CN107045057A - A kind of ox source creatine kinase isozyme colloidal gold immune chromatography rapid detecting test paper strip - Google Patents
A kind of ox source creatine kinase isozyme colloidal gold immune chromatography rapid detecting test paper strip Download PDFInfo
- Publication number
- CN107045057A CN107045057A CN201710234074.5A CN201710234074A CN107045057A CN 107045057 A CN107045057 A CN 107045057A CN 201710234074 A CN201710234074 A CN 201710234074A CN 107045057 A CN107045057 A CN 107045057A
- Authority
- CN
- China
- Prior art keywords
- gold
- pad
- source
- creatine
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/558—Immunoassay; Biospecific binding assay; Materials therefor using diffusion or migration of antigen or antibody
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/573—Immunoassay; Biospecific binding assay; Materials therefor for enzymes or isoenzymes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
Abstract
The present invention relates to a kind of ox source creatine kinase isozyme (CK BB) colloidal gold immune chromatography rapid detecting test paper strip and method, it includes:Backing, it is arranged on the sample pad on reagent backing, gold-marking binding pad, chromatographic film and absorption pad, it is provided with the sample pad in backing one end, one end and the gold-marking binding pad of sample pad abutting contact, one end and the chromatographic film of gold-marking binding pad other end abutting contact, and the absorption pad with another end in contact of chromatographic film, the first antibody of the anti-ox source creatine isodynamic enzyme of mouse marked wherein on gold-marking binding pad comprising Au colloidal nanoparticles, and misaligned detection line and nature controlling line are distributed in chromatographic film, the secondary antibody of the anti-ox source creatine isodynamic enzyme of mouse is wherein contained in detection line, the 3rd antibody of anti-first antibody is contained on nature controlling line.The present invention sets up cow endometritis Rapid&Early diagnosis new method, accomplishes not needing special instrument, by simple operations, realizes and makes Rapid&Early diagnosis in field progress cow endometritis field quick detection and adjuvant clinical inspection.
Description
Technical field
The present invention relates to colloidal gold immunochromatographimethod field of fast detection, and in particular to a kind of ox source creatine kinase isozyme
(CK-BB) colloidal gold immune chromatography rapid detecting test paper strip and method.
Background technology
China's dairy development in recent years is very rapid, but development of the infertility to milk cow production has important shadow
Ring.Great mass of data shows that infertility accounts for the 20%~30% of cow disease, and endometritis accounts for the 40%~60% of infertility.
Cause the cause of disease of cow endometritis more, but caused by main cause is the early infection in postpartum, there are some researches show milk cow production
Early stage afterwards has 93% Niu Fasheng uterine infection bacteriums, and 39% is reduced to infection rate at 46-60 days.
Cow endometritis prevents embryonated egg from implantation or embryo's Deaths, delays the calving interval, has a strong impact on
The breeding of milk cow and production capacity and efficiency, great economic loss is caused to Cow product.According to document announcement, the U.S. has every year
12.19% milk cow is eliminated due to infertility or reproductive diseases, accounts for the 52.37% of superseded cow, every year because infertility is damaged
Lose up to 2.7 hundred million dollars;Beijing Agricultural University accounts for infertile milk to 16 urban surveys such as Beijing, Nanjing, Shanghai, endometritis
The 68.34% of ox, domestic infertile milk cow superseded every year accounts for the 60%-70% for eliminating sum.
Creatine kinase (Creatine Kinase, CK;EC 2.7.3.2) 81000~82000Da of molecular weight is by two
The dimer of subunit (M and B) composition, turns phosphoryl reaction, in creatine and phosphocreatine between reversible catalysis creatine and ATP
Played an important role in conversion reaction.Such as in energetic supersession most vigorous musculature and brain tissue, CK activity is
Highest.In internal organs, uterus is the active organs of CK the 3rd, and first two are skeletal muscle and cardiac muscle.According to its isodynamic enzyme
The difference of subunit and distributing position, there are three kinds of CK isoenzymes in ox, wherein:CK-MM (being specifically present in skeletal muscle),
CK-MB (being specifically present in cardiac muscle) and CK-BB (being obtained from bovine brain).The above isoenzymes is all present in cytoplasm,
Galitzer and Oehme (1985) will much lack to the CK of all organs of the ox CK contain in detection discovery, internal organs
In skeletal muscle and cardiac muscle, and most CK belongs to isozyme C K-BB.In healthy cow's serum CK composition almost all by
CK-MM is constituted, but research finds also to there are detectable CK- in pregnancy neutralizes postpartum women, the serum of Pregnant guinea pigs
BB (brain source or smooth muscle source) and CK-MB (Clark et al., 1994).The reason for causing above phenomenon is likely to be in bosom
The late pregnancy demand higher to energy (metabolism) (Clark et al., 1994), i.e. uterine tissue are before and after childbirth to it
Mechanicalness and metabolism have higher requirement (Abramov et al., 1996).
We, which study, shows after endometrium infection inflammation that serum creatine kinase activity significantly increases, according to the study result its can
It is used as the important diagnostic index of cow endometritis.At present, the diagnosis of cow endometritis rely primarily on visual examination, palpation and
, there is early diagnosis diagnosis rate low and the problem of cause implantable pathogen superinfection in the conventional method based on uterine probe.
Therefore, in the urgent need to a kind of quick, sensitive, economic and practical, behaviour suitable for cow endometritis early stage investigation is set up in research
Make easy field fast detection method.
Immune colloidal gold technique is a kind of wider immunological method of application, and the technology is a kind of by colloid gold particle and bag
Include the technology that many protein labelings including antigen, antibody form immune Au composite.Prepared using immune-gold labeled technology
Label is applied in detection infectious disease, environmental contaminants, drugs, early pregnancy and animal doctor as the indicator in detecting system
Deng field, the application of this technology greatly enhances the simplicity and rapidity of vitro diagnostic techniques.
The immune response occurred on chromatographic material, possesses the high specific, efficientibility, high affinity of immune response
Feature.Specific process is, the sample solution containing determinand is by the capillarity of fiber chromatographic material along chromatographic material
Move up, occurrence features immune response combined with the acceptor (antigen or antibody) for determinand that is fixed on chromatographic material,
Antigen antibody complex is constantly accumulated by enrichment during a little, by enzyme reaction label or visable indicia thing directly perceived (such as
Collaurum) it is allowed to develop the color, so as to reach the purpose of testing goal material.
The content of the invention
The present invention is according to cow endometritis and the positive correlation of serum creatine kinase activity, by recombinantly expressing Niu Yuan
Creatine kinase isozyme (CK-BB), prepares screening mouse resource monoclonal antibody, further former using collaurum coating and immunochromatography
Reason have developed a kind of test strips of quick detection ox source creatine kinase isozyme (CK-BB), swash for monitor on field milk cow creatine
The change of enzyme isoenzyme (CK-BB).
It is an object of the invention to provide a kind of ox source creatine kinase isozyme (CK-BB) colloidal gold immunochromatographimethod quick detection
Test strips and method, it is thus quick to detect endometritis, the method quantitatively detected by colloidal gold immunochromatographimethod, detection immediately
The concentration of creatine kinase isozyme (CK-BB) in cow's serum, so that for assessing cow endometritis situation, accurately, quickly,
Sensitivity is high, without professional's operation, and cost is relatively low, is easy to promote the use of.
The operation principle of double antibody sandwich method is as follows:The different antigen sites of two of determinand are respectively for monoclonal gold mark
Antibody and detection line monoclonal antibody.Such as one positive sample, determinand can mark monoclonal antibody and detection line monoclonal antibody knot with gold simultaneously
The macromolecular of a double-antibody sandwich determinand is synthesized, this huge molecule is due to being fixed on the monoclonal antibody of detection line in detection line
(T) assemble, can be visually observed when assembling enough collaurums.Continue with the unnecessary gold labeling antibody that increases of determinand
Chromatography, it is the secondary antibody of gold labeling antibody that nature controlling line is coated, when unnecessary gold labeling antibody chromatography arrives nature controlling line (C), and on C lines
The constantly accumulation of two anti-bindings is until colour developing.The positive findings presented is:The double colour developings of T lines, C lines;Negative findings is:T lines disappear
Lose, the colour developing of C lines.Detection line and nature controlling line do not develop the color then for failure.
To reach above-mentioned purpose, the present invention uses the first technical scheme:A kind of anti-ox source creatine isodynamic enzyme colloid gold immune
Chromatography detecting test paper strip, it is characterised in that it includes:Backing, the sample pad being arranged on reagent backing, gold-marking binding pad, chromatography
Film and absorption pad, be provided with the sample pad in backing one end, the gold-marking binding pad of one end and sample pad abutting contact, one end with
The chromatographic film of gold-marking binding pad other end abutting contact and the absorption pad with another end in contact of chromatographic film, wherein gold mark is combined
The first antibody of the anti-ox source creatine isodynamic enzyme of mouse marked on pad comprising Au colloidal nanoparticles, and distributed and do not weigh in chromatographic film
The detection line and nature controlling line of conjunction, wherein contain in detection line and are wrapped on the secondary antibody of the anti-ox source creatine isodynamic enzyme of mouse, nature controlling line
The 3rd antibody of anti-first antibody is contained.
On the basis of the first technical scheme, further comprise following attached technical scheme:
The secondary antibody is just to be specifically bound only in the presence of having CK-BB with CK-BB and first antibody,
And the 3rd antibody can be combined with first antibody under any circumstance.
The sample pad and gold-marking binding pad are least partially overlapped, and gold-marking binding pad and chromatographic film are at least partly overlapped.
The collaurum particle diameter is 10-100nm, and the preparation of colloid gold particle is heated at reflux method using constant temperature.
The detection line is close to glue gold pad one end, and the nature controlling line is close to absorption pad one end, the detection line and nature controlling line
Standoff distance is between 0.5-1.5cm.
The upper lower half that the kit includes being mutually matched and fastening gets stuck, described to get stuck with well and observation
Hole, well is located at gold-marking binding pad and sample pad and local exposed sample pad, and peep hole is located at chromatographic film top and naked
Reveal detection line and nature controlling line.
Further, after cow's serum sample application, colloidal gold immunochromatographykit kit association colloid gold reads instrument detection blood
The CK-BB contained in final proof sheet concentration level.
Further, the collaurum reads instrument and quantitatively reads instrument using colloidal gold immunochromatographimethod, belong to one kind by light,
The signal strength values of detection line and nature controlling line are read in the precision instrument of mechanical, electrical composition, scanning, by signal strength values by photoelectricity and
Analog/digital conversion, switchs to data signal, the good CK-BB luminosity-concentration standard curve of built-in optimization, and data signal is in standard curve
After middle calculating, the concentration value for detecting and obtaining is obtained.When the collaurum reads instrument Scanning Detction line with nature controlling line, absorb light and sweep
Scope is retouched according to collaurum particle size.
Compared with prior art, beneficial effects of the present invention at least that:In kit, detection label CK-BB is used as
Monoclonal antibody, using the collaurum being widely used at present as mark substance, flag condition is mature and stable nontoxic, reagent
Box resolution ratio itself, sensitivity, stabilization are stronger, can select with the naked eye to do half-quantitative detection, can also coordinate collaurum to read instrument
Use do quantitative detection.
The CK-BB colloidal gold immune chromatography rapid detecting test paper strips and detecting system of the present invention, it is simple to operate directly to heal
Final proof sheet, detection time are short, are suitable for promoting the use of, and overcome existing enzyme-linked immunoassay method and chemoluminescence method, expensive,
Detection is time-consuming and needs to put into the shortcoming of professional operator.
Present invention incorporates collaurum read instrument small volume, it is lightweight, be easy to carry and can independent process data depending on
The advantage of detection is measured, is particularly suitable for detection of the cow's serum CK-BB levels in basic unit pasture.
The present invention improves detection serum creatine kinase index and disclosed by clinical verification, evaluation and to the perfect of this method
With sensitivity, the accuracy of reaction cow uteri endometrial inflammation degree of inflammation, cow endometritis early stage is finally set up quick
New method is diagnosed, accomplishes not needing special instrument, by simple operations, realizes and cow endometritis scene is carried out in field soon
Rapid&Early diagnosis is made in speed detection and adjuvant clinical inspection.
Brief description of the drawings
Below in conjunction with the accompanying drawings and embodiment the invention will be further described:
Fig. 1:It is that reference material uses SDS-PAGE electrophoresis with OX-heart source creatine kinase (CK-MB), detects endometritis ox
CK reference materials in serum sample, figure are commercial cattle source CK-MB and rabbit source CK;
Fig. 2:Sample cow's serum detects that Fig. 2-A are that constant exposure time takes to obtain WB photos with CK-BB polyclonal antibodies WB,
Fig. 2-B take to obtain WB photos to expose for a long time;Fig. 2-C show that the equal and anti-CK-BB polyclonal antibodies in all sample serum have spy
Opposite sex reaction;
Fig. 3:Plasmid pET28b-CK-BB is through Nde I and Xho I double digestions;
Fig. 4:The protein induced results of ox isoenzymes of creatine kinase CK-BB:1:Total protein before induction, 2:20 DEG C of supernatants;3:20
DEG C precipitation;4:37 DEG C of supernatants;5:37 DEG C of precipitations;
Fig. 5:Ox isoenzymes of creatine kinase CK-BB proteins purify SDS-PAGE analysis charts, M:Protein marker;
1:Loading;2:Outflow;3:10mM Imidazole elution fractions;4:20mM Imidazole elution fractions;5-9:50mM
Imidazole elution fractions;10-12:500mM Imidazole elution fractions;
Fig. 6:Ox isoenzymes of creatine kinase CK-BB protein SDS-PAGE analysis charts, M:Protein marker;1:Mesh
Albumen;
Fig. 7:Ox isoenzymes of creatine kinase CK-BB albumen Western Blot analysis charts M:Protein marker;1:Mesh
Albumen;
Fig. 8:Determination of protein concentration curve map;
Fig. 9:Colloidal gold immuno-chromatography test paper strip structural representation;
Figure 10:Standard items testing result:Be followed successively by 1 from left to right, 0.5,0.2,0.1,0ppm;
Figure 11:Colloidal gold immune chromatography rapid detecting test paper strip decision method;
Figure 12:Colloidal gold immune chromatography rapid detecting test paper strip detects, gradient PBS dilute expressing protein to 0,0.5,1,
5、10、40PPm;
Figure 13:31 groups of serum sample results are detected using colloidal gold immune chromatography rapid detecting test paper strip.
Embodiment
Creatine kinase and the correlation research of endometritis in the cow serum of embodiment 1.
Acquirement is diagnosed as the serum with endometritis ox by conventional method, detects its creatine kinase (CK) value, leads to
Control and the comparison of positive group are crossed, the correlation of bovine endometritis and CK is determined.
Collect many parts of clinical symptoms from Huhehaote and packet header periphery cattle farm and suffer from ox blood for cow endometritis
Clearly, carry out biochemical analysis and detection creatine kinase vigor and obtain related data.With OX-heart source creatine kinase (CK-MB) for reference material
Using SDS-PAGE electrophoresis, detection endometritis cow's serum sample (Fig. 1), by the size and color of observing purpose band
The depth judges clinical serum sample CK and uniformity and degree of conformity of the OX-heart source creatine kinase (CK-BB) for reference material.Tentatively grind
Study carefully result as follows:1st, clinical diagnosis increases for the CK activity in the infected cattle serum sample of cow endometritis is more notable than healthy ox value
It is high.The serum creatine kinase activity of normal ox only is concentrated mainly on 100-200U/L, infected cattle is only in 200- in 80-200U/L
1796U/L.2nd, the CK reference materials in figure are commercial cattle source CK-MB and rabbit source CK, have larger difference with clinical serum sample CK, are tied
Close the CK monitoring results about humans and animals, primitive decision and clinical definite the infected cattle serum sample CK that to be endometritis related
Essence is CK-BB.
The clinical symptoms that we also collect from cattle farm meet 6 parts of the infected cattle serum of cow endometritis, carry out CK work
Power detects (table 1), while using protein immunoblot method Wenstern-Blot, the polyclonal of CK-BB is recombinantly expressed with rabbit-anti
CK and recombination expression CK-BB polyclonal antibodies specific binding rate (Fig. 2) in antibody test clinical sample serum, to investigate weight
Group expression CK-BB and clinical serum sample CK correlation, as a result show:1st, 6 clinical definite endometritis infected cattle serum
Middle creatine kinase CK activity increases.2nd, recombination expression CK-BB rabbit source polyclonal antibody and clinical definite endometritis disease
Creatine kinase CK has specific combination in cow's serum, and theoretical foundation has been established to develop colloidal gold immuno-chromatography test paper strip.
The sample cow's serum CK viability examinations of table 1
The correlation research result and recombinant bovine creatine kinase of creatine kinase and endometritis are same in comprehensive cow serum
Work enzyme (CK-BB) protein immunoblot (Western-Blot) analysis result, it may be determined that by recombinant bovine creatine kinase isozyme
(CK-BB) start to develop detection ox creatine kinase isozyme (CK-BB) colloidal gold immuno-chromatography test paper strip, one is entered on this basis
Step research and development cow endometritis Rapid&Early diagnosis kit.
The full genome of embodiment 2. synthesis ox isoenzymes of creatine kinase CK-BB
Because ox isoenzymes of creatine kinase CK-BB has high correlation in bovine endometritis and serum, therefore use ox
Isoenzymes of creatine kinase CK-BB prepares related monoclonal antibody as antigen and resisted more.In the present invention, crucial reagent bovine brain source or flat
Sliding flesh source creatine kinase CK-BB shortage, seriously constrains the development of experiment.Because CK-BB application is smaller, ox on the market
Most of source creatine kinase is the commodity without CK-BB using CK-MB as main component, and difficulty is caused to research.
In order to solve the problem of CK-BB is not enough, inventor's research determines the method synthesis ox source CK- synthesized using full genome
BB genes, and prokaryotic expression is carried out to it.Ox creatine kinase CK-BB amino acid sequence, Serial No. are inquired by NCBI:
GenBank:AAX08725.1 and the codon optimization for carrying out being applied to e. coli bl21 to it, it is artificial synthesized using two step method
Ox CK-BB full genome, is next connected to expression vector pET28b by synthetic full genome, is transformed into e. coli bl21
(DE3) a large amount of destination proteins, have been measured through a small amount of expression experiments to express, have been successfully prepared ox isoenzymes of creatine kinase CK-BB's
Colibacillus engineering, is largely to prepare ox CK-BB the later stages to have established solid foundation.Experimentation is summarized as follows:
2.1CK-BB gene genetics codon is transformed and the design of primer and artificial synthesized
According to ox isoenzymes of creatine kinase CK-BB amino acid sequence (GenBank:AAX08725.1), it is soft in Bioedit
The nucleotide sequence of the gene is derived under the auxiliary of part, initiation codon ATG and terminator codon TAA are made an addition to respectively
5 ' the ends and 3 ' ends of CK-BB sequences;Using DNAworks softwares on the basis of e. coli codon frequency of use, to the gene
Codon optimize, design of primers synthesizes 54 40bp primers overlapped each other, therefrom chooses primer CK-1 and CK-54
(table 2) introduces Nde I and Xho I restriction enzyme sites respectively.It is standby after purification through desalination, PAGE after primer synthesis.
Primer | Primer sequence |
CK-1 | GCCTGGTGCCGCGCGGCAGCCATATGCCTTTCAGCAA |
CK-54 | CAGTGGTGGTGGTGGTGGTGCTCGAGTTTCTGC |
Table 2CK-BB full genomes are synthesized and amplification coding DNA primer sequence
2.2 Ns of isoenzymes of creatine kinase CK-BB full genome synthesis
First to synthesis CK-BB full genome sequencing results, subsequent artificial synthesized improved ox isoenzymes of creatine kinase CK-
BB complete genome sequences, the plasmid pET28b-CK-BB of synthesis can be through Nde I and Xho I double digestions (Fig. 3).
2.3 by prokaryotic expression system, a small amount of expression recombinant bovine isoenzymes of creatine kinase CK-BB albumen.
PET28b-CK-BB positive plasmids convert prokaryotic expression Host Strains BL21 and Rosetta, are coated on correspondence solid training
Support base, 37 DEG C of culture 12-16h.Picking single bacterium falls within correspondence fluid nutrient medium culture 12-16h, preserves glycerol stock in -80 DEG C.Bacterium
Plant activation:Recovery strain, 37 DEG C of incubated overnight activation.Induced expression:Next day, strain is with 1:50 expand culture 5mL, 37 DEG C of cultures
To OD600=0.4-0.6,2.5mL strains are collected through processing as control before induction.Remaining 2.5mL adds 0.5mM IPTG,
37 DEG C of induced expression 3h, the thalline being collected by centrifugation is through handling as postinduction sample, and SDS-PAGE identifies the expression of albumen.
Prokaryotic expression carrier information:
Recovery PET28b-CK-BB (BL21) strain, 37 DEG C of incubated overnight activation.Next day, strain is with 1:50 expand culture
800mL, 37 DEG C of cultures to OD600=0.4-0.6, adds 0.5mM IPTG, 37 DEG C of induced expression 5h.8000rpm, 4 DEG C of centrifugations
5min, collects thalline.Plus 100mL crushes liquid and carries out ultrasonic treatment.Cracking condition:Temperature ice bath, power 60%, ultrasound 2s,
It is spaced 2s, time 15min.12000rpm, 4 DEG C of centrifugation 15min, collect supernatant precipitation.SDS-PAGE is detected, judges purpose egg
White expression-form.Using high-affinity NI purifying resin supernatants, collection flows through liquid, eluent, and SDS-PAGE detection albumen is pure
Change effect.The destination protein dialysis of purifying is removed into imidazoles, SDS-PAGE detection albumen dialysis-effects.
Detection results are as follows:
(1) the protein induced results of ox isoenzymes of creatine kinase CK-BB
It is heavy at 37 DEG C it can be seen from SDS-PAGE figures by carrying out SDS-PAGE analyses (Fig. 4) to recombination expression sample
There is obvious expression in shallow lake.
(2) ox isoenzymes of creatine kinase CK-BB proteins nickel agarose affinity chromatography SDS-PAGE results (Fig. 5) pass through
Figure SDS-PAGE analysis charts are eluted successively when can be seen that destination protein 50mM, 100mM and 500mM Imidazole,
The purity of destination protein is preferable when at 500mM.Albumen plus 0.3%SKL at 10-12 is taken to dialyse to 10MmPBS, 0.1%
In SKL, pH 8.0.Concentration, filtration sterilization, packing is after -80 DEG C of preservations.
(3) ox isoenzymes of creatine kinase CK-BB albumen finally purifies SDS-PAGE analyses (Fig. 6)
(4) ox isoenzymes of creatine kinase CK-BB albumen Western Blot analyze (Fig. 7)
(5) ox isoenzymes of creatine kinase CK-BB determination of protein concentration SK3071 non-interference type determination of protein concentration reagents
Box determines protein concentration:2.012mg/ml, as a result as shown in Figure 8.
The preparation of embodiment 3.CK-BB monoclonal antibodies
1. lab scale:PET28b-CK-BB positive plasmids convert BL21 and Rosetta Host Strains, and lab scale has obvious expression.
2. it is prepared by antigen:A large amount of induced expression PET28b-CK-BB (BL21), destination protein is obvious in supernatant inclusion body
Expression, preferentially purifies supernatant, and supernatant is purified, dialysis, finally gives CK-BB recombinant protein 5mg, purity of protein > 90%.
3. more than it is anti-prepare:It is prepared for polyclonal antibody, potency 1:243000.
4. it is prepared by monoclonal antibody:Monoclonal antibody is prepared for, 5 plants of positive cell strain is screened.
5. Antibody preparation and purifying:Ascites is planted, purifying obtains monoclonal antibody.
6. antibody conjugates are screened:Pairing screening is carried out to antibody using ELISA method, the antibody pair that can be matched is obtained.
7.ELISA condition optimizings:The best antibody of effect is chosen to carrying out ELISA condition optimizings.
8. colloidal-gold strip piece optimization:A pair of best antibody of screening effect carry out colloidal-gold strip piece optimization.
Preparation method is summarized as follows:
Take 2 month female new zealand white rabbit one to be immunized, three times are carried out altogether and is immunized, takes leg muscle multiple spot to note
Penetrate.Every new zealand white rabbit antigen immune consumption is 500ug every time, and initial immunity is emulsified with equivalent Freund's complete adjuvant, the
Secondary immunity is emulsified with equivalent incomplete Freund's adjuvant, and third time is immune to be mixed with normal saline, ear vein injection.Second
Secondary immune rear 14 days venous blood collections, are surveyed antibody titer by indirect method, the antibody tormation for target are determined whether with this.Effect
Third time carries out booster immunization after valency is up to standard;Potency is not up to standard, then third time continuation incomplete Freund's adjuvant is subcutaneously exempted from
Epidemic disease, the 4th progress booster immunization after 28 days.Booster immunization takes blood after 14 days.
Take 6 week old female BAl BIcs/c mouse four to be immunized, three times are carried out altogether and is immunized, take batch lower multi-point injection.Often
It is 25ug that consumption, which is immunized, in secondary every murine antigen, and initial immunity is emulsified with equivalent Freund's complete adjuvant, second of immune equivalent
Incomplete Freund's adjuvant is emulsified, and third time is immune to be mixed with normal saline, is injected intraperitoneally.Second of immune rear 10 days tail is quiet
Arteries and veins is taken a blood sample, and antibody titer is surveyed by indirect method, and the antibody tormation for antigen is determined whether with this.Compare four mouse effects
Valency, finally selects the higher mouse of antibody titer to be used for cell fusion.First three day is merged, with the direct booster immunization of antigen once,
Dosage is the same.
Taken out from liquid nitrogen and freeze myeloma cell's cell, be immediately placed in 37 DEG C of water-baths and melt, supernatant is abandoned in centrifugation, is used
A small amount of complete culture solution breaks up cell mass, adds about complete medium in cryopreservation tube, is blown and beaten uniformly with suction pipe, all suctions out and turns
Into Tissue Culture Flask, it is placed in 37 DEG C of CO2gas incubators and cultivates.Reached after cell covers with bottom of bottle in another cell bottle
Culture, observes its cell state under inverted microscope, and cell in good condition is standby to do fusion use.
The mouse of potency highest and booster immunization is taken, eyeball excise blood sampling, separation serum is used as positive control during detection
Serum.Mouse cervical dislocation is lethal, alcohol disinfecting is soaked in, is moved into superclean bench, is fixed on dissection plate, with sterilizing
Scissors, tweezers cut off left side skin and peritonaeum respectively, and sterile taking-up spleen is placed in the sterilized petri dishes for having filled basic culture solution
Clear Xian, peels off the connective tissue on envelope.Spleen is moved into another Sheng to there are about in the filter membrane in the plate of basic culture solution, with two
Curved needle head on individual syringe is by spleen acanthopore, and then one of curved needle head fixes filter membrane, another curved needle head extruding filter membrane,
Splenocyte is set to be completely discharged in the basic culture solution in plate.Single cell suspension is made with sterile dropper piping and druming cell, harvests
Splenocyte suspension.Splenocyte suspension in plate is transferred in centrifuge tube, is centrifuged, is abandoned supernatant, use cell culture fluid centrifuge washing
Once.Isolated splenocyte is merged with the standby myeloma cell that recovers in advance with PEG, centrifuges, abandons supernatant, is used
Once, addition blows and beats into single cell suspension to cell culture fluid centrifuge washing with HAT cell culture fluid, spreads into 96 hole cell culture
Plate.The 7th day after cell fusion, cultivation plate hole bottom grows macroscopic clone, first by ELISA indirect methods to all cells
Hole is screened for the first time, and the cell hole of strong positive is presented in record.Each cell hole being positive to primary dcreening operation should be in time in 24 hole cells
Culture and cloning are enlarged in culture plate.Cell suspension serial dilution to statistically every hole is loaded using limiting dilution assay
Only contain individual cells, be transferred to 96 orifice plate cultures, operated by cloning for several times, until all cloning cell holes detect positive
When rate is 100%, you can it is determined that having obtained the hybridoma cell strain of secrete monoclonal antibody.By the positive hybridoma cell of acquisition
Expand culture in Tissue Culture Flask, then freeze and prepare ascites etc..
6 week old Healthy female mouse are taken, 0.5ml atoleine sensitization, after one to two weeks, every mouse peritoneal is injected intraperitoneally
Inject 1-2X 106Individual hybridoma, observation mouse state collects ascites after 7-10 days after mouse peritoneal substantially expands, from
Supernatant is ascites, packing, mark, standby.Ascites centrifugation 15min (4000rpm, room temperature), takes supernatant, in 4 DEG C of stirrings
Under be slowly added to saturated ammonium sulfate dropwise to semi-saturation, continue to stir 30min, centrifugation 30min (13000rpm, 4 DEG C), abandon
Clearly;Precipitation is dissolved in appropriate PBS (0.01M, pH7.4);Saturated ammonium sulfate is slowly added under being stirred at 4 DEG C dropwise to 33%, is continued
30min, centrifugation 30min (13000rpm, 4 DEG C) are stirred, supernatant is abandoned;Precipitation is dissolved in appropriate PBS (0.01M, pH7.4), 4 DEG C of dialysis
Overnight, determine antibody content, -20 DEG C freeze it is standby.Continue to be purified using Protein G pillars after ammonium sulfate precipitation, newly
Pillar first crosses post with 5ml ultra-pure waters, then purifies pillar with 5ml 0.4M PB buffer solutions (pH 7.0) balance;Antibody crosses post, process
In require it is slow cross post, in the hope of antibody protein preferably combine on binding site;Continue 10ml 0.4M PB buffer solutions (pH
7.0) balance purifying pillar;Antibody on 5ml 0.1M glycine-HCIs buffer solution (pH 2.7) elution of bound site, and add
1M Tris-HCl (pH 8.0) neutralize glycine, pH is remained the neutrality that suitable antibody is preserved.
Application mouse antibody subtype identification kit is measured and determines antibody titer using indirect ELISA method.
The preparation of the colloidal gold immuno-chromatography test paper strip of embodiment 4.
1. gold medal standard configuration is to screening
Pairing screening, the selection antibody pair that false positive is low, sensitivity is high are carried out to antibody.
The colloid gold test paper method of double antibodies sandwich is as follows:
It is prepared by a, collaurum
B, antibody labeling
C, metal spraying are with drawing film
A) envelope antigen is diluted into debita spissitudo to draw in T lines, sheep anti mouse two is anti-zoned in C lines, dries stand-by;
B) collaurum marked is sprayed on pretreated gold standard pad, dries stand-by.
D, assembling and test
A) by without the gold and film combination of two of numbering, detection pairing effect.
2. collaurum speed test paper condition optimizing
Optimized to drawing film, colloid gold label and reaction condition etc., obtain suitable condition, and write technical papers.
3. production
According to the technical papers write, the production (Fig. 9) of the fast test paper of collaurum is carried out.
Metal spraying:It is by purified gold labeling antibody concentration:2.0 μ L/cm are uniformly sprayed on place with point gold mark (film) machine
In the gold standard pad managed, 37 DEG C dry 24 hours, stand-by.
Draw film:Choose CN140 NC film points gold mark (film) machine by concentration be 2.0mg/mL FL155-1# mouse monoclonal antibody with
1.0 μ L/cm draw T lines, and concentration draws C lines for 1mg/mL sheep anti mouse secondary antibody with 1.0 μ L/cm, and 37 DEG C dry 24 hours, stand-by.
Antibody conjugates are screened:Screening monoclonal antibody intersects pairing, final choice FL155-1#, FL155-2# mouse list
Anti-, wherein FL155-1# draws film, FL155-2# antibody labelings.
Standard items detection is carried out to the colloidal gold immune chromatography test of preparation:With setting to 0,0.2,0.5,1 μ g/mL ox CK-
BB expressing proteins insert detector bar in centrifuge tube according to arrow in 1.5mL centrifuge tubes, and result (figure is read after 10 minutes
10), detection recombinant protein sensitivity can reach 0.2ppm.
Embodiment 5.CK-BB cow's serums pattern detection is reported
1st, CK-BB cow's serums sample testing method
Detect that operating procedure is as follows to actual sample using double antibodies sandwich Gold standard:
(1) operation instructions are please completely read before testing, and fast test paper and sample solution to be checked are recovered to normal temperature;
(2) please used as early as possible after fast test paper is taken out from packaging bag;
(3) fast test paper is taken out from test paper bucket, be inserted directly into sample cell, start timing;
(4) result should be read at 10-15 minutes, and other times interpretation is invalid;
(5) when reading result, fast test paper is horizontally placed at observer front, as shown in figure 11.
2nd, expressing protein is tested
With PBS dilute expressing protein to 0,0.5,1,5,10,40PPm, as shown in figure 12:
3rd, actual sample is detected
3.1, according to enzyme target testing result, serum sample are directly added dropwise test;
3.2 pattern detection results provide 3 groups of samples and detected.
CK-BB serum sample testing results
Conclusion:3 groups of totally 31 samples, can be detected positive (Figure 13) substantially.
Certainly the above embodiments merely illustrate the technical concept and features of the present invention, and its object is to allow be familiar with technique
People can understand present disclosure and implement according to this, it is not intended to limit the scope of the present invention.It is all according to this hair
Equivalent transformation or modification that the Spirit Essence of bright main technical schemes is done, should all be included within the scope of the present invention.
Claims (8)
1. a kind of anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar, it is characterised in that it includes:Backing, setting
Sample pad, gold-marking binding pad, chromatographic film and absorption pad on reagent backing, be provided with backing one end sample pad, one
End and gold-marking binding pad, the chromatographic film of one end and gold-marking binding pad other end abutting contact, the Yi Jiyu of sample pad abutting contact
The absorption pad of another end in contact of chromatographic film, the anti-ox source creatine of mouse marked wherein on gold-marking binding pad comprising Au colloidal nanoparticles
The first antibody of isodynamic enzyme, and misaligned detection line and nature controlling line are distributed in chromatographic film, wherein contain mouse in detection line
The 3rd antibody of anti-first antibody is contained on the secondary antibody of anti-ox source creatine isodynamic enzyme, nature controlling line.
2. a kind of anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar according to claim 1, its feature
It is, the secondary antibody is ability and ox source creatine isodynamic enzyme and first only in the presence of having ox source creatine isodynamic enzyme
Antibody specificity is combined, and the 3rd antibody can be combined with first antibody under any circumstance.
3. a kind of anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar according to claim 1, its feature
It is, the sample pad and gold-marking binding pad are least partially overlapped, and gold-marking binding pad and chromatographic film are at least partly overlapped.
4. a kind of anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar according to claim 1, its feature
It is, the collaurum particle diameter is 10-100nm, and the preparation of colloid gold particle is heated at reflux method using constant temperature.
5. a kind of anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar according to claim 1, its feature
It is:The detection line is separated by close to glue gold pad one end, the nature controlling line close to absorption pad one end, the detection line and nature controlling line
Distance is between 0.5-1.5cm.
6. a kind of anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar according to claim 5, its feature
It is, the upper lower half that the kit includes being mutually matched and fastening gets stuck, it is described to get stuck with well and peep hole, sample-adding
Hole position is at gold-marking binding pad and sample pad and local exposed sample pad, and peep hole is located above chromatographic film and exposed detection line
And nature controlling line.
7. a kind of method for preparing anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar, it is characterised in that it is wrapped
Include:
S1, prepare Au colloidal nanoparticles step;
The preparation process of the anti-ox source creatine isodynamic enzyme of S2, colloid gold label;
S3, glue gold pad process step;
S4, sample pad preparation process;
Detection line and the coating step of nature controlling line on S5, detecting pad;
S6, anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar number of assembling steps.
8. a kind of anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar described in claim 1 is preparing Diagnosis of Cattle
Application in Endometrium inflammation reagent.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710234074.5A CN107045057A (en) | 2017-04-11 | 2017-04-11 | A kind of ox source creatine kinase isozyme colloidal gold immune chromatography rapid detecting test paper strip |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710234074.5A CN107045057A (en) | 2017-04-11 | 2017-04-11 | A kind of ox source creatine kinase isozyme colloidal gold immune chromatography rapid detecting test paper strip |
Publications (1)
Publication Number | Publication Date |
---|---|
CN107045057A true CN107045057A (en) | 2017-08-15 |
Family
ID=59545742
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710234074.5A Pending CN107045057A (en) | 2017-04-11 | 2017-04-11 | A kind of ox source creatine kinase isozyme colloidal gold immune chromatography rapid detecting test paper strip |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107045057A (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN201087837Y (en) * | 2007-03-30 | 2008-07-16 | 万华普曼生物工程有限公司 | Human myohemoglobin/creatine kinase isoenzyme/myocardium calcium protein I diagnosis test paper |
CN202093024U (en) * | 2011-04-27 | 2011-12-28 | 李志华 | Myocardial infarction three-in-one gold-labeled rapid cassette test |
CN102539769A (en) * | 2011-12-22 | 2012-07-04 | 正元盛邦(天津)生物科技有限公司 | Method for semi-quantitative diagnosis of creatine kinase isoenzyme by double indicating line immuno-chromatography |
CN103267855A (en) * | 2013-05-06 | 2013-08-28 | 南京凯基生物科技发展有限公司 | CTnI, Myo and CK-MB three-in-one colloidal gold test strip, kit thereof, and making methods of test strip and kit |
-
2017
- 2017-04-11 CN CN201710234074.5A patent/CN107045057A/en active Pending
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN201087837Y (en) * | 2007-03-30 | 2008-07-16 | 万华普曼生物工程有限公司 | Human myohemoglobin/creatine kinase isoenzyme/myocardium calcium protein I diagnosis test paper |
CN202093024U (en) * | 2011-04-27 | 2011-12-28 | 李志华 | Myocardial infarction three-in-one gold-labeled rapid cassette test |
CN102539769A (en) * | 2011-12-22 | 2012-07-04 | 正元盛邦(天津)生物科技有限公司 | Method for semi-quantitative diagnosis of creatine kinase isoenzyme by double indicating line immuno-chromatography |
CN103267855A (en) * | 2013-05-06 | 2013-08-28 | 南京凯基生物科技发展有限公司 | CTnI, Myo and CK-MB three-in-one colloidal gold test strip, kit thereof, and making methods of test strip and kit |
Non-Patent Citations (2)
Title |
---|
T. SATTLER ET AL: "Creatine Kinase and Aspartate Aminotransferase in Cows as Indicators for Endometritis", 《JOURNAL OF VETERINARY MEDICINE SERIES》 * |
杨鼎等: "牛肌酸激酶同功酶 CK-BB 的全基因合成及其原核表达", 《畜牧与饲料科学》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101825633B (en) | Competitive ELISA kit for detecting african swine fever virus antibody and purposes thereof | |
CN105606826B (en) | A kind of kit of enzyme linked immunosorbent detection fowl chlamydia psittaci | |
CN108486064A (en) | The monoclonal antibody and application of hybridoma cell strain Anti-CLasMcAb1 and its secretion | |
CN1045603A (en) | Screening system | |
CN108486063A (en) | The monoclonal antibody and application of hybridoma cell strain Anti-CLas McAb2 and its secretion | |
CN101915835B (en) | Lily mottle virus double-antibody sandwich enzyme-linked immunosorbent assay kit and preparation method | |
US5928879A (en) | Method of diagnosing human granulocytic Ehrlichiosis | |
CN102183653A (en) | Cryptosporidium parvum immune colloidal gold detection test paper strip and production method thereof | |
CN100334110C (en) | Sperm protein monoclonal antibody and its preparing method and use | |
CN102830235A (en) | Luminescence detection kit and preparation method thereof | |
CN102798723B (en) | Chemiluminescence detection kit and preparation method | |
CN109900903B (en) | Porcine pseudorabies virus gE blocking ELISA antibody detection kit and application thereof | |
CN110484510B (en) | Hybridoma cell strain, monoclonal antibody secreted by hybridoma cell strain and application of monoclonal antibody | |
CN107045057A (en) | A kind of ox source creatine kinase isozyme colloidal gold immune chromatography rapid detecting test paper strip | |
CN107892713A (en) | The monoclonal antibody of the anti-main albumen 3 of royal jelly and the enzyme linked immunological kit for detecting the main albumen 3 of royal jelly | |
CN101781656A (en) | Expression of odontoglossum ringspot virus (ORSV) coat protein gene and preparation method of antibody | |
CN114164181B (en) | Hybridoma cell strain for producing bovine pregnancy related glycoprotein PAG8 monoclonal antibody and application thereof | |
CN104293823B (en) | The preparation method and application of soluble Type I DHV 3D albumen | |
CN109975541A (en) | A kind of detection card and preparation method thereof of quick detection canine distemper virus antigen | |
CN107132358A (en) | A kind of ox source creatine kinase isozyme double-antibody sandwich elisa quick detection kit | |
CN101418042A (en) | Separation and purification of recombinant human blood vessel endothelia cell growth factor, chemical labeling in vitro and use thereof | |
CN108866008A (en) | The monoclonal antibody and its cell strain of anti-Koi herpesvirus and application | |
CN107916254A (en) | Homer1 monoclonal antibodies and its application | |
CN109425738A (en) | 3 type antibody assay kit of pig circular ring virus and its application | |
CN107937606A (en) | A kind of reagent and method for identifying hydrophobia strain and wild type strains |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20170815 |