CN107132358A - A kind of ox source creatine kinase isozyme double-antibody sandwich elisa quick detection kit - Google Patents

Abstract

The present invention relates to a kind of ox source creatine kinase isozyme (CK BB) double-antibody sandwich elisa quick detection kit and to ox source creatine kinase isozyme (CK BB) detection method.The present invention has the advantages that quantitative, detectable concentration scope is big, sensitivity is high, high specificity, reproducible, detection required time are short, cow endometritis Rapid＆Early diagnosis new method is set up, realizes that carrying out cow endometritis quick detection and adjuvant clinical inspection makes diagnosis.

Description

A kind of ox source creatine kinase isozyme double-antibody sandwich elisa quick detection kit

Technical field

The present invention relates to colloidal gold immunochromatographimethod field of fast detection, and in particular to a kind of ox source creatine kinase isozyme (CK-BB) double-antibody sandwich elisa quick detection kit and method.

Background technology

China's dairy development in recent years is very rapid, but development of the infertility to milk cow production has important shadow Ring.Great mass of data shows that infertility accounts for the 20%~30% of cow disease, and endometritis accounts for the 40%~60% of infertility. Cause the cause of disease of cow endometritis more, but caused by main cause is the early infection in postpartum, there are some researches show milk cow production Early stage afterwards has 93% Niu Fasheng uterine infection bacteriums, and 39% is reduced to infection rate at 46-60 days.

Cow endometritis prevents embryonated egg from implantation or embryo's Deaths, delays the calving interval, has a strong impact on The breeding of milk cow and production capacity and efficiency, great economic loss is caused to Cow product.According to document announcement, the U.S. has every year 12.19% milk cow is eliminated due to infertility or reproductive diseases, accounts for the 52.37% of superseded cow, every year because infertility is damaged Lose up to 2.7 hundred million dollars；Beijing Agricultural University accounts for infertile milk to 16 urban surveys such as Beijing, Nanjing, Shanghai, endometritis The 68.34% of ox, domestic infertile milk cow superseded every year accounts for the 60%-70% for eliminating sum.

Creatine kinase (Creatine Kinase, CK；EC 2.7.3.2) 81000~82000Da of molecular weight is by two The dimer of subunit (M and B) composition, turns phosphoryl reaction, in creatine and phosphocreatine between reversible catalysis creatine and ATP Played an important role in conversion reaction.Such as in energetic supersession most vigorous musculature and brain tissue, CK activity is Highest.In internal organs, uterus is the active organs of CK the 3rd, and first two are skeletal muscle and cardiac muscle.According to its isodynamic enzyme The difference of subunit and distributing position, there are three kinds of CK isoenzymes in ox, wherein：CK-MM (being specifically present in skeletal muscle), CK-MB (being specifically present in cardiac muscle) and CK-BB (being obtained from bovine brain).The above isoenzymes is all present in cytoplasm, Galitzer and Oehme (1985) will much lack to the CK of all organs of the ox CK contain in detection discovery, internal organs In skeletal muscle and cardiac muscle, and most CK belongs to isozyme C K-BB.In healthy cow's serum CK composition almost all by CK-MM is constituted, but research finds also to there are detectable CK- in pregnancy neutralizes postpartum women, the serum of Pregnant guinea pigs BB (brain source or smooth muscle source) and CK-MB (Clark et al., 1994).The reason for causing above phenomenon is likely to be in bosom The late pregnancy demand higher to energy (metabolism) (Clark et al., 1994), i.e. uterine tissue are before and after childbirth to it Mechanicalness and metabolism have higher requirement (Abramov et al., 1996).

We, which study, shows after endometrium infection inflammation that serum creatine kinase activity significantly increases, according to the study result its can It is used as the important diagnostic index of cow endometritis.At present, the diagnosis of cow endometritis rely primarily on visual examination, palpation and , there is early diagnosis diagnosis rate low and the problem of cause implantable pathogen superinfection in the conventional method based on uterine probe. Therefore, in the urgent need to a kind of quick, sensitive, economic and practical, behaviour suitable for cow endometritis early stage investigation is set up in research Make easy field fast detection method.

The content of the invention

This research is according to cow endometritis and the positive correlation of serum creatine kinase activity, by recombinantly expressing Niu Yuan Creatine kinase isozyme (CK-BB), prepares screening mouse resource monoclonal antibody, further utilizes double antibody sandwich ELISA development A kind of double-antibody sandwich elisa kit of quick detection ox source creatine kinase isozyme (CK-BB), for monitor on field production The change of milk cow creatine kinase isozyme (CK-BB) afterwards.

It is an object of the invention to provide a kind of double-antibody sandwich elisa reagent of ox source creatine kinase isozyme (CK-BB) Box and method, thus quick detection endometritis immediately, the method detected by double-antibody sandwich elisa kit, The concentration of creatine kinase isozyme (CK-BB) in cow's serum is detected, so that for assessing cow endometritis situation, accurately, Quickly, sensitivity is high, without professional's operation, and cost is relatively low, is easy to promote the use of.

To reach above-mentioned purpose, the present invention uses the first technical scheme：A kind of ox source creatine kinase isozyme (CK-BB) Double-antibody sandwich elisa kit, including：The ELISA Plate of coating capture antibody, confining liquid, cleaning solution, substrate nitrite ion is terminated Liquid and detection antibody.

The capture antibody is the anti-CK-BB monoclonal antibodies of mouse.

The detection antibody is the anti-CK-BB monoclonal antibodies of mouse of HRP marks.

Utilize the double-antibody sandwich elisa kit detection ox source creatine of ox source creatine kinase isozyme (CK-BB) The method of kinase isozyme (CK-BB), its step is as follows：

(1) CK-BB monoclonal antibodies are diluted to 5ug/ml with CB, per hole 100ul, 4 DEG C of coatings are stayed overnight；

(2) board-washing 3-5 times, is patted dry, mark product/sample 100ul, 25 DEG C of reaction 45min；

(3) board-washing 3-5 times, is patted dry, and adds enzyme labelled antibody, and 25 DEG C of lucifuges react 30min；

(4) board-washing 3-5 times, is patted dry, and adds developer, and 25 DEG C of lucifuges react 15min；Plus measured value OD450 after terminate liquid

(5) foundation of normal equation：The ox source creatine kinase isozyme (CK-BB) of concentration known is determined using ELIASA, Obtain corresponding OD₄₀₅- CK-BB log concentration values, fitting draws linear criterion linear equation；

(6) measure of testing sample：By the OD measured₄₀₅Value substitutes into equation, the y values calculated as x values, and y values are CK- The logarithm value of BB concentration (ng/ml), and then calculate the concentration of CK-BB in testing sample.

Compared with prior art, beneficial effects of the present invention at least that：In kit, detection label CK-BB is used as Monoclonal antibody, flag condition is mature and stable nontoxic, kit resolution ratio itself, sensitivity, stable stronger, can do quantitative inspection Survey.

The CK-BB double-antibody sandwich elisas quick detection kit and detecting system of the present invention, it is simple to operate directly to heal Final proof sheet, detection time are short, are suitable for promoting the use of, and overcome existing chemoluminescence method, expensive, and detection is time-consuming and needs The shortcoming of professional operator is put into, energy independent process data are particularly suitable for cow's serum CK-BB water so as to the advantage quantitatively detected Put down the detection in basic unit pasture.

The present invention improves detection serum creatine kinase index and disclosed by clinical verification, evaluation and to the perfect of this method With sensitivity, the accuracy of reaction cow uteri endometrial inflammation degree of inflammation, cow endometritis early stage is finally set up quick New method is diagnosed, accomplishes not needing special instrument, by simple operations, realizes and cow endometritis scene is carried out in field soon Rapid＆Early diagnosis is made in speed detection and adjuvant clinical inspection.

Brief description of the drawings

Below in conjunction with the accompanying drawings and embodiment the invention will be further described：

Fig. 1 is that reference material uses SDS-PAGE electrophoresis with OX-heart source creatine kinase (CK-MB), detects endometritis ox blood CK reference materials in final proof sheet, figure are commercial cattle source CK-MB and rabbit source CK；

Fig. 2 samples cow's serum detects that Fig. 2-A are that constant exposure time takes to obtain WB photos, are schemed with CK-BB polyclonal antibodies WB 2-B takes to obtain WB photos to expose for a long time；Fig. 2-C show that the equal and anti-CK-BB polyclonal antibodies in all sample serum have specifically Property reaction；

Fig. 3 plasmids pET28b-CK-BB is through Nde I and Xho I double digestions；

The protein induced results of Fig. 4 ox isoenzymes of creatine kinase CK-BB：1：Total protein before induction, 2：20 DEG C of supernatants；3：20℃ Precipitation；4：37 DEG C of supernatants；5：37 DEG C of precipitations；

Fig. 5 ox isoenzymes of creatine kinase CK-BB proteins purify SDS-PAGE analysis charts, M：Protein marker； 1：Loading；2：Outflow；3：10mM Imidazole elution fractions；4：20mM Imidazole elution fractions；5-9：50mM Imidazole elution fractions；10-12：500mM Imidazole elution fractions；

Fig. 6 is ox isoenzymes of creatine kinase CK-BB protein SDS-PAGE analysis charts, M：Protein marker；1： Destination protein；

Fig. 7 ox isoenzymes of creatine kinase CK-BB albumen Western Blot analysis charts M：Protein marker；1：Purpose Albumen；

Fig. 8 kit Elisa condition optimizing canonical plottings；

Fig. 9 Elisa linear criterion linear equations.

Embodiment

Creatine kinase and the correlation research of endometritis in the cow serum of embodiment 1.

Acquirement is diagnosed as the serum with endometritis ox by conventional method, detects its creatine kinase (CK) value, leads to Control and the comparison of positive group are crossed, the correlation of bovine endometritis and CK is determined.

Collect many parts of clinical symptoms from Huhehaote and packet header periphery cattle farm and suffer from ox blood for cow endometritis Clearly, carry out biochemical analysis and detection creatine kinase vigor and obtain related data.With OX-heart source creatine kinase (CK-MB) for reference material Using SDS-PAGE electrophoresis, detection endometritis cow's serum sample (Fig. 1), by the size and color of observing purpose band The depth judges clinical serum sample CK and uniformity and degree of conformity of the OX-heart source creatine kinase (CK-BB) for reference material.Tentatively grind Study carefully result as follows：1st, clinical diagnosis increases for the CK activity in the infected cattle serum sample of cow endometritis is more notable than healthy ox value It is high.The serum creatine kinase activity of normal ox only is concentrated mainly on 100-200U/L, infected cattle is only in 200- in 80-200U/L 1796U/L.2nd, the CK reference materials in figure are commercial cattle source CK-MB and rabbit source CK, have larger difference with clinical serum sample CK, are tied Close the CK monitoring results about humans and animals, primitive decision and clinical definite the infected cattle serum sample CK that to be endometritis related Essence is CK-BB.

The clinical symptoms that we also collect from cattle farm meet 6 parts of the infected cattle serum of cow endometritis, carry out CK work Power detects (table 1), while using protein immunoblot method Wenstern-Blot, the polyclonal of CK-BB is recombinantly expressed with rabbit-anti CK and recombination expression CK-BB polyclonal antibodies specific binding rate (Fig. 2) in antibody test clinical sample serum, to investigate weight Group expression CK-BB and clinical serum sample CK correlation, as a result show：1st, 6 clinical definite endometritis infected cattle serum Middle creatine kinase CK activity increases.2nd, recombination expression CK-BB rabbit source polyclonal antibody and clinical definite endometritis disease Creatine kinase CK has specific combination in cow's serum, and theoretical foundation has been established to develop colloidal gold immuno-chromatography test paper strip.

The sample cow's serum CK viability examinations of table 1

The correlation research result and recombinant bovine creatine kinase of creatine kinase and endometritis are same in comprehensive cow serum Work enzyme (CK-BB) protein immunoblot (Western-Blot) analysis result, it may be determined that by recombinant bovine creatine kinase isozyme (CK-BB) start to develop detection ox source creatine kinase isozyme (CK-BB) double-antibody sandwich elisa quick detection kit.

The full genome of embodiment 2. synthesis ox isoenzymes of creatine kinase CK-BB

Because ox isoenzymes of creatine kinase CK-BB has high correlation in bovine endometritis and serum, therefore use ox Isoenzymes of creatine kinase CK-BB prepares related monoclonal antibody as antigen and resisted more.In the present invention, crucial reagent bovine brain source or flat Sliding flesh source creatine kinase CK-BB shortage, seriously constrains the development of experiment.Because CK-BB application is smaller, ox on the market Most of source creatine kinase is the commodity without CK-BB using CK-MB as main component, and difficulty is caused to research.

In order to solve the problem of CK-BB is not enough, inventor's research determines the method synthesis ox source CK- synthesized using full genome BB genes, and prokaryotic expression is carried out to it.Ox creatine kinase CK-BB amino acid sequence, Serial No. are inquired by NCBI： GenBank:AAX08725.1 and the codon optimization for carrying out being applied to e. coli bl21 to it, it is artificial synthesized using two step method Ox CK-BB full genome.Next synthetic full genome is connected to expression vector pET28b, is transformed into e. coli bl21 (DE3) a large amount of destination proteins, have been measured through a small amount of expression experiments to express, have been successfully prepared ox isoenzymes of creatine kinase CK-BB's Colibacillus engineering, is largely to prepare ox CK-BB the later stages to have established solid foundation.Sketch experimentation as follows：

2.1 CK-BB gene genetics codons are transformed and the design of primer and artificial synthesized

According to ox isoenzymes of creatine kinase CK-BB amino acid sequence (GenBank:AAX08725.1), it is soft in Bioedit The nucleotide sequence of the gene is derived under the auxiliary of part, initiation codon ATG and terminator codon TAA are made an addition to respectively 5 ' the ends and 3 ' ends of CK-BB sequences；Using DNAworks softwares on the basis of e. coli codon frequency of use, to the gene Codon optimize, design of primers synthesizes 54 40bp primers overlapped each other, therefrom chooses primer CK-1 and CK-54 (being shown in Table 2) introduces Nde I and Xho I restriction enzyme sites respectively.It is standby after purification through desalination, PAGE after primer synthesis.

Primer	Primer sequence
		CK-1	GCCTGGTGCCGCGCGGCAGCCATATGCCTTTCAGCAA
CK-54	CAGTGGTGGTGGTGGTGGTGCTCGAGTTTCTGC

The CK-BB full genomes of table 2 are synthesized and amplification coding DNA primer sequence

2.2 Ns of isoenzymes of creatine kinase CK-BB full genome synthesis

First to synthesis CK-BB full genome sequencing results, subsequent artificial synthesized improved ox isoenzymes of creatine kinase CK- BB complete genome sequences (SEQ ID NO:1), the plasmid pET28b-CK-BB of synthesis can be through Nde I and Xho I double digestions (Fig. 3).

2.3 by prokaryotic expression system, a small amount of expression recombinant bovine isoenzymes of creatine kinase CK-BB albumen.

PET28b-CK-BB positive plasmids convert prokaryotic expression Host Strains BL21 and Rosetta, are coated on correspondence solid training Support base, 37 DEG C of culture 12-16h.Picking single bacterium falls within correspondence fluid nutrient medium culture 12-16h, preserves glycerol stock in -80 DEG C.Bacterium Plant activation：Recovery strain, 37 DEG C of incubated overnight activation.Induced expression：Next day, strain is with 1：50 expand culture 5mL, 37 DEG C of cultures To OD600=0.4-0.6,2.5mL strains are collected through processing as control before induction.Remaining 2.5mL adds 0.5mM IPTG, 37 DEG C of induced expression 3h, the thalline being collected by centrifugation is through handling as postinduction sample, and SDS-PAGE identifies the expression of albumen.

Prokaryotic expression carrier information：

Recovery PET28b-CK-BB (BL21) strain, 37 DEG C of incubated overnight activation.Next day, strain is with 1：50 expand culture 800mL, 37 DEG C of cultures to OD600=0.4-0.6, adds 0.5mM IPTG, 37 DEG C of induced expression 5h.8000rpm, 4 DEG C of centrifugations 5min, collects thalline.Plus 100mL crushes liquid and carries out ultrasonic treatment.Cracking condition：Temperature ice bath, power 60%, ultrasound 2s, It is spaced 2s, time 15min.12000rpm, 4 DEG C of centrifugation 15min, collect supernatant precipitation.SDS-PAGE is detected, judges purpose egg White expression-form.Using high-affinity NI purifying resin supernatants, collection flows through liquid, eluent, and SDS-PAGE detection albumen is pure Change effect.The destination protein dialysis of purifying is removed into imidazoles, SDS-PAGE detection albumen dialysis-effects.

Detection results are as follows：

(1) the protein induced results of ox isoenzymes of creatine kinase CK-BB

It is heavy at 37 DEG C it can be seen from SDS-PAGE figures by carrying out SDS-PAGE analyses (Fig. 4) to recombination expression sample There is obvious expression in shallow lake.

(2) ox isoenzymes of creatine kinase CK-BB proteins nickel agarose affinity chromatography SDS-PAGE results (Fig. 5) pass through Figure SDS-PAGE analysis charts are eluted successively when can be seen that destination protein 50mM, 100mM and 500mM Imidazole, The purity of destination protein is preferable when at 500mM.Albumen plus 0.3%SKL at 10-12 is taken to dialyse to 10MmPBS, 0.1% In SKL, pH 8.0.Concentration, filtration sterilization, packing is after -80 DEG C of preservations.

(3) ox isoenzymes of creatine kinase CK-BB albumen finally purifies SDS-PAGE analyses (Fig. 6)

(4) ox isoenzymes of creatine kinase CK-BB albumen Western Blot analyze (Fig. 7)

The preparation of embodiment 3.CK-BB monoclonal antibodies

1. lab scale：PET28b-CK-BB positive plasmids convert BL21 and Rosetta Host Strains, and lab scale has obvious expression.

2. it is prepared by antigen：A large amount of induced expression PET28b-CK-BB (BL21), destination protein is obvious in supernatant inclusion body Expression, preferentially purifies supernatant, and supernatant is purified, dialysis, finally gives CK-BB recombinant protein 5mg, purity of protein ＞ 90%.

3. more than it is anti-prepare：It is prepared for polyclonal antibody, potency 1:243000.

4. it is prepared by monoclonal antibody：Monoclonal antibody is prepared for, 5 plants of positive cell strain is screened.

5. Antibody preparation and purifying：Ascites is planted, purifying obtains monoclonal antibody.

6. antibody conjugates are screened：Pairing screening is carried out to antibody using ELISA method, the antibody pair that can be matched is obtained.

7.ELISA condition optimizings：The best antibody of effect is chosen to carrying out ELISA condition optimizings.

Preparation method is summarized as follows：

Take 2 month female new zealand white rabbit one to be immunized, three times are carried out altogether and is immunized, takes leg muscle multiple spot to note Penetrate.Every new zealand white rabbit antigen immune consumption is 500ug every time, and initial immunity is emulsified with equivalent Freund's complete adjuvant, the Secondary immunity is emulsified with equivalent incomplete Freund's adjuvant, and third time is immune to be mixed with normal saline, ear vein injection.Second Secondary immune rear 14 days venous blood collections, are surveyed antibody titer by indirect method, the antibody tormation for target are determined whether with this.Effect Third time carries out booster immunization after valency is up to standard；Potency is not up to standard, then third time continuation incomplete Freund's adjuvant is subcutaneously exempted from Epidemic disease, the 4th progress booster immunization after 28 days.Booster immunization takes blood after 14 days.

Take 6 week old female BAl BIcs/c mouse four to be immunized, three times are carried out altogether and is immunized, take batch lower multi-point injection.Often It is 25ug that consumption, which is immunized, in secondary every murine antigen, and initial immunity is emulsified with equivalent Freund's complete adjuvant, second of immune equivalent Incomplete Freund's adjuvant is emulsified, and third time is immune to be mixed with normal saline, is injected intraperitoneally.Second of immune rear 10 days tail is quiet Arteries and veins is taken a blood sample, and antibody titer is surveyed by indirect method, and the antibody tormation for antigen is determined whether with this.Compare four mouse effects Valency, finally selects the higher mouse of antibody titer to be used for cell fusion.First three day is merged, with the direct booster immunization of antigen once, Dosage is the same.

Taken out from liquid nitrogen and freeze myeloma cell's cell, be immediately placed in 37 DEG C of water-baths and melt, supernatant is abandoned in centrifugation, is used A small amount of complete culture solution breaks up cell mass, adds about complete medium in cryopreservation tube, is blown and beaten uniformly with suction pipe, all suctions out and turns Into Tissue Culture Flask, it is placed in 37 DEG C of CO2gas incubators and cultivates.Reached after cell covers with bottom of bottle in another cell bottle Culture, observes its cell state under inverted microscope, and cell in good condition is standby to do fusion use.

The mouse of potency highest and booster immunization is taken, eyeball excise blood sampling, separation serum is used as positive control during detection Serum.Mouse cervical dislocation is lethal, alcohol disinfecting is soaked in, is moved into superclean bench, is fixed on dissection plate, with sterilizing Scissors, tweezers cut off left side skin and peritonaeum respectively, and sterile taking-up spleen is placed in the sterilized petri dishes for having filled basic culture solution Clear Xian, peels off the connective tissue on envelope.Spleen is moved into another Sheng to there are about in the filter membrane in the plate of basic culture solution, with two Curved needle head on individual syringe is by spleen acanthopore, and then one of curved needle head fixes filter membrane, another curved needle head extruding filter membrane, Splenocyte is set to be completely discharged in the basic culture solution in plate.Single cell suspension is made with sterile dropper piping and druming cell, harvests Splenocyte suspension.Splenocyte suspension in plate is transferred in centrifuge tube, is centrifuged, is abandoned supernatant, use cell culture fluid centrifuge washing Once.Isolated splenocyte is merged with the standby myeloma cell that recovers in advance with PEG, centrifuges, abandons supernatant, is used Once, addition blows and beats into single cell suspension to cell culture fluid centrifuge washing with HAT cell culture fluid, spreads into 96 hole cell culture Plate.The 7th day after cell fusion, cultivation plate hole bottom grows macroscopic clone, first by ELISA indirect methods to all cells Hole is screened for the first time, and the cell hole of strong positive is presented in record.Each cell hole being positive to primary dcreening operation should be in time in 24 hole cells Culture and cloning are enlarged in culture plate.Cell suspension serial dilution to statistically every hole is loaded using limiting dilution assay Only contain individual cells, be transferred to 96 orifice plate cultures, operated by cloning for several times, until all cloning cell holes detect positive When rate is 100%, you can it is determined that having obtained the hybridoma cell strain of secrete monoclonal antibody.By the positive hybridoma cell of acquisition Expand culture in Tissue Culture Flask, then freeze and prepare ascites etc..

6 week old Healthy female mouse are taken, 0.5ml atoleine sensitization, after one to two weeks, every mouse peritoneal is injected intraperitoneally Inject 1-2X10⁶Individual hybridoma, observation mouse state collects ascites after 7-10 days after mouse peritoneal substantially expands, and centrifuges Supernatant is ascites, packing, mark, standby.Ascites centrifugation 15min (4000rpm, room temperature), takes supernatant, in the case where 4 DEG C are stirred Saturated ammonium sulfate is slowly added to dropwise to semi-saturation, is continued to stir 30min, centrifugation 30min (13000rpm, 4 DEG C), is abandoned supernatant； Precipitation is dissolved in appropriate PBS (0.01M, pH7.4)；Saturated ammonium sulfate is slowly added under being stirred at 4 DEG C dropwise to 33%, continues to stir 30min, centrifugation 30min (13000rpm, 4 DEG C), abandons supernatant；Precipitation is dissolved in appropriate PBS (0.01M, pH7.4), and 4 DEG C were dialysed Night, determine antibody content, -20 DEG C freeze it is standby.Continue to be purified using Protein G pillars after ammonium sulfate precipitation, new post Son first crosses post with 5ml ultra-pure waters, then purifies pillar with 5ml 0.4M PB buffer solutions (pH 7.0) balance；Antibody crosses post, during It is required that slow cross post, preferably combined in the hope of antibody protein on binding site；Continue 10ml 0.4M PB buffer solutions (pH 7.0) balance purifying pillar；Antibody on 5ml 0.1M glycine-HCIs buffer solution (pH 2.7) elution of bound site, and add 1M Tris-HCl (pH 8.0) neutralize glycine, pH is remained the neutrality that suitable antibody is preserved.

Application mouse antibody subtype identification kit is measured and determines antibody titer using indirect ELISA method.

The preparation method of the double-antibody sandwich elisa kit of 4. Ns of source creatine kinase isozymes (CK-BB) of embodiment

1.ELISA condition optimizings

2.1 single-mono- pairing sensitivity techniques

Preferable 2 groups of effect of pairing is chosen, sensitivity technique is carried out.

Two monoclonal antibodies of FL155-2/4 reach as antibody, FL155-1-HRP is caught as detection antibody, detection sensitivity 12.5ppb。

2.2 kit condition optimizings

FL155-2 monoclonal antibodies carry out condition optimizing (Fig. 8) as antibody, FL155-1-HRP is caught as detection antibody.

Mark product ppb	OD
		80	2.207
40	1.192
		20	0.763
10	0.409
		0	0.075

It is final to determine, FL155-2 monoclonal antibodies 5ug/ml coatings, FL155-1-HRP 1:1k dilutes, and detection sensitivity reaches 10ppb, range of linearity 10-80ppb.

The detection method of the double-antibody sandwich elisa kit of 5. Ns of source creatine kinase isozymes (CK-BB) of embodiment

1st, detection method

Detect that operating procedure is as follows to actual sample using double crush syndrome method：

A, with CB CK-BB monoclonal antibodies are diluted to 5ug/ml, per hole 100ul, 4 DEG C of coatings are stayed overnight；

B, board-washing 3-5 times, are patted dry, mark product/sample 100ul, 25 DEG C of reaction 45min；

C, board-washing 3-5 times, are patted dry, and add enzyme labelled antibody, and 25 DEG C of lucifuges react 30min；

D, board-washing 3-5 times, are patted dry, and add developer, and 25 DEG C of lucifuges react 15min；

E, plus terminate liquid after measured value OD450.

2nd, preliminary experiment

Detection is weakly positive after 6 samples, 10 times of dilutions, next reduction Sample Dilution multiple.

3rd, actual sample is detected

According to the testing result and sample size of preliminary experiment, the dilution factor of serum sample is adjusted to 2.

3.1 standard curves map (Fig. 9)：

3 groups of samples are provided, CK-BB serum sample testing results are as follows：

Conclusion：3 groups of 2 times of dilutions of totally 31 samples, can be detected, specific data are with reference to testing result substantially.

Certainly the above embodiments merely illustrate the technical concept and features of the present invention, and its object is to allow be familiar with technique People can understand present disclosure and implement according to this, it is not intended to limit the scope of the present invention.It is all according to this hair Equivalent transformation or modification that the Spirit Essence of bright main technical schemes is done, should all be included within the scope of the present invention.

Claims (4)

1. a kind of double-antibody sandwich elisa kit of ox source creatine kinase isozyme (CK-BB), including：Coating capture antibody ELISA Plate, confining liquid, cleaning solution, substrate nitrite ion, terminate liquid and detection antibody.

2. the double-antibody sandwich elisa kit of the ox source creatine kinase isozyme (CK-BB) according to claim 1, Characterized in that, the capture antibody is the anti-CK-BB monoclonal antibodies of mouse, the detection antibody is to detect that antibody is that the mouse that HRP is marked resists CK-BB monoclonal antibodies.

3. a kind of double-antibody sandwich elisa kit detection ox source creatine kinase of ox source creatine kinase isozyme (CK-BB) is same The method of work enzyme (CK-BB), its step is as follows：(1) CK-BB monoclonal antibodies are diluted to 5ug/ml with CB, per hole 100ul, 4 DEG C of coatings Overnight；(2) board-washing 3-5 times, is patted dry, mark product/sample 100ul, 25 DEG C of reaction 45min；(3) board-washing 3-5 times, is patted dry, and adds enzyme Labeling antibody, 25 DEG C of lucifuges react 30min；(4) board-washing 3-5 times, is patted dry, and adds developer, and 25 DEG C of lucifuges react 15min；Plus eventually Only measured value OD450 after liquid；(5) foundation of normal equation：The ox source creatine kinase isozyme of concentration known is determined using ELIASA (CK-BB) corresponding OD, is obtained₄₀₅- CK-BB log concentration values, fitting draws linear criterion linear equation；(6) testing sample Determine：By the OD measured₄₀₅Value substitutes into equation, the y values calculated as x values, and y values are the logarithm value of CK-BB concentration (ng/ml), And then calculate the concentration of CK-BB in testing sample.

4. it is prepared by the double-antibody sandwich elisa kit of the ox source creatine kinase isozyme (CK-BB) described in claim 1 Detect the application in bovine endometritis reagent.