CN107132358B - Bovine-derived creatine kinase isoenzyme double-antibody sandwich ELISA rapid detection kit - Google Patents

Abstract

The invention relates to a bovine-derived creatine kinase isoenzyme (CK-BB) double-antibody sandwich ELISA rapid detection kit and a detection method of the bovine-derived creatine kinase isoenzyme (CK-BB). The method has the advantages of quantification, large detection concentration range, high sensitivity, strong specificity, good repeatability, short detection time and the like, establishes a new method for quickly diagnosing the endometritis of the milk cow at the early stage, and realizes quick detection of the endometritis of the milk cow and diagnosis by assisting clinical examination.

Description

Bovine-derived creatine kinase isoenzyme double-antibody sandwich ELISA rapid detection kit

Technical Field

The invention relates to the field of colloidal gold immunochromatography rapid detection, in particular to a bovine creatine kinase isoenzyme (CK-BB) double-antibody sandwich ELISA rapid detection kit and a method.

Background

In recent years, the development of the dairy cow industry in China is very rapid, but infertility has important influence on the development of the dairy cow breeding industry. A large number of data show that infertility accounts for 20-30% of cow diseases, and endometritis accounts for 40-60% of infertility. The causes of cow endometritis are more, but the main cause is postpartum early infection, and researches show that 93 percent of cows in the early postpartum stage of cows have uterine infection bacteria, and the infection rate is reduced to 39 percent by 46 to 60 days.

The endometritis of the milk cow can prevent fertilized eggs from being implanted or lead embryos to die early, thereby delaying the calving interval, seriously influencing the reproductive capacity and the production capacity and the efficiency of the milk cow and causing great economic loss to the production of the milk cow. The data reports that 12.19% of cows in the united states are rejected annually due to infertility or reproductive disease, accounting for 52.37% of rejected cows, with annual infertility losses of $ 2.7 million; according to 16 urban surveys such as Beijing, Nanjing, Shanghai and the like by Beijing agriculture university, endometritis accounts for 68.34% of the number of the infertile cows, and the number of the rejected infertile cows accounts for 60% -70% of the total number of the rejected infertile cows every year in China.

Creatine Kinase (CK; EC 2.7.3.2) has a molecular weight of 81000-82000 Da, is a dimer consisting of two subunits (M and B), reversibly catalyzes the transphosphoryl reaction between Creatine and ATP, and plays an important role in the conversion reaction of Creatine and phosphocreatine. For example, CK activity is highest in muscle tissue and brain tissue where energy metabolism is most vigorous. Among the visceral organs, the uterus is the third active organ of CK, and the first two are skeletal muscle and cardiac muscle. There are three CK isozymes in cattle, depending on their isozyme subunits and distribution positions, among which: CK-MM (specific for skeletal muscle), CK-MB (specific for cardiac muscle) and CK-BB (obtained from bovine brain). These isozymes are present in cytoplasm, and it was found that when CK is detected in all bovine organs by Galitzer and Oehme (1985), CK contained in visceral organs is much less than that in skeletal muscle and cardiac muscle, and most of CK is isozyme CK-BB. The CK composition in the serum of healthy cattle is almost entirely composed of CK-MM, but it has been found that CK-BB (of brain or smooth muscle origin) and CK-MB (Clark et al, 1994) are also detectable in the serum of pregnant and postpartum women, pregnant guinea pigs. The reason for this is probably the higher demand for energy (metabolism) in the late pregnancy (Clark et al, 1994), i.e. the higher mechanical and metabolic requirements of the uterine tissue before and after parturition (Abramov et al, 1996).

The research shows that the serum creatine kinase activity is obviously increased after the endometrium infection is inflamed, and the creatine kinase can be used as an important diagnostic index of the cow endometritis according to the research result. At present, the diagnosis of the cow endometritis mainly depends on the traditional methods of visual examination, palpation and uterine probe, and has the problems of low diagnosis rate in early diagnosis and secondary infection of implanted pathogenic bacteria. Therefore, the research and establishment of a rapid on-site detection method which is suitable for early stage examination of the endometritis of the dairy cow, sensitive, economical and applicable and simple and convenient to operate is urgently needed.

Disclosure of Invention

According to the research, according to the positive correlation between the endometritis of the milk cow and the activity of serum creatine kinase, a murine monoclonal antibody is prepared and screened by recombining and expressing bovine creatine kinase isozyme (CK-BB), and a double-antibody sandwich ELISA kit for rapidly detecting the bovine creatine kinase isozyme (CK-BB) is further developed by utilizing a double-antibody sandwich ELISA method and is used for monitoring the change of the postpartum cow creatine kinase isozyme (CK-BB) in the field.

The invention aims to provide a double-antibody sandwich ELISA kit and a method for bovine-derived creatine kinase isoenzyme (CK-BB), so that endometritis can be detected quickly and immediately, and the concentration of the CK-kinase isoenzyme (CK-BB) in bovine serum can be detected by a quantitative detection method of the double-antibody sandwich ELISA kit, so that the kit and the method are used for evaluating the endometritis condition of the dairy cattle, and are accurate, quick, high in sensitivity, free of operation of professional personnel, low in cost and convenient to popularize and use.

In order to achieve the purpose, the invention adopts a first technical scheme that: a double-antibody sandwich ELISA kit of bovine-derived creatine kinase isozyme (CK-BB) comprises: an enzyme label plate for coating the capture antibody, a confining liquid, a washing liquid, a substrate developing liquid, a stopping liquid and a detection antibody.

The capture antibody is murine anti-CK-BB monoclonal antibody.

The detection antibody is HRP marked mouse anti-CK-BB monoclonal antibody.

The method for detecting the bovine-derived creatine kinase isoenzyme (CK-BB) by using the double-antibody sandwich ELISA kit of the bovine-derived creatine kinase isoenzyme (CK-BB) comprises the following steps:

(1) diluting CK-BB monoclonal antibody to 5ug/ml with CB, 100ul per well, and coating overnight at 4 deg.C;

(2) washing the plate for 3-5 times, patting to dry, making the sample/specimen 100ul, and reacting for 45min at 25 ℃;

(3) washing the plate for 3-5 times, drying, adding enzyme-labeled antibody, and reacting at 25 deg.C in dark for 30 min;

(4) washing the plate for 3-5 times, drying, adding color developing agent, and reacting at 25 deg.C in dark for 15 min; measured value after addition of the terminating solution OD450

(5) Establishment of standard equations: measuring bovine-derived creatine kinase isoenzyme (CK-BB) with known concentration by use of microplate reader to obtain corresponding OD₄₀₅-fitting the CK-BB concentration logarithm to obtain a linear standard linear equation;

(6) and (3) determination of a sample to be tested: the measured OD is measured₄₀₅Substituting the value as x value into the equation to calculate y value, wherein the y value is the logarithm value of CK-BB concentration (ng/ml), and further calculating the CK-BB concentration in the sample to be detected.

Compared with the prior art, the invention has the beneficial effects that: in the kit, the monoclonal antibody used as a detection marker CK-BB is mature, stable and nontoxic in labeling conditions, strong in resolution, sensitivity and stability of the kit and capable of being used for quantitative detection.

The CK-BB double-antibody sandwich ELISA rapid detection kit and the detection system have the advantages of simple operation, direct addition of serum samples, short detection time, suitability for popularization and use, overcoming the defects of high price, time-consuming detection and need of professional operators of the existing chemiluminescence method, independently processing data so as to realize quantitative detection, and being particularly suitable for detecting the CK-BB level of bovine serum in a grassland of a basic level.

According to the invention, through clinical verification, evaluation and improvement of the method, the sensitivity and accuracy of detecting serum creatine kinase indexes to reveal and reflect the endometritis infection and inflammation degree of the dairy cow are improved, and finally, a novel method for quickly diagnosing the endometritis of the dairy cow at the early stage is established, so that a professional instrument is not needed, and the field quick detection of the endometritis of the dairy cow in the field and the auxiliary clinical examination for quickly diagnosing the endometritis of the dairy cow at the early stage are realized through simple operation.

Drawings

The invention is further described with reference to the following figures and examples:

FIG. 1 shows bovine serum samples from endometritis detected by SDS-PAGE electrophoresis using bovine heart creatine kinase (CK-MB) as standard, wherein the CK standard is commercial bovine CK-MB and rabbit CK;

FIG. 2 is a diagram showing the detection of bovine serum and a CK-BB polyclonal antibody WB, wherein FIG. 2-A is a WB photograph taken by normal exposure time, and FIG. 2-B is a WB photograph taken by long exposure time; FIG. 2-C shows that all sample sera reacted specifically with anti-CK-BB polyclonal antibody;

FIG. 3 plasmid pET28b-CK-BB is double digested with Nde I and Xho I;

FIG. 4 shows the induction result of CK-BB protein, which is an isoenzyme of bovine creatine kinase: 1: total protein before induction, 2: supernatant at 20 ℃; 3: precipitating at 20 ℃; 4: supernatant at 37 ℃; 5: precipitating at 37 ℃;

FIG. 5 SDS-PAGE analysis of protein purification of bovine creatine kinase isoenzyme CK-BB protein, M: protein marker; 1: sampling; 2: flowing out; 3: 10mM Imidazole eluate fraction; 4: 20mM Imidazole eluate fraction; 5-9: 50mm of a midiazole eluting fraction; 10-12: 500mM Imidazole eluate fraction;

FIG. 6 is an SDS-PAGE analysis chart of bovine creatine kinase isoenzyme CK-BB protein, M: protein marker; 1: a protein of interest;

FIG. 7 Western Blot analysis of CK-BB protein, bovine creatine kinase isozyme, panel M: protein marker; 1: a protein of interest;

FIG. 8 is a graph of the optimization criteria of the Elisa conditions of the kit;

fig. 9Elisa linear standard linear equation.

Detailed Description

Example 1 correlation study of creatine kinase in cow serum with endometritis

Serum of cattle confirmed to have endometritis by a conventional method is taken, Creatine Kinase (CK) value is detected, and correlation of cattle endometritis and CK is determined by comparing control with positive group.

Collecting multiple clinical symptoms from a cow farm around Hu He Hao Te and Baotou as cow serum suffering from endometritis of the cow, and carrying out biochemical analysis to detect the activity of creatine kinase and obtain related data. And (3) detecting a bovine serum sample (figure 1) of endometritis by taking the bovine heart-derived creatine kinase (CK-MB) as a standard substance and adopting SDS-PAGE electrophoresis, and judging the consistency and the conformity of the clinical serum sample CK and the bovine heart-derived creatine kinase (CK-BB) as the standard substance by observing the size and the shade of a target band. The results of the preliminary study are as follows: 1. the clinical diagnosis shows that the CK activity in a diseased bovine serum sample of the cow endometritis is obviously higher than that of a healthy cow. The serum creatine kinase activity of normal cattle is 80-200U/L, mainly concentrated on 100-1796U/L and that of infected cattle is only 200-1796U/L. 2. The CK standard substances in the figure are commercial bovine CK-MB and rabbit CK, are greatly different from clinical serum samples CK, and are basically judged to be essentially CK-BB in the sick bovine serum samples CK related to clinically confirmed endometritis by combining CK monitoring results of related human and animals.

We also collected 6 sera of sick cattle from the cattle farm whose clinical symptoms corresponded to the endometritis of cows, and performed the CK viability assay (table 1), while using western blotting method Wenstern-Blot to assay the specific binding rate of CK in clinical sample sera and the polyclonal antibody recombinantly expressed CK-BB with rabbit anti-polyclonal antibody recombinantly expressed CK-BB (fig. 2), to investigate the correlation of the recombinantly expressed CK-BB with the clinical serum sample CK, and the results showed that: 1. the creatine kinase CK activity in the serum of 6 clinically confirmed endometritis cattle is increased. 2. The rabbit source polyclonal antibody of recombinant expression CK-BB has specific combination with creatine kinase CK in clinical confirmed endometritis disease cattle serum, and lays a theoretical foundation for developing colloidal gold immunochromatography test strips.

TABLE 1 sample bovine serum CK viability assay

By integrating the research result of the correlation between creatine kinase and endometritis in the serum of the dairy cow and the analysis result of recombinant bovine creatine kinase isozyme (CK-BB) protein immunoblotting (Western-Blot), the rapid detection kit for detecting bovine creatine kinase isozyme (CK-BB) double-antibody sandwich ELISA can be determined to be developed from the recombinant bovine creatine kinase isozyme (CK-BB).

Example 2 Total Gene Synthesis of bovine creatine kinase isoenzyme CK-BB

As the bovine endometritis and the creatine kinase isoenzyme CK-BB in the serum have high correlation, the creatine kinase isoenzyme CK-BB is adopted as an antigen to prepare the related monoclonal antibody and polyclonal antibody. In the invention, the shortage of a key reagent, namely bovine brain-derived or smooth muscle-derived creatine kinase CK-BB severely restricts the development of experiments. As CK-BB is less in application, most of bovine-derived creatine kinase in the market takes CK-MB as a main component, and no CK-BB product exists, so that the research is difficult.

In order to solve the problem of CK-BB deficiency, the inventor researches and determines to synthesize bovine CK-BB gene by a whole-gene synthesis method and perform prokaryotic expression on the bovine CK-BB gene. The amino acid sequence of the bovine creatine kinase CK-BB is inquired through NCBI, and the sequence number is as follows: AAX08725.1 and carrying out codon optimization suitable for escherichia coli BL21 on GenBank, and artificially synthesizing a bovine CK-BB whole gene by adopting a two-step method. And then, the synthesized whole gene is connected to an expression vector pET28b and is transformed into escherichia coli BL21(DE3), a large amount of target protein expression is detected through a small-amount expression test, the escherichia coli engineering bacteria of the creatine kinase isoenzyme CK-BB are successfully prepared, and a solid foundation is laid for the later-stage large-amount preparation of the bovine CK-BB. Briefly described, the experimental procedure is as follows:

2.1 CK-BB Gene genetic codon modification and primer design and Artificial Synthesis

The nucleotide sequence of the gene is derived under the assistance of Bioedit software according to the amino acid sequence (GenBank: AAX08725.1) of the bovine creatine kinase isozyme CK-BB, and an initiation codon ATG and a termination codon TAA are respectively added to the 5 'end and the 3' end of the CK-BB sequence; using DNAworks software to optimize codons of the gene by taking the codon usage frequency of escherichia coli as a reference, designing and synthesizing 54 mutually overlapped primers of 40bp, and selecting primers CK-1 and CK-54 (shown in table 2) from the primers to respectively introduce Nde I and Xho I enzyme cutting sites. The primers are synthesized and then desalted and purified by PAGE for later use.

Primer name	Primer sequences
		CK-1	GCCTGGTGCCGCGCGGCAGCCATATGCCTTTCAGCAA
CK-54	CAGTGGTGGTGGTGGTGGTGCTCGAGTTTCTGC

TABLE 2 CK-BB Total Gene Synthesis and amplification of coding DNA primer sequences

2.2 Total Gene Synthesis of bovine creatine kinase isoenzyme CK-BB

Firstly, sequencing the synthesized CK-BB whole gene, then artificially synthesizing the modified CK-BB whole gene sequence (SEQ ID NO:1) of the bovine creatine kinase isozyme, wherein the synthesized plasmid pET28b-CK-BB can be subjected to Nde I and Xho I double enzyme digestion (FIG. 3).

2.3, expressing the recombinant bovine creatine kinase isoenzyme CK-BB protein in a small amount by a prokaryotic expression system.

PET28b-CK-BB positive plasmid is transformed into prokaryotic expression host bacteria BL21 and Rosetta, coated on a corresponding solid culture medium, and cultured for 12-16h at 37 ℃. Selecting single colony, culturing in liquid culture medium for 12-16 hr, and storing glycerol strain at-80 deg.C. Activating strains: the strain is recovered and cultured and activated overnight at 37 ℃. Inducing expression: the next day, the strains were measured as 1: 5mL of the culture was expanded at 50, cultured at 37 ℃ until OD600 became 0.4-0.6, and 2.5mL of the collected culture was treated as a pre-induction control. 0.5mM IPTG was added to the remaining 2.5mL, and the cells were induced at 37 ℃ for 3 hours, and then treated with centrifugation to obtain induced samples, and SDS-PAGE was carried out to identify the expression of the protein.

Prokaryotic expression vector information:

the PET28b-CK-BB (BL21) strain was recovered and cultured overnight at 37 ℃ for activation. The next day, the strains were measured as 1: 50 expansion culture was carried out in 800mL, and the cells were cultured at 37 ℃ until OD600 became 0.4-0.6, and 0.5mM IPTG was added to induce expression at 37 ℃ for 5 hours. Centrifuging at 8000rpm and 4 deg.C for 5min, and collecting thallus. 100mL of the disruption solution was added for ultrasonic lysis. And (3) cracking conditions: temperature ice bath, power 60%, ultrasonic 2s, interval 2s, time 15 min. Centrifuging at 12000rpm and 4 deg.C for 15min, and collecting supernatant and precipitate. SDS-PAGE detection is carried out to judge the expression form of the target protein. And purifying the supernatant by using high-affinity NI resin, collecting flow-through liquid and eluent, and detecting the protein purification effect by SDS-PAGE. The imidazole is removed from the purified target protein by dialysis, and the protein dialysis effect is detected by SDS-PAGE.

The detection effect is as follows:

(1) inducing result of CK-BB protein of bovine creatine kinase isoenzyme

By SDS-PAGE analysis of the recombinant expression samples (FIG. 4), it was shown that there was significant expression in the pellet at 37 ℃.

(2) As shown by SDS-PAGE analysis, the protein of the bovine creatine kinase isoenzyme CK-BB protein is eluted successively at 50mM, 100mM and 500mM of Imidazole, and the purity of the target protein is better at 500 mM. Adding 0.3% SKL into 10-12 protein, dialyzing to 10MmPBS, 0.1% SKL, and pH 8.0. Concentrating, filtering, sterilizing, packaging, and storing at-80 deg.C.

(3) SDS-PAGE analysis of final purification of CK-BB protein, an isoenzyme of bovine creatine kinase (FIG. 6)

(4) Western Blot analysis of CK-BB protein, an isozyme of bovine creatine kinase (FIG. 7)

Example 3 preparation of CK-BB monoclonal antibody

1. And (3) small trial: PET28b-CK-BB positive plasmid is transformed into BL21 and Rosetta host bacteria, and both the plasmids have obvious expression in a small test.

2. Antigen preparation: a great amount of induced expression PET28b-CK-BB (BL21), obvious expression of target protein in the supernatant and inclusion body, preferential purification of the supernatant, purification and dialysis of the supernatant, and finally obtaining the CK-BB recombinant protein 5mg with the protein purity of more than 90%.

3. Preparing a polyclonal antibody: polyclonal antibodies were prepared with a titer of 1: 243000.

4. Preparing monoclonal antibody: monoclonal antibodies were prepared and positive cell line 5 was selected.

5. Preparing and purifying an antibody: and (5) ascites implantation and purification to obtain the monoclonal antibody.

6. And (3) antibody pairing screening: and (3) carrying out pairing screening on the antibodies by using an ELISA method to obtain an antibody pair capable of being paired.

ELISA condition optimization: and selecting the antibody pair with the best effect to optimize the ELISA conditions.

The preparation method is briefly described as follows:

one 2-month-old female New Zealand white rabbit is immunized for three times, and thigh muscle is injected at multiple points. Each new Zealand white rabbit antigen is immunized with 500ug of antigen, the first immunization is emulsified with equivalent Freund's complete adjuvant, the second immunization is emulsified with equivalent Freund's incomplete adjuvant, and the third immunization is mixed with equivalent physiological saline and injected into ear vein. The blood was collected intravenously 14 days after the second immunization, and the antibody titer was measured by an indirect method, thereby determining whether or not an antibody against the target was produced. Performing boosting immunization for the third time after the titer reaches the standard; if the titer does not reach the standard, continuing subcutaneous immunization by Freund incomplete adjuvant for the third time, and boosting immunization for the fourth time after 28 days. Blood was taken 14 days after the booster immunization.

Four female BALB/c mice of 6 weeks old are immunized for three times, and the batch multipoint injection is adopted. The dose of each mouse antigen for each immunization is 25ug, the first immunization is emulsified with equivalent Freund's complete adjuvant, the second immunization is emulsified with equivalent Freund's incomplete adjuvant, the third immunization is mixed with equivalent physiological saline, and the mixture is injected into abdominal cavity. The tail vein was sampled 10 days after the second immunization, and the antibody titer was measured by an indirect method, thereby determining whether or not antibodies against the antigen were produced. Comparing the titer of four mice, and finally selecting the mice with higher antibody titer for cell fusion. Three days before fusion, the antigen was used to boost directly once, at the same dose as before.

Taking out the frozen myeloma cell from the liquid nitrogen, immediately putting the cell into a water bath at 37 ℃ for melting, centrifuging, discarding the supernatant, scattering cell clusters by using a small amount of complete culture solution, adding the cell clusters into a freezing tube of the complete culture medium, uniformly blowing the cell clusters by using a suction tube, completely sucking the cell clusters out, transferring the cell clusters into a cell culture bottle, and culturing the cell clusters in a carbon dioxide incubator at 37 ℃. After the cells grow to fill the bottom of the bottle, the cells are transferred to another cell bottle for culture, the cell state is observed under an inverted microscope, and the cells with good state are ready for fusion.

Taking the mouse with the highest titer and with the enhanced immunity, removing an eyeball to collect blood, and separating serum to be used as positive control serum during detection. Dislocation of cervical vertebra of mouse for killing, soaking in ethanol for sterilization, transferring into an ultra-clean bench, fixing on a dissection plate, cutting left skin and peritoneum with sterilizing scissors and forceps, aseptically taking out spleen, washing in an aseptic plate containing basic culture solution, and stripping connective tissue from capsule. The spleen was transferred to another filter in a dish containing basal medium, and the spleen was punctured with bent needles on two syringes, one of which was then used to fix the filter and the other pressed against the filter, allowing the splenocytes to be released completely into the basal medium in the dish. The cells were blown up with a sterile dropper to make a single cell suspension, and the spleen cell suspension was harvested. The spleen cell suspension in the dish was transferred to a centrifuge tube, centrifuged, the supernatant discarded, and washed once with cell culture medium. Fusing the separated splenocytes with myeloma cells which are recovered for later use by PEG, centrifuging, discarding the supernatant, centrifuging and washing the supernatant once by using cell culture solution, adding cell culture solution which is blown by HAT to prepare single cell suspension, and paving the single cell suspension in a 96-hole cell culture plate. At day 7 after cell fusion, macroscopic clones grew out of the well bottoms of the culture plates, and all the wells were first screened by ELISA indirect method and the wells showing strong positive were recorded. Each well positive for primary screening should be expanded and cloned in 24 well cell culture plates in time. And (3) continuously diluting the cell suspension by adopting a limiting dilution method until each hole contains only a single cell statistically, transferring the cell suspension to a 96-well plate for culture, and carrying out cloning operation for a plurality of times until the positive rate of detection of all the cloned cell holes is 100%, thus determining the hybridoma cell strain secreting the monoclonal antibody. And performing expanded culture on the obtained positive hybridoma cells in a cell culture bottle, freezing and storing, preparing ascites and the like.

Taking 6-week-old healthy female mice, carrying out intraperitoneal injection of 0.5ml of liquid paraffin for sensitization, and carrying out intraperitoneal injection of 1-2X10 on each mouse after one to two weeks⁶Observing the state of the mouse for 7-10 days, collecting ascites after the abdominal cavity of the mouse is obviously enlarged, centrifuging the supernatant to obtain the ascites, and subpackaging and marking for later use. Centrifuging ascites for 15min (4000rpm, room temperature), collecting supernatant, adding saturated ammonium sulfate dropwise slowly at 4 deg.C under stirring to half saturation, stirring for 30min, centrifuging for 30min (13000rpm, 4 deg.C), and discarding supernatant; the pellet was dissolved in an appropriate amount of PBS (0.01M, pH 7.4); slowly adding saturated ammonium sulfate dropwise to 33% under stirring at 4 deg.C, stirring for 30min, centrifuging for 30min (13000rpm, 4 deg.C), and removing supernatant; the precipitate was dissolved in an appropriate amount of PBS (0.01M, pH7.4), dialyzed overnight at 4 ℃ and assayed for antibody content, and frozen at-20 ℃ for future use. Ammonium sulfate precipitation, purifying with Protein G column, passing 5ml ultrapure water through the new column, and balancing the purified column with 5ml 0.4M PB buffer solution (pH 7.0); the antibody passes through the column slowly in the process, so that the antibody protein is better combined on the binding site; the column was equilibrated with 10ml of 0.4M PB buffer (pH7.0); 5ml of 0.1M glycine-hydrochloric acid buffer (pH 2.7) eluted the antibody at the binding site, and 1M Tris-HCl (pH 8.0) was added to neutralize the glycine, keeping the pH neutral for antibody preservation.

The mouse antibody subtype identification kit is used for determination and the indirect ELISA method is used for determining the antibody titer.

Example 4 preparation method of double antibody sandwich ELISA kit of bovine-derived creatine kinase isozyme (CK-BB)

Optimization of ELISA conditions

2.1 Single-Single Pair sensitivity detection

And selecting 2 groups with better pairing effect to carry out sensitivity detection.

FL155-2/4 is used as a capture antibody, FL155-1-HRP is used as a detection antibody, and the detection sensitivity reaches 12.5 ppb.

2.2 kit Condition optimization

FL155-2 monoclonal antibody as capture antibody and FL155-1-HRP as detection antibody were subjected to condition optimization (FIG. 8).

Ppb of Standard	OD
		80	2.207
40	1.192
		20	0.763
10	0.409
		0	0.075

Finally, FL155-2 monoclonal antibody 5ug/ml is coated, FL155-1-HRP 1:1k is diluted, the detection sensitivity reaches 10ppb, and the linear range is 10-80 ppb.

Example 5 detection method of double antibody sandwich ELISA kit of bovine-derived creatine kinase isozyme (CK-BB)

1. Detection method

The method adopts a double-antibody sandwich ELISA method to detect the actual sample, and comprises the following operation steps:

a. diluting CK-BB monoclonal antibody to 5ug/ml with CB, 100ul per well, and coating overnight at 4 deg.C;

b. washing the plate for 3-5 times, patting to dry, making the sample/specimen 100ul, and reacting for 45min at 25 ℃;

c. washing the plate for 3-5 times, drying, adding enzyme-labeled antibody, and reacting at 25 deg.C in dark for 30 min;

d. washing the plate for 3-5 times, drying, adding color developing agent, and reacting at 25 deg.C in dark for 15 min;

e. the value OD450 was measured after adding the stop solution.

2. Preliminary experiments

The detection of 6 samples is weak positive after 10 times of dilution, and then the sample dilution times are reduced.

3. Actual sample detection

According to the detection result of the preliminary experiment and the sample amount, the dilution of the serum sample is adjusted to 2.

3.1 plotting of Standard Curve (FIG. 9):

3 groups of samples are provided, and the detection results of the CK-BB serum samples are as follows:

and (4) conclusion: 3 groups of 31 samples are diluted by 2 times, and basically all the samples can be detected, and specific data refers to detection results.

It should be understood that the above-mentioned embodiments are only illustrative of the technical concepts and features of the present invention, and are intended to enable those skilled in the art to understand the contents of the present invention and implement the present invention, and not to limit the scope of the present invention. All equivalent changes or modifications made according to the spirit of the main technical scheme of the invention are covered in the protection scope of the invention.

Claims (1)

1. An application of a double-antibody sandwich ELISA kit of bovine-derived creatine kinase isoenzyme CK-BB in preparing a reagent for detecting bovine endometritis comprises the following steps: an enzyme label plate for coating the capture antibody, a confining liquid, a washing liquid, a substrate developing liquid, a stop solution and a detection antibody;

the capture antibody is a mouse anti-CK-BB monoclonal antibody, and the detection antibody is an HRP-labeled mouse anti-CK-BB monoclonal antibody;

the double-antibody sandwich ELISA kit for detecting the bovine-derived creatine kinase isoenzyme CK-BB comprises the following steps: (1) diluting CK-BB monoclonal antibody to 5ug/ml with CB, 100ul per well, and coating overnight at 4 deg.C; (2) washing the plate for 3-5 times, patting to dry, making the sample/specimen 100ul, and reacting for 45min at 25 ℃; (3) washing the plate for 3-5 times, drying, adding enzyme-labeled antibody, and reacting at 25 deg.C in dark for 30 min; (4) washing the plate for 3-5 times, drying, adding color developing agent, and reacting at 25 deg.C in dark for 15 min; adding a stop solution and measuring the value OD 450; (5) establishment of standard equations: measuring the bovine-derived creatine kinase isoenzyme CK-BB with known concentration by using a microplate reader to obtain the corresponding OD₄₀₅-fitting the CK-BB concentration logarithm to obtain a linear standard linear equation; (6) and (3) determination of a sample to be tested: the measured OD is measured₄₀₅Substituting the value as an x value into an equation to calculate a y value, wherein the y value is a logarithm value of the CK-BB concentration, and further calculating the CK-BB concentration in the sample to be detected;

the CK-BB concentration is expressed in ng/ml.

Images