CN107058340A - One grows tobacco anti-drought gene NtSAP5 and its cloning process and application - Google Patents
One grows tobacco anti-drought gene NtSAP5 and its cloning process and application Download PDFInfo
- Publication number
- CN107058340A CN107058340A CN201710302599.8A CN201710302599A CN107058340A CN 107058340 A CN107058340 A CN 107058340A CN 201710302599 A CN201710302599 A CN 201710302599A CN 107058340 A CN107058340 A CN 107058340A
- Authority
- CN
- China
- Prior art keywords
- ntsap5
- tobacco
- gene
- drought
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
Grown tobacco anti-drought gene NtSAP5 and its cloning process and application the invention discloses one；Tobacco anti-drought gene NtSAP5 nucleotide sequences such as SEQ ID NO：Shown in 1；The amino acid sequence of encoding proteins such as SEQ ID NO：Shown in 2；The overexpression gene can improve adaptability of the tobacco to drought stress, and NtSAP5 has broad application prospects in tobacco drought resisting field.In the present invention, in the tobacco seedling blade of Osmotic treatment, described ubiquitin E3 connection enzyme coding genes NtSAP5 is induced expression.Albumen NtSAP5 of the present invention is the crucial enzyme in Plant Ubiquitin protein degradation approach, so regulation and control NtSAP5 expression can adjust resistance of the plant to arid.Therefore the described drought-resistant gene NtSAP5 of tobacco has broad application prospects in plant drought field, and its economic efficient latent is huge.
Description
Technical field
The invention belongs to genetic engineering technology field, and in particular to one grows tobacco anti-drought gene NtSAP5 and its cloning process
With application.
Background technology
Arid has a strong impact on the growing of crop, yield and quality.The drought-resistant ability for improving plant has become the modern times
One of key issue in plant research work.The research of drought resistance mechanism is the basis of Drought-resistant Breeding, be also breeding it is crucial because
One of element.The effort of decades is experienced, the research to plant drought is analyzed from the appearance factor of drought resistant index, entered point
The exploration of son and gene level.
In recent years, with global warming, arid turns into the natural calamity frequently occurred in China's crop production.Cigarette
Grass is very high in requirement of the whole breeding time to moisture as the important industrial crops of China.Most of China cigarette district be in arid,
In Semi-arid environment, and high-quality cigarette district multidigit often influences growing for cigarette strain in Hills because of soil drought, causes
The yield and quality reduction of tobacco leaf, arid has turned into one of main limiting factor that restriction China's yield of tobacco is improved with quality.
Therefore, strengthen the excavation and utilization of tobacco anti-drought gene resource, for tobacco drought resisting rearing new variety, realize that tobacco agriculture can be held
Supervention exhibition is significant.
Since 1980s, domestic and foreign scholars are done in terms of arid is to tobacco growing, development, the influence of metabolism
Numerous studies, achieve some impressive progresses.Being summed up mainly has the following aspects:First, arid is to tobacco physiology
Influence, be mainly manifested in:(1) drought stress have impact on the synthesis of chlorophyll, promote the decomposition of chlorophyll, so as to have impact on
Photosynthetic efficiency (the Plant Molecular Biology, 1979,20 of blade:37-44) ；(2) drought stress causes plant nitrogen
The activity reduction of plain key enzyme-nitrate reductase (NR), and hydrolase of proteolysis enhancing causes proline, glutamy
Amine, asparagine and valine etc. are largely accumulated；(3) drought stress causes cell membrane lipid peroxidation to strengthen, and membrane permeability increases
Plus, there is Electrolyte Leakage in the rise of MDA (MDA) content.Under the enzymatic activitys such as antioxidative defense enzyme S0D, P0D, CAT are notable
Drop.Second, the influence that arid is developed to tobacco growing is mainly manifested in:(I) drought stress reduces sprouting and the seedling of seed
Survive；(2) growth of root system is inhibited, so as to have impact on the absorption of mineral nutrition；(3) drought stress causes plant short and small,
Internode is short, and blade is small, easy early ageing.These researchs preferably illustrate physiology of the arid to tobacco growing, development and metabolic effect
Biochemical basis, but lack the research to tobacco drought resisting molecular genetic mechanism.
In recent years, going deep into molecular biology and genomics research, the excavation of anti-drought gene turns into current crop
The focus that degeneration-resistant genetic resources is studied with breed improvement, increasing gene related to drought tolerance is cloned and identified in succession.According to
The function of anti-drought gene, can be divided into gene studies on plant drought-resistance two major classes:First genoid is functional gene, is mainly being planted
Shielded in thing resistance.This genoid mainly includes infiltration and adjusts benzyl because such as:Trehalose synthetase geneTPSlJfAmmonia
Acid synthase geneP5CS, mannitol synthetic genemtlD, betaine synthetase level withinBADHAnd press synthetic gene moreOdc
Deng；Protect the active gene of large biological molecule such as:Dehydrin geneBDN1, water channel protein geneAQPWith late embryo hair
Raw Abundant proteinLEADeng.Second genoid is tune benzyl because mainly playing regulation during signal transduction and Stress gene expression
Effect, mainly including some transcription factor genes such as:DREB、MYB、bZIP、WRKY、NACDeng.These genes are in plant gene
It is applied in engineering.
A kind of important form of ubiquitination organism epigenetic modification, it is general that the process can occur biological vivo protein
Elementization, the albumen of ubiquitination can be degraded.Ubiquitin ligase E3 is the crucial enzyme during ubiquitination, determines those eggs
In vain can be by ubiquitination.Ubiquitination plays an important role in phytohormone Regulation, flower development and pathogen defense response
(Plant J,2010,61:1029-1040 ；J Exp Bot, 2007,58:221-227).
The content of the invention
The first object of the present invention is that providing one grows tobacco anti-drought gene NtSAP5；Second purpose is described in offer
Tobacco anti-drought gene NtSAP5 cloning process, the 3rd purpose is the application of the tobacco anti-drought gene NtSAP5 described in offer.
The first object of the present invention is achieved in that described tobacco anti-drought gene NtSAP5 nucleotide sequence such as
SEQ ID NO：Shown in 1.
The second object of the present invention, which is achieved in that, to be comprised the following steps：
A, tobacco leaf cDNA are synthesized：Tobacco leaf total serum IgE is extracted, reverse transcription obtains the first chain cDNA；
The PCR amplifications of B, NtSAP5 gene：Using tobacco leaf cDNA as template, primer is designed according to NtSAP5 gene orders, entered
Performing PCR is expanded, and is reclaimed and purifying pcr amplification product, and be sequenced.
The third object of the present invention is achieved in that described tobacco anti-drought gene NtSAP5 drought-resistant turns base obtaining
Because of the application in tobacco plant.
The invention provides a kind of new plant drought GAP-associated protein GAP and its encoding gene.
Plant drought GAP-associated protein GAP provided by the present invention, entitled NtSAP5, it is cultivated tobacco from cloud and mist 87, is
Protein with one of following amino acid residue sequences：
1) the SEQ ID NO in sequence table：2；
2) by SEQ ID No in sequence table：2 amino acid residue sequence by one or several amino acid residues substitution and/
Or missing and/or addition and the protein related to plant drought.
Sequence 2 in sequence table is made up of 154 amino acid.
The substitution of one or several amino acid residues and/or missing and/or addition refer to no more than 10 amino acid
The substitution of residue and/or missing and/or addition.
NtSAP5 encoding gene (NtSAP5) falls within protection scope of the present invention.
NtSAP5 encoding gene, can have one of following nucleotide sequence：1) SEQ ID No in sequence table：1 DNA
Sequence；2) SEQ ID No in polynucleotide：The polynucleotides of 2 protein sequences；3) can be with sequence table under high high stringency conditions
Middle SEQ ID No：The nucleotide sequence of the 1 DNA sequence dna hybridization limited；4) with SEQ ID No in sequence table：The 1 DNA sequences limited
Row have more than 70% homology, and coding identical function protein DNA sequence.
Expression vector containing NtSAP5 of the present invention, cell line and Host Strains belong to protection scope of the present invention.Amplification
The primer pair of any fragment falls within protection scope of the present invention in NtSAP5.
It is the above-mentioned plant of overexpression in plant present invention also offers the method using the genes amplification plant drought resistance
Thing drought resistance related protein encoding gene.
The above-mentioned plant drought resistance related protein encoding gene NtSAP5 of overexpression can pass through accomplished in many ways, such as plant
The method that viral vector mediated gene is overexpressed, agrobacterium mediation converted over-express vector is rectified to optimize to gene code and repaiied
Change, the gene promoter is optimized to reach that being overexpressed the methods such as effect realizes.The method of overexpression gene of the present invention
Above-mentioned several method is not limited to, as long as can overexpression NtSAP5.
Plant performance is set to be drought resisting using any gene overexpression or the genetic modification method NtSAP5；Utilize any one
The carrier that foreign gene is expressed in plant can be guided by planting, and NtSAP5 provided by the present invention is transferred in plant, plant is just
Show arid insensitive.
The NtSAP5 genes of the present invention can be added when being building up in plant expression vector before its transcription initiation nucleotides
Any one enhancing promoter or inducible promoter.For the ease of transgenic plant cells or plant are identified and sieved
Choosing, can be processed to used carrier, such as add plant it is alternative mark (gus gene, luciferase genes) or
Resistant antibiotic marker (gentamicin, kanamycins etc.).The plant host being converted both can be that unifacial leaf is planted
Thing or dicotyledon, such as：Tobacco, paddy rice, wheat, corn, cucumber, tomato, willow, turfgrass or lucerne place etc..From
The security consideration of genetically modified plants, can be not added with any selected marker, directly be come with plant seedling stage leaves water loss degree
Screen transformed plant.The expression vector for carrying NtSAP5 genes of the present invention can be by using Ti-plasmids, Ri plasmids, plant virus
The conventional biology methods such as carrier, directly delivered DNA, microinjection, conductance, agriculture bacillus mediated convert plant cell or tissue,
And by the plant of conversion through tissue cultivating into plant.
The plant drought GAP-associated protein GAP and its encoding gene of the present invention provides base for crops especially tobacco Drought-resistant Breeding
Because of the support with technology.
In the present invention, in the tobacco seedling blade of Osmotic treatment, described ubiquitin E3 connection enzyme coding gene NtSAP5 quilts
Induced expression.Albumen NtSAP5 of the present invention is the crucial enzyme in Plant Ubiquitin protein degradation approach, so regulation and control
NtSAP5 expression can adjust resistance of the plant to arid.Therefore the gene NtSAP5 of described responses of drought stress is in plant drought
Field has broad application prospects, and its economic efficient latent is huge.
Brief description of the drawings
Fig. 1 is NtSAP5 gene response drought stress block diagrams in tobacco leaf of the present invention；
Fig. 2 is NtSAP5 PCR primer electrophoretogram；
Fig. 3 is pdonr-zeo carrier figures；
Fig. 4 schemes for NtSAP5 gene plant expression vectors PB2GW7；
Fig. 5 is the tobacco line expression block diagram for turning NtSAP5 genes；
The growth phenotype photo that Fig. 6 is handled drought stress for the tobacco plant of NtSAP5 gene overexpressions.
Embodiment
With reference to embodiment and accompanying drawing, the present invention is further illustrated, but the present invention is not subject in any way
Limitation, based on present invention teach that any conversion or replacement made, belong to protection scope of the present invention.
Tobacco anti-drought gene NtSAP5 of the present invention nucleotide sequence such as SEQ ID NO：Shown in 1.
The amino acid sequence such as SEQ ID NO of described tobacco anti-drought gene NtSAP5 codings：Shown in 2.
Tobacco anti-drought gene NtSAP5 of the present invention cloning process, comprises the following steps：
A, tobacco leaf cDNA are synthesized：Tobacco leaf total serum IgE is extracted, reverse transcription obtains the first chain cDNA；
The PCR amplifications of B, NtSAP5 gene：Using tobacco leaf cDNA as template, primer is designed according to NtSAP5 gene orders, entered
Performing PCR is expanded, and is reclaimed and purifying pcr amplification product, and be sequenced.
Primer described in step B is：
Forward primer：5’- ATGGCTCAGAGAACAGAGAAAG -3’
Reverse primer：5’- TCAAAGTTTAACGATCTTCG -3’.
PCR reaction systems and amplification condition described in step B is as follows：
The concrete operations of sequencing described in step B are sequenced to deliver invitrogen companies.
The concrete operations of recovery and purifying pcr amplification product described in step B are as follows：
Described recovery and the concrete operations of purifying pcr amplification product are as follows：After gel electrophoresis, mesh will be carried with clean blade
The glue of fragment cut down, be put into centrifuge tube, glue should not be cut too much, and DNA fragmentation solution contains during avoiding reclaiming
Substantial amounts of impurity；Added into centrifuge tube after the QG solution of 3 times of volumes, the min of warm bath 10 under the conditions of 50 DEG C, until glue is complete
Melt；In the adsorption column that solution in centrifuge tube is moved on to 2 ml, 1 min is centrifuged, liquid phase is discarded；Added again into adsorption column
0.5 ml QG solution, centrifuges 1 min, discards liquid phase；0.75 ml PE solution is added to adsorption column, 1 min is centrifuged, discards
Liquid phase；Centrifuge again after 1 min, adsorption column is placed on a new centrifuge tube, add 50 μ l lysate, stand 1
Min, finally centrifuges 1 min, and obtained liquid phase is the DNA solution of recovery.
Tobacco anti-drought gene NtSAP5 of the present invention application is that described tobacco anti-drought gene NtSAP5 is being obtained
Application in drought-resistant transgenic tobacco plant.
So that case is embodied, the present invention will be further described below：
Embodiment 1
The seed of cloud and mist 87 is seeded into flowerpot, temperature be 26-28 °C, humidity be 60%, alternation of light and darkness cycle be 16h/8h light
Cultivated according in culturing room.When seedling length to about 5-6 piece blades, Osmotic treatment is carried out.The time of processing is respectively 0.5 hour, 2
Hour；Tobacco seedling not do Stress treatment as a control group, takes the tobacco leaf material of control and processing to carry out high pass
Measure RNA-seq.WhereinNtSAP5As E3 ligases, up-regulation is notable when Osmotic treatment 0.5 hour, is expressed after two hours
Amount is lowered（Fig. 1）.
Embodiment 2
The clone of NtSAP5 genes
1. tobacco leaf cDNA is synthesized
Tobacco leaf total serum IgE is extracted using TRIZOL (Invitrogen, USA) reagent, by the quantitative 1 μ g of tobacco leaf total serum IgE in
In 1.5ml centrifuge tubes, reverse transcription is carried out according to the RNA extracts kits description of product of invitrogen companies, cigarette is finally obtained
Careless leaf cDNA.、
The PCR amplifications of 2.NtSAP5 genes
Using tobacco leaf cDNA as template, primer is designed according to tobacco gene group database information, the PCR of NtSAP5 genes is carried out
Amplification, obtains pcr amplification product.
Primer is
Agarose gel electrophoresis of the PCR primer obtained 0.8% will be expanded, Gel electrophoresis results are (as shown in Figure 2), are obtained
The fragment of 471bp sizes.
After electrophoresis terminates, using Qiagen companies PCR primer purification kit, according to described in description of product recovery purifying
PCR primer, and send invitrogen to be sequenced, sequence results are verified, as a result show that the sequence and data in genome database are complete
It is exactly the same.
Embodiment 3
NtSAP5 genetic transformation tobacco and transfer-gen plant detection
1st, the structure of plant expression vector
Using NtSAP5 full length fragments in embodiment 2 as template, enter performing PCR with the primer containing gateway joint sequences and expand, expand
Volume increase thing after purification, is inserted into invitrogen companies pdonr-zeo carriers through PCR primer by BP reactions.It will build
BP reaction carriers by LR react by NtSAP5 fragments replace into PB2GW7 carriers.
Gateway reaction primer sequences are as follows:
2nd, the identification of agriculture bacillus mediated Transformation of tobacco and transfer-gen plant
It will react and be sequenced by PCR, and identify that correct recombinant plasmid converts Agrobacterium LBA4404 using freeze-thaw method, pass through bacterium
Fall PCR and determine positive agrobacterium strains, utilize agriculture bacillus mediated leaf disk method transformation of tobacco kind cloud and mist 87.
Specific method is as follows:
(1) under aseptic condition, tobacco seed is put into EP pipes and uses aseptic water washing 2-3 times；
(2) 30-60sec is soaked in 75% alcohol；
(3) 5min is handled with 0.1% mercuric chloride again, finally with aseptic water washing 5 times；
(4) it is seeded on MS culture mediums, cultivates in Yunnan tobacco academy of agricultural science tissue culture room, light culture 4 days.
25 DEG C of illumination cultivations 20-30 days；
(5) when tobacco seedling length is to 3-5cm（20-30 days）, take terminal bud to be put in MS+BA0.2 mg/L（Strong bud, makes it fast rapid-result
It is long）On culture medium, squamous subculture；
(6) squamous subculture is after 14 days（There are vanelets）, blade is taken, size 1cmX1cm cuts petiole, blade surface and leaf
On edge torn, the precultivation medium for being put into MS+ BA1.0mg/L pH6.0-6.5, face down is close to culture medium placement,
In preculture 2-3 days under dark condition；
(7) blade or stem section of preculture are then taken out, is put into infect in liquid and is infected.Evening before that day is infected, bacterium agriculture is shaken
2 bottles of bacillus.2ml centrifuge tubes are filled into bacterium solution, 4000rpm centrifugation 5min are cleaned twice with outstanding bacterium solution.With 1:10 ratios（10ml
Outstanding bacterium solution puts 1 pipe 1.5ml thalline）Outstanding bacterium solution is put into, As25mg/L is added（Add 40ulAs in 40ml）Constantly rock and infect liquid, make
It is fully contacted with blade and stem section incision, after 10min, is taken out, is put on sterilized dry filter paper and blots bacterium solution；
(8) blade and stem section are put back on pre-culture medium, co-cultured 2-3 days under 28 DEG C of dark conditions, to around paddle cutout
There is germ spot to be formed；
(9) wash bacterium, take out the tobacco leaf co-cultured and stem section, with addition 500mg/LCef aseptic water washing 5 times, first
The secondary shaking table that is positioned over shakes 30min, behind every time 5min, to wash away the Agrobacterium on explant surface；
(10) after taking out, blotted with filter paper, be transferred to tobacco and lure on bud culture medium, it is MS+ BA 1.0mg/L to lure bud culture medium
+ Hyg25mg/L + Cef500mg/L pH5.8；Observation in 2 weeks is crossed, if it find that not long bacterium, then reduce Cef concentration.If long
Bacterium, then continue to keep Cef concentration；
(11) subculture is changed every two weeks, until growing adventitious bud（Ordinary circumstance is 2 weeks）.Cut the seedling of regeneration
（1cm or so）, it is transferred to subculture medium MS+ BA0.2-0.1mg/L+ Hyg25mg/L+Cef500mg/L pH5.8；
(12) to seedling length to 2cm it is long when（There is budlet）, transfer on root media MS+ NAA0.2-0.1mg/L,
24 1 DEG C of scholars, 12h illumination, 1500lx cultures can grow sturdy root system in three weeks or so；
(13) treat root growth to 2-3cm.During height of seedling 7-10cm or so, remove triangular flask and wash away root culture medium, transplant in flowerpot
In, hot-house culture.
Using Qiagen companies DNA extraction kit, the genomic DNA of transgene tobacco seedling is extracted, design Basta resists
Property gene primer enter performing PCR amplification, screen positive plant, detect 25 plants of positive plants；
WT lines are extracted according to method described in example 2 and 25 plants turn total serum IgEs of the NtSAP5 genes T0 for plant, are carried out
Real time-PCR are analyzed, and reference gene is 26s, analyze the expression of different strains.Choose the two plants of plants of expression quantity highest
Strain（Fig. 5）.Individual plant is collected seed and sowed respectively, with separation situations of the basta antibiotic-screenings T1 for plant, is so repeated up to
In T3 generations, obtain the transgenic line of inheritance stability.
NtSAP5QRT primers
26s reference gene primers
Embodiment 4
NtSAP5Overexpression tobacco plant is identified the resistant phenotype of drought stress
1st, it is the plant of wild-type tobacco cloud and mist 87 and 2 transgenosis system (being overexpressed _ 1 and overexpression _ 2) Transgenic Tobacco Seeds is equal
In the even small basin being sowed at containing Nutrition Soil, it is placed in illumination cultivation room and cultivates.When seedling length to 5-6 piece leaves (30 days), stop pouring
Water 2 weeks, observes plant strain growth situation, and record related data.
2nd, tobacco plant is after Osmotic treatment 2 weeks,NtSAP5Transgene tobacco upgrowth situation is substantially better than wild-type tobacco
Here plant, rotaring gene plant blade withers, and WT lines wilting situation becomes apparent, and here most of blade withers (Fig. 6).ShowNtSAP5The transgene tobacco of overexpression shows preferable resistance to drought stress.
SEQUENCE LISTING
<110>Yunnan Academy of Tobacco Agricultural Science
<120>One grows tobacco anti-drought gene NtSAP5 and its cloning process and application
<130> 2017
<160> 10
<170> PatentIn version 3.3
<210> 1
<211> 471
<212> DNA
<213>NtSAP5 nucleotide sequence
<400> 1
atggctcaga gaacagagaa agaagagact gaatacaaca aagtcgtaca tgagaaaacc 60
ttaacacttt gcgttaaaag ttgcggtgtc atcggcaatc cagccaccaa taatatgtgc 120
caaaattgct ctaacgctag ctcctccaag gtcgcatatc ctcataaatt cgccaacata 180
ttaaccagat ctacctcgtc cgatctaaaa aaatatgtcg atcgagcggt gaaagatgat 240
gataaggcaa aggagagcgt ttcaccggcg aagagggagg tgaaccgttg ctctggttgt 300
cggaggaagc taggattaac cggcttccgt tgccggtgcg gtgaattatt ctgcggcgaa 360
caccgttact ctgaccgtca tgattgcagc tatgattaca gaaccgccgg ccgagaggcg 420
atcgcgaggc agaatccgct cgtcaaagcc gcgaagatcg ttaaactttg a 471
<210> 2
<211> 160
<212> PRT
<213>The amino acid sequence of NtSAP5 codings
<400> 2
Met Glu Thr Ala Gln Arg Thr Glu Lys Glu Glu Thr Glu Tyr Asn Lys
1 5 10 15
Val Val His Glu Lys Thr Leu Thr Leu Cys Val Lys Ser Cys Gly Val
20 25 30
Ile Gly Asn Pro Ala Thr Asn Asn Met Glu Thr Cys Gln Asn Cys Ser
35 40 45
Asn Ala Ser Ser Ser Lys Val Ala Tyr Pro His Lys Phe Ala Asn Ile
50 55 60
Leu Thr Arg Ser Thr Ser Ser Asp Leu Lys Lys Tyr Val Asp Arg Ala
65 70 75 80
Val Lys Asp Asp Asp Lys Ala Lys Glu Ser Val Ser Pro Ala Lys Arg
85 90 95
Glu Val Asn Arg Cys Ser Gly Cys Arg Arg Lys Leu Gly Leu Thr Gly
100 105 110
Phe Arg Cys Arg Cys Gly Glu Leu Phe Cys Gly Glu His Arg Tyr Ser
115 120 125
Asp Arg His Asp Cys Ser Tyr Asp Tyr Arg Thr Ala Gly Arg Glu Ala
130 135 140
Ile Ala Arg Gln Asn Pro Leu Val Lys Ala Ala Lys Ile Val Lys Leu
145 150 155 160
<210> 3
<211> 22
<212> DNA
<213>Forward primer
<400> 3
atggctcaga gaacagagaa ag 22
<210> 4
<211> 20
<212> DNA
<213>Reverse primer
<400> 4
tcaaagttta acgatcttcg 20
<210> 5
<211> 53
<212> DNA
<213>Gateway reaction forward primers
<400> 5
ggggacaagt ttgtacaaaa aagcaggctg catggctcag agaacagaga aag
53
<210> 6
<211> 50
<212> DNA
<213>Gateway reacts reverse primer
<400> 6
ggggaccact ttgtacaaga aagctgggtc tcaaagttta acgatcttcg 50
<210> 7
<211> 20
<212> DNA
<213>NtSAP5qRT forward primers
<400> 7
ccaaggtcgc atatcctcat 20
<210> 8
<211> 20
<212> DNA
<213>NtSAP5qRT reverse primers
<400> 8
gccggttaat cctagcttcc 20
<210> 9
<211> 20
<212> DNA
<213>26s reference gene forward primers
<400> 9
gaagaaggtc ccaagggttc 20
<210> 10
<211> 20
<212> DNA
<213>26s reference gene reverse primers
<400> 10
tctcccttta acaccaacgg 20
Claims (7)
1. one grows tobacco anti-drought gene NtSAP5, it is characterised in that described tobacco anti-drought gene NtSAP5 nucleotide sequence is such as
SEQ ID NO：Shown in 1.
2. tobacco anti-drought gene NtSAP5 according to claim 1, it is characterised in that described tobacco anti-drought gene
The amino acid sequence such as SEQ ID NO of NtSAP5 codings：Shown in 2.
3. the cloning process of the tobacco anti-drought gene NtSAP5 described in a kind of claim 1 or 2, it is characterised in that including following step
Suddenly：
A, tobacco leaf cDNA are synthesized：Tobacco leaf total serum IgE is extracted, reverse transcription obtains the first chain cDNA；
The PCR amplifications of B, NtSAP5 gene：Using tobacco leaf cDNA as template, primer is designed according to NtSAP5 gene orders, entered
Performing PCR is expanded, and is reclaimed and purifying pcr amplification product, and be sequenced.
4. tobacco anti-drought gene NtSAP5 according to claim 3 cloning process, it is characterised in that described in step B
Primer is：
Forward primer：5’- ATGGCTCAGAGAACAGAGAAAG -3’
Reverse primer：5’- TCAAAGTTTAACGATCTTCG -3’.
5. tobacco anti-drought gene NtSAP5 according to claim 3 cloning process, it is characterised in that described in step B
PCR reaction systems and amplification condition are as follows：
。
6. tobacco anti-drought gene NtSAP5 according to claim 3 cloning process, it is characterised in that described in step B
Reclaim and the concrete operations of purifying pcr amplification product are as follows：After gel electrophoresis, with clean blade by the glue with purpose fragment
Cut down, be put into centrifuge tube, glue should not cut it is too much, with avoid reclaim when DNA fragmentation solution contain substantial amounts of impurity；
Added into centrifuge tube after the QG solution of 3 times of volumes, the min of warm bath 10 under the conditions of 50 DEG C, until glue melts completely；Will centrifugation
Solution in pipe is moved on in 2 ml adsorption column, is centrifuged 1 min, is discarded liquid phase；0.5 ml QG is added into adsorption column again
Solution, centrifuges 1 min, discards liquid phase；0.75 ml PE solution is added to adsorption column, 1 min is centrifuged, discards liquid phase；Again from
After the min of the heart 1, adsorption column is placed on a new centrifuge tube, 50 μ l lysate is added, 1 min is stood, finally centrifuges
1 min, obtained liquid phase is the DNA solution of recovery.
7. a kind of application of the tobacco anti-drought gene NtSAP5 described in claim 1 or 2, it is characterised in that described tobacco drought resisting
Applications of the gene NtSAP5 in drought-resistant transgenic tobacco plant is obtained.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710302599.8A CN107058340B (en) | 2017-05-03 | 2017-05-03 | Tobacco drought-resistant gene NtSAP5, and cloning method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710302599.8A CN107058340B (en) | 2017-05-03 | 2017-05-03 | Tobacco drought-resistant gene NtSAP5, and cloning method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107058340A true CN107058340A (en) | 2017-08-18 |
| CN107058340B CN107058340B (en) | 2020-02-07 |
Family
ID=59597306
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710302599.8A Active CN107058340B (en) | 2017-05-03 | 2017-05-03 | Tobacco drought-resistant gene NtSAP5, and cloning method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107058340B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113817039A (en) * | 2021-11-01 | 2021-12-21 | 海南大学 | Protein VaPBP2-L for enhancing plant drought resistance and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1771258A (en) * | 2002-12-31 | 2006-05-10 | 德里大学 | A novel gene OSISAP1 of rice confers tolerance to stresses and a method thereof |
| CN103804478A (en) * | 2012-11-14 | 2014-05-21 | 中国农业科学院作物科学研究所 | Stress tolerance associated protein TaSAP1 of plants as well as coding gene and application thereof |
-
2017
- 2017-05-03 CN CN201710302599.8A patent/CN107058340B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1771258A (en) * | 2002-12-31 | 2006-05-10 | 德里大学 | A novel gene OSISAP1 of rice confers tolerance to stresses and a method thereof |
| CN103804478A (en) * | 2012-11-14 | 2014-05-21 | 中国农业科学院作物科学研究所 | Stress tolerance associated protein TaSAP1 of plants as well as coding gene and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| HOZAIN M等: "Expression of AtSAP5 in cotton up-regulates putative stress-responsive genes and improves the tolerance to rapidly developing water deficit and moderate heat stress", 《J PLANT PHYSIOL》 * |
| MIYOUNG KANG等: "Arabidopsis SAP5 functions as a positive regulator of stress responses and exhibits E3 ubiquitin ligase activity", 《PLANT MOL BIOL》 * |
| 佚名: "登录号：XM_016606182.1", 《GENBANK》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113817039A (en) * | 2021-11-01 | 2021-12-21 | 海南大学 | Protein VaPBP2-L for enhancing plant drought resistance and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107058340B (en) | 2020-02-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110904071B (en) | Application of RAF49 protein and encoding gene thereof in regulation and control of plant drought resistance | |
| CN109456982B (en) | Application of rice OsMYB6 gene and encoding protein thereof in drought resistance and salt resistance | |
| CN106868021B (en) | Gene OsNAC1 for controlling rice seed size and application thereof | |
| CN102776228A (en) | Application of Arabidopsis transcription factor in breeding drought-resistant salt-tolerant rice | |
| CN105585619B (en) | With rice grain grain length and grain weight GAP-associated protein GAP and its encoding gene GL3-3 and application | |
| CN102757486B (en) | Plant development related protein GA20ox, and encoding gene and application thereof | |
| CN106916827A (en) | One grows tobacco low-temperature resistance stress-inducing early blossoming gene NtMYB15 and its cloning process and application | |
| CN113621625B (en) | Application of sesame SiERF103 gene in enhancing plant resistance | |
| CN101748144B (en) | Torch pear haloduric gene PpGST and application thereof | |
| CN107365777A (en) | One grows tobacco nicotine content controlling gene NtCLC b and its cloning process and application | |
| CN103897047A (en) | Protein BhHSP70-1 as well as encoding gene and application thereof | |
| CN107058340A (en) | One grows tobacco anti-drought gene NtSAP5 and its cloning process and application | |
| CN102234327B (en) | Plant salt resistant associated protein AtST1, coded genes and application thereof | |
| CN108034662A (en) | The breeding method of application and Rust resistance bacterium wheat of the wheat stripe rust PSTG_06025 genes in stripe rust prevention | |
| CN104513825B (en) | Wheat salt-tolerant gene TaNAS1 and application thereof | |
| CN106520723A (en) | Protein VvMas and encoding gene, and application thereof in improvement of salt tolerance of plants | |
| CN105189535A (en) | Transporter HKT2 with high affinity for potassium ions and which is derived from cotton and the coding gene and use thereof | |
| CN104911198B (en) | Blueberry salt tolerant, anti-drought gene VcLON2 and its coding albumen and application | |
| CN106636140A (en) | Drought response gene NtXERICO of tobacco, and cloning method and application thereof | |
| CN114606244B (en) | Astragalus sinicus AGL18 gene and application thereof | |
| CN115011631B (en) | Protein for regulating drought resistance of corn at seedling stage, and coding gene and application thereof | |
| CN114645046B (en) | Application of inhibiting ZmHLH 21 protein expression in drought resistance of plants | |
| CN114516906B (en) | Corn and mycorrhizal fungi symbiotic related protein, and coding gene and application thereof | |
| CN102146139A (en) | Fusion protein capable of synthetizing trehalose and application thereof in culture of dwarfed lawn grass | |
| CN107475261B (en) | A kind of tobacco responses of drought stress gene NtTIFY and its cloning process and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Xie He Inventor after: Yang Dahai Inventor after: Bai Ge Inventor after: Yao Heng Inventor after: Xiao Bingguang Inventor after: Zhang Yihan Inventor after: Li Yongping Inventor after: Tong Wenjie Inventor before: Xie He Inventor before: Yang Dahai Inventor before: Bai Ge Inventor before: Yao Heng Inventor before: Xiao Bingguang Inventor before: Zhang Yihan Inventor before: Li Yongping Inventor before: Tong Wenjie |
|
| CB03 | Change of inventor or designer information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |