ile Ala Lys Leu Asp Gln Gln Glu Phe Gly Leu Asp Leu Glu Glu
835 840 845
Leu Glu Arg Leu His Asp Glu Ser Gln Glu Glu Val Ala Lys Met Ile
850 855 860
Lys Asp Val Glu Met His Asn Leu Ala Lys Ser Tyr Leu Ala Glu Leu
865 870 875 880
Ile Lys Glu Glu Cys Trp Asn Ser Met Ala Val Lys Gly Arg Ala Leu
885 890 895
Lys Cys Phe His Ile Pro Cys Val Val Glu Asn Phe Pro Met Lys Ala
900 905 910
Arg Thr Val Glu Glu Leu Lys Glu Leu Glu Arg Val Leu Gln Gln Lys
915 920 925
Lys Ile Glu Ala Glu Cys Leu Lys Leu Arg Lys Glu Ile Val Glu Ala
930 935 940
Gln Ser Gly Val Lys Leu Ile Lys Gln Arg His Glu Glu Asp Asp Glu
945 950 955 960
Glu Glu Glu Glu Glu Asp Lys Thr Val Lys Tyr Ser Asn Leu Pro Asn
965 970 975
Tyr Leu Leu Gly Ser Leu Ser Thr Asp Phe Gly Val Asp Thr Ser Leu
980 985 990
Leu Ser Ser Gln Leu Glu Leu His Ser Arg Glu Glu Lys Ile Asn Gln
995 1000 1005
Ile Ile Leu Leu Lys Asp Ile Ile Tyr Lys Val Lys Thr Val Phe Asn
1010 1015 1020
Asn Glu Phe Asp Ala Ala Tyr Lys Gln Lys Glu Phe Glu Ile Ala Arg
1025 1030 1035 1040
Val Lys Glu Arg Asn Val Arg Ile Arg Glu Ile Ile Leu Asp Leu Glu
1045 1050 1055
Leu Glu Glu Ala Val Trp Gln Pro Glu Phe Glu Asp Cys Glu Lys Pro
1060 1065 1070
Glu Arg Thr Leu Val Val Gln Asp Glu Glu Ile Thr Ala His Lys His
1075 1080 1085
Ile Lys Pro Trp His Lys Ala Lys Glu Leu Ile Val Asn His Glu Lys
1090 1095 1100
Glu His Trp Leu Leu Ile Gln Asp Ala Ser Thr Arg Leu Arg Ala Leu
1105 1110 1115 1120
Met Asp Met Met Gly Gly Val Leu Glu Val Lys Lys Glu Asp Ile Leu
1125 1130 1135
Arg Met Val Ile Pro Gln Pro Ala Phe Met Ala Lys Pro Asp Ala Val
1140 1145 1150
Trp Thr Glu Glu Glu Arg Lys Gln Phe Lys Asp Tyr Glu Lys Lys Val
1155 1160 1165
Lys Glu Leu Asn Glu Glu Arg Asp Lys Tyr Arg Lys Ser Leu Glu Ala
1170 1175 1180
Glu Leu Lys Lys Leu Gln Asn Ser Ile Gln Glu Ser Thr Gln Ala Phe
1185 1190 1195 1200
Asp Glu His Leu Lys Arg Leu Phe Glu Arg Arg Val Lys Ala Glu Met
1205 1210 1215
Val Thr Asn Gln Glu Glu Leu Lys Ile Ser Asn Leu Ala Phe Ser Leu
1220 1225 1230
Leu Leu Asp Glu Glu Leu Ser Ser Arg Glu Lys Phe Leu Asn Asn Tyr
1235 1240 1245
Leu Thr Arg Lys Gln His Glu Lys Ser Gln Thr Ser Glu Ala Val Arg
1250 1255 1260
Lys Ser Arg Glu Asp Leu Asp Val Cys Lys Glu His Tyr Asp Asn Leu
1265 1270 1275 1280
Leu Ala Glu Asp Lys Val Met Asp Arg Ser Phe Lys Lys Glu Phe Ser
1285 1290 1295
Glu Ile Pro Gly His Gln Val Asp Ile Leu Tyr Lys Leu Phe Lys Arg
1300 1305 1310
Arg Pro Arg Ile Ser Lys Gln Lys Thr His Ser Glu Thr Thr Ser Val
1315 1320 1325
Val Pro Phe Gly Glu Leu Pro Gly Ser Gly Lys Leu Asn Lys Asp Ala
1330 1335 1340
Phe Ala Gln Leu Met Lys Ala Met Asp Glu Leu Asp Asn Ile Ser Asn
1345 1350 1355 1360
Met Pro Glu Gly Leu Asp Pro Leu Val Trp Asn His Phe Cys Met Thr
1365 1370 1375
Arg Arg Ala Lys Val Glu Asn Glu Gln Lys Val Lys Gln Lys Ala Ala
1380 1385 1390
Asp Leu Leu Glu Met Ala Thr Phe Leu Gln Lys Arg Val Glu Glu Glu
1395 1400 1405
Glu Lys Val Gln Gln Glu Ile Glu Arg Val Phe His Glu Leu Ile Leu
1410 1415 1420
Leu Gln Glu Glu Lys Val Arg Phe Gln Leu Asn Leu Thr Ile Gln Ile
1425 1430 1435 1440
Leu Leu Lys Gln Gly Gln Val Glu Leu Glu Asn Phe Gln Leu Val Leu
1445 1450 1455
Glu Tyr Ser Asp Ala Ile Leu Ile Asn Lys Asn Ile Ile Glu Asp Leu
1460 1465 1470
Asn Ser Val Ile Arg Thr Gln Gly Gln Lys Lys Val Ala Ser Met Met
1475 1480 1485
Glu Ser Lys Asp Val His Lys Arg Ile Leu Gln Ile Glu Trp Glu His
1490 1495 1500
Lys Lys Met Glu Met Glu Arg Glu Asp Leu Asn Gln Lys Ala Trp Asp
1505 1510 1515 1520
Ile Gln Met Leu Phe Phe Ser Arg Asp Arg Gln Lys Tyr Leu Asn Glu
1525 1530 1535
Pro Asn Tyr Glu Ala Leu Ile Ser Ile Gln Ile Gly Ile Met Glu Gln
1540 1545 1550
Thr Ile Ala Val Leu Asp Lys Met His Lys Lys Asn Val Glu Asn Cys
1555 1560 1565
Lys Lys Leu Leu Lys Lys Leu Gly Lys Phe Ser Asn Gln Lys Asp Ile
1570 1575 1580
Ala Asn Tyr Ala Leu Ser Cys Asn Leu Arg Glu Glu Leu Val Ala Val
1585 1590 1595 1600
Ser Glu Arg Lys Asp Ile Cys Asn Ala Met Gly Ser Lys Leu Thr Cys
1605 1610 1615
Glu Lys Ile Val Lys Glu Arg Tyr Glu Asn Met Met Gln Gln Gln Lys
1620 1625 1630
Leu Thr Asn Ile Ser Lys Gln Gln Ala Glu Gln Ile Ser Ile Leu Gln
1635 1640 1645
Thr Glu Val Glu Arg Leu Arg Met Lys Thr Phe Pro Ala Leu Val Gln
1650 1655 1660
Met
1665
<210>3
<211>19
<212>DNA
<213> Artificial sequence (Homo sapiens)
<400>3
ttgcgataag tggtgctaa 19
<210>4
<211>21
<212>DNA
<213> Artificial sequence (Homo sapiens)
<400>4
cacatggtta tgtaggaatg g 21
<210>5
<211>19
<212>DNA
<213> Artificial sequence (Homo sapiens)
<400>5
cattgttcgc ctccagtaa 19
<210>6
<211>22
<212>DNA
<213> Artificial sequence (Homo sapiens)
<400>6
ctagccagtg ttgtatagga ta 22
<210>7
<211>21
<212>DNA
<213> Artificial sequence (Homo sapiens)
<400>7
ctagagacag taacctaatg g 21
<210>8
<211>20
<212>DNA
<213> Artificial sequence (Homo sapiens)
<400>8
catacgaaca actccaagat 20
<210>9
<211>933
<212>PRT
<213>Homo Sapiens
<400>9
Met Ala Gln Gly Arg Glu Arg Asp Glu Gly Pro His Ser Ala Gly Gly
1 5 10 15
Ala Ser Leu Ser Val Arg Trp Val Gln Gly Phe Pro Lys Gln Asn Val
20 25 30
His Phe Val Asn Asp Asn Thr Ile Cys Tyr Pro Cys Gly Asn Tyr Val
35 40 45
Ile Phe Ile Asn Ile Glu Thr Lys Lys Lys Thr Val Leu Gln Cys Ser
50 55 60
Asn Gly Ile Val Gly Val Met Ala Thr Asn Ile Pro Cys Glu Val Val
65 70 75 80
Ala Phe Ser Asp Arg Lys Leu Lys Pro Leu Ile Tyr Val Tyr Ser Phe
85 90 95
Pro Gly Leu Thr Arg Arg Thr Lys Leu Lys Gly Asn Ile Leu Leu Asp
100 105 110
Tyr Thr Leu Leu Ser Phe Ser Tyr Cys Gly Thr Tyr Leu Ala Ser Tyr
115 120 125
Ser Ser Leu Pro Glu Phe Glu Leu Ala Leu Trp Asn Trp Glu Ser Ser
130 135 140
Ile Ile Leu Cys Lys Lys Ser Gln Pro Gly Met Asp Val Asn Gln Met
145 150 155 160
Ser Phe Asn Pro Met Asn Trp Arg Gln Leu Cys Leu Ser Ser Pro Ser
165 170 175
Thr Val Ser Val Trp Thr Ile Glu Arg Ser Asn Gln Glu His Cys Phe
180 185 190
Arg Ala Arg Ser Val Lys Leu Pro Leu Glu Asp Gly Ser Phe Phe Asn
195 200 205
Glu Thr Asp Val Val Phe Pro Gln Ser Leu Pro Lys Asp Leu Ile Tyr
210 215 220
Gly Pro Val Leu Pro Leu Ser Ala Ile Ala Gly Leu Val Gly Lys Glu
225 230 235 240
Ala Glu Thr Phe Arg Pro Lys Asp Asp Leu Tyr Pro Leu Leu His Pro
245 250 255
Thr Met His Cys Trp Thr Pro Thr Ser Asp Leu Tyr Ile Gly Cys Glu
260 265 270
Glu Gly His Leu Leu Met Ile Asn Gly Asp Thr Leu Gln Val Thr Val
275 280 285
Leu Asn Lys Ile Glu Glu Glu Ser Pro Leu Asp Arg Arg Asn Phe Ile
290 295 300
Ser Pro Val Thr Leu Val Tyr Gln Lys Glu Gly Val Leu Ala Ser Gly
305 310 315 320
Ile Asp Gly Phe Val Tyr Ser Phe Ile Ile Lys Asp Arg Ser Tyr Met
325 330 335
Ile Glu Asp Phe Leu Glu Ile Glu Arg Pro Val Glu His Met Thr Phe
340 345 350
Ser Pro Asn Tyr Thr Val Leu Leu Ile Gln Thr Asp Lys Gly Ser Val
355 360 365
Tyr Ile Tyr Thr Phe Gly Lys Glu Pro Thr Leu Asn Lys Val Leu Asp
370 375 380
Ala Cys Asp Gly Lys Phe Gln Ala Ile Asp Phe Ile Thr Pro Gly Thr
385 390 395 400
Gln Tyr Phe Met Thr Leu Thr Tyr Ser Gly Glu Ile Cys Val Trp Trp
405 410 415
Leu Glu Asp Cys Ala Cys Val Ser Lys Ile Tyr Leu Asn Thr Leu Ala
420 425 430
Thr Val Leu Ala Cys Cys Pro Ser Ser Leu Ser Ala Ala Val Gly Thr
435 440 445
Glu Asp Gly Ser Val Tyr Phe Ile Ser Val Tyr Asp Lys Glu Ser Pro
450 455 460
Gln Val Val His Lys Ala Phe Leu Ser Glu Ser Ser Val Gln His Val
465 470 475 480
Val Tyr Asp Gln Gln Gly Ile Phe Leu Leu Val Gly Thr Ala Glu Gly
485 490 495
Lys Val Phe Ile Ile Asn Ala Asn Ser Ser Ser Ser Phe Gln Ile Ile
500 505 510
Gly Phe Thr Glu Val Ala Lys Asp Ile Leu Gln Ile Ser Thr Val Ser
515 520 525
Leu Leu Glu Thr Asp Ile Val Glu Val Met Val Leu Ser Ser Leu Pro
530 535 540
Glu Ala Gly Arg Ser Arg Leu Glu Met Phe Thr Leu Pro Thr Leu Leu
545 550 555 560
Pro Gln Val Ser Thr Thr Phe Ala Asp Glu Arg Gly Arg Leu Lys Asp
565 570 575
Glu Ile Ile His Lys Tyr Leu Tyr Glu Leu Glu His Ala Leu Ser Ser
580 585 590
Ala Val Leu Gly Phe Gln Ser Asn Gln Ile Tyr Gly Phe Cys Ser Gln
595 600 605
Val Pro Tyr Ile Cys Ser Tyr Leu Leu Pro Glu Glu Glu His Thr Gly
610 615 620
Ile Tyr Ile Leu Lys Pro Tyr Lys Lys Val Gln Ser Arg Gln Tyr Gly
625 630 635 640
Pro Gly Leu Leu Tyr Leu Ser Ser His Gly Leu Trp Leu Ile Thr Ile
645 650 655
Ala Lys Cys Gly Ile Leu Cys Ile Arg Asp Val Tyr Thr Leu Glu Thr
660 665 670
Phe Ala Trp Cys Arg Ser His Ser His Gln Gly His Gly Ile Gln Ser
675 680 685
Met Arg Ile Ser Met Asp Gly Gln Asn Ile Leu Val Asn Gly Arg Asp
690 695 700
Asp Gly Thr Leu Val Tyr Leu Lys Trp Lys Arg Phe Gly Gly His Leu
705 710 715 720
Ala Ser Glu Ile Leu Asp Tyr Tyr Gln Lys Leu Leu Ile Ser Leu Ser
725 730 735
Ser Ala Met Asp Lys Glu Asn His Tyr Leu Ser Thr Thr Pro Lys Val
740 745 750
Ser Val Asp Leu Gly Ser Asp Ser Glu His Thr Lys Gln Lys Ala Ser
755 760 765
Thr Asp Leu Ser Gln Asp Glu Leu Val Leu Thr Asp Val Lys Lys Glu
770 775 780
Ile Pro Trp Ile Gln Gln Lys Ser Gln Glu Ala Ile Lys Lys Glu Val
785 790 795 800
Asn Leu Phe Ser Lys Lys Arg Lys Glu Ile Lys Gln Gly Ile Lys Ser
805 810 815
Leu Ser Lys Thr Ile Leu Asn Met Met Glu Glu Asn Asp Lys Leu Glu
820 825 830
Asn Ile Ala Lys Leu Asp Gln Gln Glu Phe Gly Leu Asp Leu Glu Glu
835 840 845
Leu Glu Arg Leu His Asp Glu Ser Gln Glu Glu Val Ala Lys Met Ile
850 855 860
Lys Asp Val Glu Met His Asn Leu Ala Lys Ser Tyr Leu Ala Glu Leu
865 870 875 880
Ile Lys Glu Glu Cys Trp Asn Ser Met Ala Val Lys Gly Arg Ala Leu
885 890 895
Lys Cys Phe His Ile Pro Cys Val Val Glu Asn Phe Pro Met Lys Ala
900 905 910
Arg Thr Val Glu Glu Leu Lys Glu Leu Glu Arg Val Leu Gln Gln Lys
915 920 925
Lys Ile Glu Ala Glu
930
Claims (3)
1. A biomarker of sperm flagellar Multiple Morphological Abnormality (MMAF) characterized by a mutated CFAP43 gene, the biomarker being a mutated CFAP43 gene having:
a splice site deletion mutation in exon 30 (c.3661-2A >);
the mutated CFAP43 gene has the following mutations in the sequence of SEQ ID NO: 1:
deletion mutation of splice site in exon 30 (c.3661-2A >).
2. A nucleic acid probe complementary to a mutant CFAP43 gene, characterized in that the mutation is a splice site deletion mutation (c.3661-2A >) in exon 30, and the cDNA sequence of the wild-type CFAP43 gene is shown as SEQ ID NO:1 is shown.
3. A kit for detecting a mutant CFAP43 gene, comprising the nucleic acid probe of claim 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710866969.0A CN107523628B (en) | 2017-09-22 | 2017-09-22 | MMAF (MMAF-mediated acute respiratory syndrome) pathogenic new gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710866969.0A CN107523628B (en) | 2017-09-22 | 2017-09-22 | MMAF (MMAF-mediated acute respiratory syndrome) pathogenic new gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107523628A CN107523628A (en) | 2017-12-29 |
| CN107523628B true CN107523628B (en) | 2020-02-14 |
Family
ID=60736179
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710866969.0A Active CN107523628B (en) | 2017-09-22 | 2017-09-22 | MMAF (MMAF-mediated acute respiratory syndrome) pathogenic new gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107523628B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109097464B (en) * | 2018-09-19 | 2021-12-14 | 中国医学科学院阜外医院深圳医院(深圳市孙逸仙心血管医院) | Application of SNP (single nucleotide polymorphism) site of CFAP43 gene |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107176994A (en) * | 2017-06-26 | 2017-09-19 | 厦门市妇幼保健院（厦门市计划生育服务中心） | A kind of new Disease-causing genes of MMAF and its application |
| CN107176993A (en) * | 2017-06-26 | 2017-09-19 | 厦门市妇幼保健院（厦门市计划生育服务中心） | A kind of MMAF Disease-causing genes new mutation and its application |
-
2017
- 2017-09-22 CN CN201710866969.0A patent/CN107523628B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107176994A (en) * | 2017-06-26 | 2017-09-19 | 厦门市妇幼保健院（厦门市计划生育服务中心） | A kind of new Disease-causing genes of MMAF and its application |
| CN107176993A (en) * | 2017-06-26 | 2017-09-19 | 厦门市妇幼保健院（厦门市计划生育服务中心） | A kind of MMAF Disease-causing genes new mutation and its application |
Non-Patent Citations (1)
| Title |
|---|
| Biallelic Mutations in CFAP43 and CFAP44 Cause Male Infertility with Multiple Morphological Abnormalities of the Sperm Flagella;Shuyan Tang等;《Am J Hum Genet》;20170525;第100卷(第6期);摘要，表1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107523628A (en) | 2017-12-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yang et al. | Genetic etiology study of the non-syndromic deafness in Chinese Hans by targeted next-generation sequencing | |
| Karayiorgou et al. | Schizophrenia susceptibility associated with interstitial deletions of chromosome 22q11. | |
| Aretz et al. | Familial adenomatous polyposis: aberrant splicing due to missense or silent mutations in the APC gene | |
| Weisschuh et al. | Deep‐intronic variants in CNGB3 cause achromatopsia by pseudoexon activation | |
| CN110541025A (en) | Detection method, primer composition and kit for Duchenne muscular dystrophy gene defect | |
| CN107176994B (en) | MMAF novel pathogenic gene and application thereof | |
| CN107164520A (en) | A kind of new Disease-causing gene of severe asthenospermia and its application | |
| CN102618549A (en) | NCSTN mutant gene, and its identification method and tool | |
| Beit-Ya'acov et al. | Homozygosity for a novel ABCA4 founder splicing mutation is associated with progressive and severe Stargardt-like disease | |
| CN107523628B (en) | MMAF (MMAF-mediated acute respiratory syndrome) pathogenic new gene and application thereof | |
| CN104450727A (en) | Pathogenic gene for X-linked hypophosphatemic rickets as well as protein encoded by pathogenic gene and application of pathogenic gene | |
| CN104745592B (en) | CYP4V2 gene mutant and application thereof | |
| Musolf et al. | Caucasian families exhibit significant linkage of myopia to chromosome 11p | |
| Growney et al. | Evolutionary divergence of the mouse and human Lgn1/SMA repeat structures | |
| Abd El‐Aziz et al. | A novel genetic study of Chinese families with autosomal recessive retinitis pigmentosa | |
| CN112626193A (en) | Gene chip, kit comprising gene chip and application of gene chip | |
| CN103757028A (en) | OSBPL2 mutant gene as well as identification method and detection kit thereof | |
| CN107475423B (en) | New pathogenic gene of headless spermatozoon disease and application thereof | |
| CN107475420A (en) | The pathogenic new gene of sperm disease without a head and its application | |
| CN108504660A (en) | ADCY10 gene mutation bodies and its application | |
| Liu et al. | Targeted next generation sequencing identified novel loss‐of‐function mutations in MERTK gene in Chinese patients with retinitis pigmentosa | |
| CN107176993A (en) | A kind of MMAF Disease-causing genes new mutation and its application | |
| CN108866067B (en) | Pathogenic mutation of Leber congenital amaurosis and detection reagent thereof | |
| CN104745591B (en) | CYP4V2 gene mutant and application thereof | |
| JPH11510059A (en) | Genetic diagnostic co-dominance test |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |