CN107045057A - A kind of ox source creatine kinase isozyme colloidal gold immune chromatography rapid detecting test paper strip - Google Patents

Abstract

The present invention relates to a kind of ox source creatine kinase isozyme (CK BB) colloidal gold immune chromatography rapid detecting test paper strip and method, it includes：Backing, it is arranged on the sample pad on reagent backing, gold-marking binding pad, chromatographic film and absorption pad, it is provided with the sample pad in backing one end, one end and the gold-marking binding pad of sample pad abutting contact, one end and the chromatographic film of gold-marking binding pad other end abutting contact, and the absorption pad with another end in contact of chromatographic film, the first antibody of the anti-ox source creatine isodynamic enzyme of mouse marked wherein on gold-marking binding pad comprising Au colloidal nanoparticles, and misaligned detection line and nature controlling line are distributed in chromatographic film, the secondary antibody of the anti-ox source creatine isodynamic enzyme of mouse is wherein contained in detection line, the 3rd antibody of anti-first antibody is contained on nature controlling line.The present invention sets up cow endometritis Rapid＆Early diagnosis new method, accomplishes not needing special instrument, by simple operations, realizes and makes Rapid＆Early diagnosis in field progress cow endometritis field quick detection and adjuvant clinical inspection.

Description

A kind of ox source creatine kinase isozyme colloidal gold immune chromatography rapid detecting test paper strip

Technical field

The present invention relates to colloidal gold immunochromatographimethod field of fast detection, and in particular to a kind of ox source creatine kinase isozyme (CK-BB) colloidal gold immune chromatography rapid detecting test paper strip and method.

Background technology

China's dairy development in recent years is very rapid, but development of the infertility to milk cow production has important shadow Ring.Great mass of data shows that infertility accounts for the 20%~30% of cow disease, and endometritis accounts for the 40%~60% of infertility. Cause the cause of disease of cow endometritis more, but caused by main cause is the early infection in postpartum, there are some researches show milk cow production Early stage afterwards has 93% Niu Fasheng uterine infection bacteriums, and 39% is reduced to infection rate at 46-60 days.

Cow endometritis prevents embryonated egg from implantation or embryo's Deaths, delays the calving interval, has a strong impact on The breeding of milk cow and production capacity and efficiency, great economic loss is caused to Cow product.According to document announcement, the U.S. has every year 12.19% milk cow is eliminated due to infertility or reproductive diseases, accounts for the 52.37% of superseded cow, every year because infertility is damaged Lose up to 2.7 hundred million dollars；Beijing Agricultural University accounts for infertile milk to 16 urban surveys such as Beijing, Nanjing, Shanghai, endometritis The 68.34% of ox, domestic infertile milk cow superseded every year accounts for the 60%-70% for eliminating sum.

Creatine kinase (Creatine Kinase, CK；EC 2.7.3.2) 81000~82000Da of molecular weight is by two The dimer of subunit (M and B) composition, turns phosphoryl reaction, in creatine and phosphocreatine between reversible catalysis creatine and ATP Played an important role in conversion reaction.Such as in energetic supersession most vigorous musculature and brain tissue, CK activity is Highest.In internal organs, uterus is the active organs of CK the 3rd, and first two are skeletal muscle and cardiac muscle.According to its isodynamic enzyme The difference of subunit and distributing position, there are three kinds of CK isoenzymes in ox, wherein：CK-MM (being specifically present in skeletal muscle), CK-MB (being specifically present in cardiac muscle) and CK-BB (being obtained from bovine brain).The above isoenzymes is all present in cytoplasm, Galitzer and Oehme (1985) will much lack to the CK of all organs of the ox CK contain in detection discovery, internal organs In skeletal muscle and cardiac muscle, and most CK belongs to isozyme C K-BB.In healthy cow's serum CK composition almost all by CK-MM is constituted, but research finds also to there are detectable CK- in pregnancy neutralizes postpartum women, the serum of Pregnant guinea pigs BB (brain source or smooth muscle source) and CK-MB (Clark et al., 1994).The reason for causing above phenomenon is likely to be in bosom The late pregnancy demand higher to energy (metabolism) (Clark et al., 1994), i.e. uterine tissue are before and after childbirth to it Mechanicalness and metabolism have higher requirement (Abramov et al., 1996).

We, which study, shows after endometrium infection inflammation that serum creatine kinase activity significantly increases, according to the study result its can It is used as the important diagnostic index of cow endometritis.At present, the diagnosis of cow endometritis rely primarily on visual examination, palpation and , there is early diagnosis diagnosis rate low and the problem of cause implantable pathogen superinfection in the conventional method based on uterine probe. Therefore, in the urgent need to a kind of quick, sensitive, economic and practical, behaviour suitable for cow endometritis early stage investigation is set up in research Make easy field fast detection method.

Immune colloidal gold technique is a kind of wider immunological method of application, and the technology is a kind of by colloid gold particle and bag Include the technology that many protein labelings including antigen, antibody form immune Au composite.Prepared using immune-gold labeled technology Label is applied in detection infectious disease, environmental contaminants, drugs, early pregnancy and animal doctor as the indicator in detecting system Deng field, the application of this technology greatly enhances the simplicity and rapidity of vitro diagnostic techniques.

The immune response occurred on chromatographic material, possesses the high specific, efficientibility, high affinity of immune response Feature.Specific process is, the sample solution containing determinand is by the capillarity of fiber chromatographic material along chromatographic material Move up, occurrence features immune response combined with the acceptor (antigen or antibody) for determinand that is fixed on chromatographic material, Antigen antibody complex is constantly accumulated by enrichment during a little, by enzyme reaction label or visable indicia thing directly perceived (such as Collaurum) it is allowed to develop the color, so as to reach the purpose of testing goal material.

The content of the invention

The present invention is according to cow endometritis and the positive correlation of serum creatine kinase activity, by recombinantly expressing Niu Yuan Creatine kinase isozyme (CK-BB), prepares screening mouse resource monoclonal antibody, further former using collaurum coating and immunochromatography Reason have developed a kind of test strips of quick detection ox source creatine kinase isozyme (CK-BB), swash for monitor on field milk cow creatine The change of enzyme isoenzyme (CK-BB).

It is an object of the invention to provide a kind of ox source creatine kinase isozyme (CK-BB) colloidal gold immunochromatographimethod quick detection Test strips and method, it is thus quick to detect endometritis, the method quantitatively detected by colloidal gold immunochromatographimethod, detection immediately The concentration of creatine kinase isozyme (CK-BB) in cow's serum, so that for assessing cow endometritis situation, accurately, quickly, Sensitivity is high, without professional's operation, and cost is relatively low, is easy to promote the use of.

The operation principle of double antibody sandwich method is as follows：The different antigen sites of two of determinand are respectively for monoclonal gold mark Antibody and detection line monoclonal antibody.Such as one positive sample, determinand can mark monoclonal antibody and detection line monoclonal antibody knot with gold simultaneously The macromolecular of a double-antibody sandwich determinand is synthesized, this huge molecule is due to being fixed on the monoclonal antibody of detection line in detection line (T) assemble, can be visually observed when assembling enough collaurums.Continue with the unnecessary gold labeling antibody that increases of determinand Chromatography, it is the secondary antibody of gold labeling antibody that nature controlling line is coated, when unnecessary gold labeling antibody chromatography arrives nature controlling line (C), and on C lines The constantly accumulation of two anti-bindings is until colour developing.The positive findings presented is：The double colour developings of T lines, C lines；Negative findings is：T lines disappear Lose, the colour developing of C lines.Detection line and nature controlling line do not develop the color then for failure.

To reach above-mentioned purpose, the present invention uses the first technical scheme：A kind of anti-ox source creatine isodynamic enzyme colloid gold immune Chromatography detecting test paper strip, it is characterised in that it includes：Backing, the sample pad being arranged on reagent backing, gold-marking binding pad, chromatography Film and absorption pad, be provided with the sample pad in backing one end, the gold-marking binding pad of one end and sample pad abutting contact, one end with The chromatographic film of gold-marking binding pad other end abutting contact and the absorption pad with another end in contact of chromatographic film, wherein gold mark is combined The first antibody of the anti-ox source creatine isodynamic enzyme of mouse marked on pad comprising Au colloidal nanoparticles, and distributed and do not weigh in chromatographic film The detection line and nature controlling line of conjunction, wherein contain in detection line and are wrapped on the secondary antibody of the anti-ox source creatine isodynamic enzyme of mouse, nature controlling line The 3rd antibody of anti-first antibody is contained.

On the basis of the first technical scheme, further comprise following attached technical scheme：

The secondary antibody is just to be specifically bound only in the presence of having CK-BB with CK-BB and first antibody, And the 3rd antibody can be combined with first antibody under any circumstance.

The sample pad and gold-marking binding pad are least partially overlapped, and gold-marking binding pad and chromatographic film are at least partly overlapped.

The collaurum particle diameter is 10-100nm, and the preparation of colloid gold particle is heated at reflux method using constant temperature.

The detection line is close to glue gold pad one end, and the nature controlling line is close to absorption pad one end, the detection line and nature controlling line Standoff distance is between 0.5-1.5cm.

The upper lower half that the kit includes being mutually matched and fastening gets stuck, described to get stuck with well and observation Hole, well is located at gold-marking binding pad and sample pad and local exposed sample pad, and peep hole is located at chromatographic film top and naked Reveal detection line and nature controlling line.

Further, after cow's serum sample application, colloidal gold immunochromatographykit kit association colloid gold reads instrument detection blood The CK-BB contained in final proof sheet concentration level.

Further, the collaurum reads instrument and quantitatively reads instrument using colloidal gold immunochromatographimethod, belong to one kind by light, The signal strength values of detection line and nature controlling line are read in the precision instrument of mechanical, electrical composition, scanning, by signal strength values by photoelectricity and Analog/digital conversion, switchs to data signal, the good CK-BB luminosity-concentration standard curve of built-in optimization, and data signal is in standard curve After middle calculating, the concentration value for detecting and obtaining is obtained.When the collaurum reads instrument Scanning Detction line with nature controlling line, absorb light and sweep Scope is retouched according to collaurum particle size.

Compared with prior art, beneficial effects of the present invention at least that：In kit, detection label CK-BB is used as Monoclonal antibody, using the collaurum being widely used at present as mark substance, flag condition is mature and stable nontoxic, reagent Box resolution ratio itself, sensitivity, stabilization are stronger, can select with the naked eye to do half-quantitative detection, can also coordinate collaurum to read instrument Use do quantitative detection.

The CK-BB colloidal gold immune chromatography rapid detecting test paper strips and detecting system of the present invention, it is simple to operate directly to heal Final proof sheet, detection time are short, are suitable for promoting the use of, and overcome existing enzyme-linked immunoassay method and chemoluminescence method, expensive, Detection is time-consuming and needs to put into the shortcoming of professional operator.

Present invention incorporates collaurum read instrument small volume, it is lightweight, be easy to carry and can independent process data depending on The advantage of detection is measured, is particularly suitable for detection of the cow's serum CK-BB levels in basic unit pasture.

The present invention improves detection serum creatine kinase index and disclosed by clinical verification, evaluation and to the perfect of this method With sensitivity, the accuracy of reaction cow uteri endometrial inflammation degree of inflammation, cow endometritis early stage is finally set up quick New method is diagnosed, accomplishes not needing special instrument, by simple operations, realizes and cow endometritis scene is carried out in field soon Rapid＆Early diagnosis is made in speed detection and adjuvant clinical inspection.

Brief description of the drawings

Below in conjunction with the accompanying drawings and embodiment the invention will be further described：

Fig. 1：It is that reference material uses SDS-PAGE electrophoresis with OX-heart source creatine kinase (CK-MB), detects endometritis ox CK reference materials in serum sample, figure are commercial cattle source CK-MB and rabbit source CK；

Fig. 2：Sample cow's serum detects that Fig. 2-A are that constant exposure time takes to obtain WB photos with CK-BB polyclonal antibodies WB, Fig. 2-B take to obtain WB photos to expose for a long time；Fig. 2-C show that the equal and anti-CK-BB polyclonal antibodies in all sample serum have spy Opposite sex reaction；

Fig. 3：Plasmid pET28b-CK-BB is through Nde I and Xho I double digestions；

Fig. 4：The protein induced results of ox isoenzymes of creatine kinase CK-BB：1：Total protein before induction, 2：20 DEG C of supernatants；3：20 DEG C precipitation；4：37 DEG C of supernatants；5：37 DEG C of precipitations；

Fig. 5：Ox isoenzymes of creatine kinase CK-BB proteins purify SDS-PAGE analysis charts, M：Protein marker； 1：Loading；2：Outflow；3：10mM Imidazole elution fractions；4：20mM Imidazole elution fractions；5-9：50mM Imidazole elution fractions；10-12：500mM Imidazole elution fractions；

Fig. 6：Ox isoenzymes of creatine kinase CK-BB protein SDS-PAGE analysis charts, M：Protein marker；1：Mesh Albumen；

Fig. 7：Ox isoenzymes of creatine kinase CK-BB albumen Western Blot analysis charts M：Protein marker；1：Mesh Albumen；

Fig. 8：Determination of protein concentration curve map；

Fig. 9：Colloidal gold immuno-chromatography test paper strip structural representation；

Figure 10：Standard items testing result：Be followed successively by 1 from left to right, 0.5,0.2,0.1,0ppm；

Figure 11：Colloidal gold immune chromatography rapid detecting test paper strip decision method；

Figure 12：Colloidal gold immune chromatography rapid detecting test paper strip detects, gradient PBS dilute expressing protein to 0,0.5,1, 5、10、40PPm；

Figure 13：31 groups of serum sample results are detected using colloidal gold immune chromatography rapid detecting test paper strip.

Embodiment

Creatine kinase and the correlation research of endometritis in the cow serum of embodiment 1.

Acquirement is diagnosed as the serum with endometritis ox by conventional method, detects its creatine kinase (CK) value, leads to Control and the comparison of positive group are crossed, the correlation of bovine endometritis and CK is determined.

Collect many parts of clinical symptoms from Huhehaote and packet header periphery cattle farm and suffer from ox blood for cow endometritis Clearly, carry out biochemical analysis and detection creatine kinase vigor and obtain related data.With OX-heart source creatine kinase (CK-MB) for reference material Using SDS-PAGE electrophoresis, detection endometritis cow's serum sample (Fig. 1), by the size and color of observing purpose band The depth judges clinical serum sample CK and uniformity and degree of conformity of the OX-heart source creatine kinase (CK-BB) for reference material.Tentatively grind Study carefully result as follows：1st, clinical diagnosis increases for the CK activity in the infected cattle serum sample of cow endometritis is more notable than healthy ox value It is high.The serum creatine kinase activity of normal ox only is concentrated mainly on 100-200U/L, infected cattle is only in 200- in 80-200U/L 1796U/L.2nd, the CK reference materials in figure are commercial cattle source CK-MB and rabbit source CK, have larger difference with clinical serum sample CK, are tied Close the CK monitoring results about humans and animals, primitive decision and clinical definite the infected cattle serum sample CK that to be endometritis related Essence is CK-BB.

The clinical symptoms that we also collect from cattle farm meet 6 parts of the infected cattle serum of cow endometritis, carry out CK work Power detects (table 1), while using protein immunoblot method Wenstern-Blot, the polyclonal of CK-BB is recombinantly expressed with rabbit-anti CK and recombination expression CK-BB polyclonal antibodies specific binding rate (Fig. 2) in antibody test clinical sample serum, to investigate weight Group expression CK-BB and clinical serum sample CK correlation, as a result show：1st, 6 clinical definite endometritis infected cattle serum Middle creatine kinase CK activity increases.2nd, recombination expression CK-BB rabbit source polyclonal antibody and clinical definite endometritis disease Creatine kinase CK has specific combination in cow's serum, and theoretical foundation has been established to develop colloidal gold immuno-chromatography test paper strip.

The sample cow's serum CK viability examinations of table 1

The correlation research result and recombinant bovine creatine kinase of creatine kinase and endometritis are same in comprehensive cow serum Work enzyme (CK-BB) protein immunoblot (Western-Blot) analysis result, it may be determined that by recombinant bovine creatine kinase isozyme (CK-BB) start to develop detection ox creatine kinase isozyme (CK-BB) colloidal gold immuno-chromatography test paper strip, one is entered on this basis Step research and development cow endometritis Rapid＆Early diagnosis kit.

The full genome of embodiment 2. synthesis ox isoenzymes of creatine kinase CK-BB

Because ox isoenzymes of creatine kinase CK-BB has high correlation in bovine endometritis and serum, therefore use ox Isoenzymes of creatine kinase CK-BB prepares related monoclonal antibody as antigen and resisted more.In the present invention, crucial reagent bovine brain source or flat Sliding flesh source creatine kinase CK-BB shortage, seriously constrains the development of experiment.Because CK-BB application is smaller, ox on the market Most of source creatine kinase is the commodity without CK-BB using CK-MB as main component, and difficulty is caused to research.

In order to solve the problem of CK-BB is not enough, inventor's research determines the method synthesis ox source CK- synthesized using full genome BB genes, and prokaryotic expression is carried out to it.Ox creatine kinase CK-BB amino acid sequence, Serial No. are inquired by NCBI： GenBank:AAX08725.1 and the codon optimization for carrying out being applied to e. coli bl21 to it, it is artificial synthesized using two step method Ox CK-BB full genome, is next connected to expression vector pET28b by synthetic full genome, is transformed into e. coli bl21 (DE3) a large amount of destination proteins, have been measured through a small amount of expression experiments to express, have been successfully prepared ox isoenzymes of creatine kinase CK-BB's Colibacillus engineering, is largely to prepare ox CK-BB the later stages to have established solid foundation.Experimentation is summarized as follows：

2.1CK-BB gene genetics codon is transformed and the design of primer and artificial synthesized

According to ox isoenzymes of creatine kinase CK-BB amino acid sequence (GenBank:AAX08725.1), it is soft in Bioedit The nucleotide sequence of the gene is derived under the auxiliary of part, initiation codon ATG and terminator codon TAA are made an addition to respectively 5 ' the ends and 3 ' ends of CK-BB sequences；Using DNAworks softwares on the basis of e. coli codon frequency of use, to the gene Codon optimize, design of primers synthesizes 54 40bp primers overlapped each other, therefrom chooses primer CK-1 and CK-54 (table 2) introduces Nde I and Xho I restriction enzyme sites respectively.It is standby after purification through desalination, PAGE after primer synthesis.

Primer	Primer sequence
		CK-1	GCCTGGTGCCGCGCGGCAGCCATATGCCTTTCAGCAA
CK-54	CAGTGGTGGTGGTGGTGGTGCTCGAGTTTCTGC

Table 2CK-BB full genomes are synthesized and amplification coding DNA primer sequence

2.2 Ns of isoenzymes of creatine kinase CK-BB full genome synthesis

First to synthesis CK-BB full genome sequencing results, subsequent artificial synthesized improved ox isoenzymes of creatine kinase CK- BB complete genome sequences, the plasmid pET28b-CK-BB of synthesis can be through Nde I and Xho I double digestions (Fig. 3).

2.3 by prokaryotic expression system, a small amount of expression recombinant bovine isoenzymes of creatine kinase CK-BB albumen.

PET28b-CK-BB positive plasmids convert prokaryotic expression Host Strains BL21 and Rosetta, are coated on correspondence solid training Support base, 37 DEG C of culture 12-16h.Picking single bacterium falls within correspondence fluid nutrient medium culture 12-16h, preserves glycerol stock in -80 DEG C.Bacterium Plant activation：Recovery strain, 37 DEG C of incubated overnight activation.Induced expression：Next day, strain is with 1：50 expand culture 5mL, 37 DEG C of cultures To OD600=0.4-0.6,2.5mL strains are collected through processing as control before induction.Remaining 2.5mL adds 0.5mM IPTG, 37 DEG C of induced expression 3h, the thalline being collected by centrifugation is through handling as postinduction sample, and SDS-PAGE identifies the expression of albumen.

Prokaryotic expression carrier information：

Recovery PET28b-CK-BB (BL21) strain, 37 DEG C of incubated overnight activation.Next day, strain is with 1：50 expand culture 800mL, 37 DEG C of cultures to OD600=0.4-0.6, adds 0.5mM IPTG, 37 DEG C of induced expression 5h.8000rpm, 4 DEG C of centrifugations 5min, collects thalline.Plus 100mL crushes liquid and carries out ultrasonic treatment.Cracking condition：Temperature ice bath, power 60%, ultrasound 2s, It is spaced 2s, time 15min.12000rpm, 4 DEG C of centrifugation 15min, collect supernatant precipitation.SDS-PAGE is detected, judges purpose egg White expression-form.Using high-affinity NI purifying resin supernatants, collection flows through liquid, eluent, and SDS-PAGE detection albumen is pure Change effect.The destination protein dialysis of purifying is removed into imidazoles, SDS-PAGE detection albumen dialysis-effects.

Detection results are as follows：

(1) the protein induced results of ox isoenzymes of creatine kinase CK-BB

It is heavy at 37 DEG C it can be seen from SDS-PAGE figures by carrying out SDS-PAGE analyses (Fig. 4) to recombination expression sample There is obvious expression in shallow lake.

(2) ox isoenzymes of creatine kinase CK-BB proteins nickel agarose affinity chromatography SDS-PAGE results (Fig. 5) pass through Figure SDS-PAGE analysis charts are eluted successively when can be seen that destination protein 50mM, 100mM and 500mM Imidazole, The purity of destination protein is preferable when at 500mM.Albumen plus 0.3%SKL at 10-12 is taken to dialyse to 10MmPBS, 0.1% In SKL, pH 8.0.Concentration, filtration sterilization, packing is after -80 DEG C of preservations.

(3) ox isoenzymes of creatine kinase CK-BB albumen finally purifies SDS-PAGE analyses (Fig. 6)

(4) ox isoenzymes of creatine kinase CK-BB albumen Western Blot analyze (Fig. 7)

(5) ox isoenzymes of creatine kinase CK-BB determination of protein concentration SK3071 non-interference type determination of protein concentration reagents Box determines protein concentration:2.012mg/ml, as a result as shown in Figure 8.

The preparation of embodiment 3.CK-BB monoclonal antibodies

1. lab scale：PET28b-CK-BB positive plasmids convert BL21 and Rosetta Host Strains, and lab scale has obvious expression.

2. it is prepared by antigen：A large amount of induced expression PET28b-CK-BB (BL21), destination protein is obvious in supernatant inclusion body Expression, preferentially purifies supernatant, and supernatant is purified, dialysis, finally gives CK-BB recombinant protein 5mg, purity of protein ＞ 90%.

3. more than it is anti-prepare：It is prepared for polyclonal antibody, potency 1:243000.

4. it is prepared by monoclonal antibody：Monoclonal antibody is prepared for, 5 plants of positive cell strain is screened.

5. Antibody preparation and purifying：Ascites is planted, purifying obtains monoclonal antibody.

6. antibody conjugates are screened：Pairing screening is carried out to antibody using ELISA method, the antibody pair that can be matched is obtained.

7.ELISA condition optimizings：The best antibody of effect is chosen to carrying out ELISA condition optimizings.

8. colloidal-gold strip piece optimization：A pair of best antibody of screening effect carry out colloidal-gold strip piece optimization.

Preparation method is summarized as follows：

Take 2 month female new zealand white rabbit one to be immunized, three times are carried out altogether and is immunized, takes leg muscle multiple spot to note Penetrate.Every new zealand white rabbit antigen immune consumption is 500ug every time, and initial immunity is emulsified with equivalent Freund's complete adjuvant, the Secondary immunity is emulsified with equivalent incomplete Freund's adjuvant, and third time is immune to be mixed with normal saline, ear vein injection.Second Secondary immune rear 14 days venous blood collections, are surveyed antibody titer by indirect method, the antibody tormation for target are determined whether with this.Effect Third time carries out booster immunization after valency is up to standard；Potency is not up to standard, then third time continuation incomplete Freund's adjuvant is subcutaneously exempted from Epidemic disease, the 4th progress booster immunization after 28 days.Booster immunization takes blood after 14 days.

Take 6 week old female BAl BIcs/c mouse four to be immunized, three times are carried out altogether and is immunized, take batch lower multi-point injection.Often It is 25ug that consumption, which is immunized, in secondary every murine antigen, and initial immunity is emulsified with equivalent Freund's complete adjuvant, second of immune equivalent Incomplete Freund's adjuvant is emulsified, and third time is immune to be mixed with normal saline, is injected intraperitoneally.Second of immune rear 10 days tail is quiet Arteries and veins is taken a blood sample, and antibody titer is surveyed by indirect method, and the antibody tormation for antigen is determined whether with this.Compare four mouse effects Valency, finally selects the higher mouse of antibody titer to be used for cell fusion.First three day is merged, with the direct booster immunization of antigen once, Dosage is the same.

Taken out from liquid nitrogen and freeze myeloma cell's cell, be immediately placed in 37 DEG C of water-baths and melt, supernatant is abandoned in centrifugation, is used A small amount of complete culture solution breaks up cell mass, adds about complete medium in cryopreservation tube, is blown and beaten uniformly with suction pipe, all suctions out and turns Into Tissue Culture Flask, it is placed in 37 DEG C of CO2gas incubators and cultivates.Reached after cell covers with bottom of bottle in another cell bottle Culture, observes its cell state under inverted microscope, and cell in good condition is standby to do fusion use.

The mouse of potency highest and booster immunization is taken, eyeball excise blood sampling, separation serum is used as positive control during detection Serum.Mouse cervical dislocation is lethal, alcohol disinfecting is soaked in, is moved into superclean bench, is fixed on dissection plate, with sterilizing Scissors, tweezers cut off left side skin and peritonaeum respectively, and sterile taking-up spleen is placed in the sterilized petri dishes for having filled basic culture solution Clear Xian, peels off the connective tissue on envelope.Spleen is moved into another Sheng to there are about in the filter membrane in the plate of basic culture solution, with two Curved needle head on individual syringe is by spleen acanthopore, and then one of curved needle head fixes filter membrane, another curved needle head extruding filter membrane, Splenocyte is set to be completely discharged in the basic culture solution in plate.Single cell suspension is made with sterile dropper piping and druming cell, harvests Splenocyte suspension.Splenocyte suspension in plate is transferred in centrifuge tube, is centrifuged, is abandoned supernatant, use cell culture fluid centrifuge washing Once.Isolated splenocyte is merged with the standby myeloma cell that recovers in advance with PEG, centrifuges, abandons supernatant, is used Once, addition blows and beats into single cell suspension to cell culture fluid centrifuge washing with HAT cell culture fluid, spreads into 96 hole cell culture Plate.The 7th day after cell fusion, cultivation plate hole bottom grows macroscopic clone, first by ELISA indirect methods to all cells Hole is screened for the first time, and the cell hole of strong positive is presented in record.Each cell hole being positive to primary dcreening operation should be in time in 24 hole cells Culture and cloning are enlarged in culture plate.Cell suspension serial dilution to statistically every hole is loaded using limiting dilution assay Only contain individual cells, be transferred to 96 orifice plate cultures, operated by cloning for several times, until all cloning cell holes detect positive When rate is 100%, you can it is determined that having obtained the hybridoma cell strain of secrete monoclonal antibody.By the positive hybridoma cell of acquisition Expand culture in Tissue Culture Flask, then freeze and prepare ascites etc..

6 week old Healthy female mouse are taken, 0.5ml atoleine sensitization, after one to two weeks, every mouse peritoneal is injected intraperitoneally Inject 1-2X 10⁶Individual hybridoma, observation mouse state collects ascites after 7-10 days after mouse peritoneal substantially expands, from Supernatant is ascites, packing, mark, standby.Ascites centrifugation 15min (4000rpm, room temperature), takes supernatant, in 4 DEG C of stirrings Under be slowly added to saturated ammonium sulfate dropwise to semi-saturation, continue to stir 30min, centrifugation 30min (13000rpm, 4 DEG C), abandon Clearly；Precipitation is dissolved in appropriate PBS (0.01M, pH7.4)；Saturated ammonium sulfate is slowly added under being stirred at 4 DEG C dropwise to 33%, is continued 30min, centrifugation 30min (13000rpm, 4 DEG C) are stirred, supernatant is abandoned；Precipitation is dissolved in appropriate PBS (0.01M, pH7.4), 4 DEG C of dialysis Overnight, determine antibody content, -20 DEG C freeze it is standby.Continue to be purified using Protein G pillars after ammonium sulfate precipitation, newly Pillar first crosses post with 5ml ultra-pure waters, then purifies pillar with 5ml 0.4M PB buffer solutions (pH 7.0) balance；Antibody crosses post, process In require it is slow cross post, in the hope of antibody protein preferably combine on binding site；Continue 10ml 0.4M PB buffer solutions (pH 7.0) balance purifying pillar；Antibody on 5ml 0.1M glycine-HCIs buffer solution (pH 2.7) elution of bound site, and add 1M Tris-HCl (pH 8.0) neutralize glycine, pH is remained the neutrality that suitable antibody is preserved.

Application mouse antibody subtype identification kit is measured and determines antibody titer using indirect ELISA method.

The preparation of the colloidal gold immuno-chromatography test paper strip of embodiment 4.

1. gold medal standard configuration is to screening

Pairing screening, the selection antibody pair that false positive is low, sensitivity is high are carried out to antibody.

The colloid gold test paper method of double antibodies sandwich is as follows：

It is prepared by a, collaurum

B, antibody labeling

C, metal spraying are with drawing film

A) envelope antigen is diluted into debita spissitudo to draw in T lines, sheep anti mouse two is anti-zoned in C lines, dries stand-by；

B) collaurum marked is sprayed on pretreated gold standard pad, dries stand-by.

D, assembling and test

A) by without the gold and film combination of two of numbering, detection pairing effect.

2. collaurum speed test paper condition optimizing

Optimized to drawing film, colloid gold label and reaction condition etc., obtain suitable condition, and write technical papers.

3. production

According to the technical papers write, the production (Fig. 9) of the fast test paper of collaurum is carried out.

Metal spraying：It is by purified gold labeling antibody concentration：2.0 μ L/cm are uniformly sprayed on place with point gold mark (film) machine In the gold standard pad managed, 37 DEG C dry 24 hours, stand-by.

Draw film：Choose CN140 NC film points gold mark (film) machine by concentration be 2.0mg/mL FL155-1# mouse monoclonal antibody with 1.0 μ L/cm draw T lines, and concentration draws C lines for 1mg/mL sheep anti mouse secondary antibody with 1.0 μ L/cm, and 37 DEG C dry 24 hours, stand-by.

Antibody conjugates are screened：Screening monoclonal antibody intersects pairing, final choice FL155-1#, FL155-2# mouse list Anti-, wherein FL155-1# draws film, FL155-2# antibody labelings.

Standard items detection is carried out to the colloidal gold immune chromatography test of preparation：With setting to 0,0.2,0.5,1 μ g/mL ox CK- BB expressing proteins insert detector bar in centrifuge tube according to arrow in 1.5mL centrifuge tubes, and result (figure is read after 10 minutes 10), detection recombinant protein sensitivity can reach 0.2ppm.

Embodiment 5.CK-BB cow's serums pattern detection is reported

1st, CK-BB cow's serums sample testing method

Detect that operating procedure is as follows to actual sample using double antibodies sandwich Gold standard：

(1) operation instructions are please completely read before testing, and fast test paper and sample solution to be checked are recovered to normal temperature；

(2) please used as early as possible after fast test paper is taken out from packaging bag；

(3) fast test paper is taken out from test paper bucket, be inserted directly into sample cell, start timing；

(4) result should be read at 10-15 minutes, and other times interpretation is invalid；

(5) when reading result, fast test paper is horizontally placed at observer front, as shown in figure 11.

2nd, expressing protein is tested

With PBS dilute expressing protein to 0,0.5,1,5,10,40PPm, as shown in figure 12：

3rd, actual sample is detected

3.1, according to enzyme target testing result, serum sample are directly added dropwise test；

3.2 pattern detection results provide 3 groups of samples and detected.

CK-BB serum sample testing results

Conclusion：3 groups of totally 31 samples, can be detected positive (Figure 13) substantially.

Certainly the above embodiments merely illustrate the technical concept and features of the present invention, and its object is to allow be familiar with technique People can understand present disclosure and implement according to this, it is not intended to limit the scope of the present invention.It is all according to this hair Equivalent transformation or modification that the Spirit Essence of bright main technical schemes is done, should all be included within the scope of the present invention.

Claims (8)

1. a kind of anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar, it is characterised in that it includes：Backing, setting Sample pad, gold-marking binding pad, chromatographic film and absorption pad on reagent backing, be provided with backing one end sample pad, one End and gold-marking binding pad, the chromatographic film of one end and gold-marking binding pad other end abutting contact, the Yi Jiyu of sample pad abutting contact The absorption pad of another end in contact of chromatographic film, the anti-ox source creatine of mouse marked wherein on gold-marking binding pad comprising Au colloidal nanoparticles The first antibody of isodynamic enzyme, and misaligned detection line and nature controlling line are distributed in chromatographic film, wherein contain mouse in detection line The 3rd antibody of anti-first antibody is contained on the secondary antibody of anti-ox source creatine isodynamic enzyme, nature controlling line.

2. a kind of anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar according to claim 1, its feature It is, the secondary antibody is ability and ox source creatine isodynamic enzyme and first only in the presence of having ox source creatine isodynamic enzyme Antibody specificity is combined, and the 3rd antibody can be combined with first antibody under any circumstance.

3. a kind of anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar according to claim 1, its feature It is, the sample pad and gold-marking binding pad are least partially overlapped, and gold-marking binding pad and chromatographic film are at least partly overlapped.

4. a kind of anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar according to claim 1, its feature It is, the collaurum particle diameter is 10-100nm, and the preparation of colloid gold particle is heated at reflux method using constant temperature.

5. a kind of anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar according to claim 1, its feature It is：The detection line is separated by close to glue gold pad one end, the nature controlling line close to absorption pad one end, the detection line and nature controlling line Distance is between 0.5-1.5cm.

6. a kind of anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar according to claim 5, its feature It is, the upper lower half that the kit includes being mutually matched and fastening gets stuck, it is described to get stuck with well and peep hole, sample-adding Hole position is at gold-marking binding pad and sample pad and local exposed sample pad, and peep hole is located above chromatographic film and exposed detection line And nature controlling line.

7. a kind of method for preparing anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar, it is characterised in that it is wrapped Include：

S1, prepare Au colloidal nanoparticles step；

The preparation process of the anti-ox source creatine isodynamic enzyme of S2, colloid gold label；

S3, glue gold pad process step；

S4, sample pad preparation process；

Detection line and the coating step of nature controlling line on S5, detecting pad；

S6, anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar number of assembling steps.

8. a kind of anti-ox source creatine isodynamic enzyme colloidal gold immunochromatographydetection detection test paper bar described in claim 1 is preparing Diagnosis of Cattle Application in Endometrium inflammation reagent.