CN106636140A

CN106636140A - Drought response gene NtXERICO of tobacco, and cloning method and application thereof

Info

Publication number: CN106636140A
Application number: CN201610976938.6A
Authority: CN
Inventors: 谢贺; 白戈; 杨大海; 姚恒; 张谊寒; 李永平; 肖炳光; 陈学军
Original assignee: Yunnan Academy of Tobacco Agricultural Sciences
Current assignee: Yunnan Academy of Tobacco Agricultural Sciences
Priority date: 2016-11-08
Filing date: 2016-11-08
Publication date: 2017-05-10

Abstract

The invention discloses a drought response gene NtXERICO of tobacco, and a cloning method and an application thereof. A nucleotide sequence of the drought response gene NtXERICO of tobacco is as shown in SEQ ID NO: 1. An amino acid sequence of an encoding protein is as shown in SEQ ID NO: 2. Adaptation of the tobacco to drought stress can be improved by over-expressing the gene. The NtXERICO has a wide application prospect in the drought resistance field of tobacco. According to the application of the gene provided by the invention, the ubiquitin E3 ligase encoding gene NtXERICO is inducibly expressed in tobacco seedling leaves subjected to drought treatment. The protein NtXERICO provided by the invention is a key enzyme in degradation processes of ubiquitination proteins of plants, so that drought resistance of plants can be regulated by controlling the expression of the NtXERICO. Therefore, the drought response gene NtXERICO has the wide application prospect in the drought resistance field of plants, and also has huge economic potential.

Description

One grows tobacco responses of drought stress gene NtXERICO and its cloning process and application

Technical field

The invention belongs to genetic engineering technology field, and in particular to one grow tobacco responses of drought stress gene NtXERICO and its gram Grand method and application.

Background technology

Arid has a strong impact on the growing of crop, yield and quality.The drought-resistant ability for improving plant has become the modern times One of key issue in plant research work.The research of drought resistance mechanism is the basis of Drought-resistant Breeding, be also breeding key because One of element.The effort of decades is experienced, the research to plant drought is analyzed from the appearance factor of drought resistant index, entered into point The exploration of son and gene level.

In recent years, with global warming, arid has become the natural calamity frequently occurred in China's crop production.Cigarette Grass is very high in requirement of the whole breeding time to moisture as the important industrial crops of China.Most of China cigarette district in arid, In Semi-arid environment, and high-quality cigarette district multidigit often affects growing for cigarette strain in Hills because of soil drought, causes The yield and quality of tobacco leaf is reduced, and arid becomes one of main limiting factor that restriction China's yield of tobacco is improved with quality. Therefore, strengthen the excavation and utilization of tobacco anti-drought gene resource, for tobacco drought resisting rearing new variety, realize that tobacco agriculture can hold Supervention exhibition is significant.

Since the eighties in 20th century, Chinese scholars are done in arid to aspects such as tobacco growing, development, the impacts of metabolism Numerous studies, achieve some impressive progresses.It is summed up and mainly have the following aspects:First, arid is to tobacco physiology Impact, be mainly manifested in:(1) drought stress have impact on chlorophyllous synthesis, promote chlorophyllous decomposition, so as to have impact on Blade photosynthetic efficiency (Plant Molecular Biology, 1979,20:37-44) ；(2) drought stress causes plant nitrogen The activity reduction of plain key enzyme-nitrate reductase (NR), and hydrolase of proteolysis enhancing causes proline, glutamy Amine, asparagine and valine etc. are accumulated in a large number；(3) drought stress causes cell membrane lipid peroxidation to strengthen, and membrane permeability increases Plus, MDA (MDA) content is raised, and Electrolyte Leakage occurs.Under the enzymatic activitys such as antioxidative defense enzyme S0D, P0D, CAT are notable Drop.Second, impact of the arid to tobacco growing development is mainly manifested in:(I) drought stress reduces sprouting and the seedling of seed Survive；(2) growth of root system is inhibited, so as to have impact on the absorption of mineral nutrition；(3) drought stress causes plant short and small, Internode is short, and blade is little, easy early ageing.These researchs preferably illustrate physiology of the arid to tobacco growing, development and metabolic effect Biochemical basis, but lack the research to tobacco drought resisting molecular genetic mechanism.

In recent years, going deep into molecular biology and genomics research, the excavation of anti-drought gene becomes current crop The focus that degeneration-resistant genetic resources is studied with breed improvement, increasing gene related to drought tolerance is cloned and identifies in succession.According to The function of anti-drought gene, can be divided into two big class gene studies on plant drought-resistance:First genoid is functional gene, is mainly being planted Shield in thing resistance.This genoid mainly includes that infiltration adjusts benzyl because such as:Trehalose synthetase geneTPSlJfAmmonia Acid synthase geneP5CS, mannitol synthetic genemtlD, within betaine synthetase levelBADHAnd press synthetic gene moreOdc Deng；The active gene of protection large biological molecule is such as:Dehydrin geneBDN1, water channel protein geneAQPSend out with late embryo Raw Abundant proteinLEADeng.Second genoid is tune benzyl because mainly playing regulation during signal transduction and Stress gene expression Effect, mainly including some transcription factor genes such as:DREB、MYB、bZIP、WRKY、NACDeng.These genes are in plant gene It is applied in engineering.

A kind of important form of ubiquitination organism epigenetic modification, it is general to there is can biological vivo protein in the process Elementization, the albumen of ubiquitination can be degraded.Ubiquitin ligase E3 is the crucial enzyme during ubiquitination, determines those eggs In vain can be by ubiquitination.Ubiquitination plays an important role in phytohormone Regulation, flower development and pathogen defense response (Plant J,2010,61:1029-1040 ；J Exp Bot, 2007,58:221-227).

The content of the invention

The first object of the present invention is to provide one to grow tobacco responses of drought stress gene NtXERICO；Second purpose is to provide The cloning process of described tobacco responses of drought stress gene NtXERICO, the 3rd purpose is to provide described tobacco responses of drought stress base Because of the application of NtXERICO.

The first object of the present invention is achieved in that the nucleotides sequence of described tobacco responses of drought stress gene NtXERICO Row such as SEQ ID NO：Shown in 1.

The second object of the present invention is achieved in that and comprises the following steps：

A, tobacco leaf cDNA synthesize：Tobacco leaf total serum IgE is extracted, reverse transcription obtains the first chain cDNA；

The PCR amplifications of B, NtXERICO gene：With tobacco leaf cDNA as template, drawn according to the design of NtXERICO gene orders Thing, enters performing PCR amplification, reclaims and purifies pcr amplification product, and is sequenced.

The third object of the present invention is achieved in that described tobacco responses of drought stress gene NtXERICO is obtaining anti-dry Application in non-irrigated transgenic tobacco plant.

The invention provides a kind of new plant drought GAP-associated protein GAP and its encoding gene.

Plant drought GAP-associated protein GAP provided by the present invention, entitled NtXERICO, it derives from the cultivation tobacco of cloud and mist 87, It is the protein with one of following amino acid residue sequences：

1) the SEQ ID NO in sequence table：2；

2) by SEQ ID No in sequence table：2 amino acid residue sequence through one or several amino acid residues replacement and/ Or disappearance and/or addition and the protein related to plant drought.

Sequence 2 in sequence table is made up of 154 amino acid.

The replacement of one or several amino acid residues and/or disappearance and/or addition are referred to less than 10 amino acid The replacement of residue and/or disappearance and/or addition.

NtXERICO encoding gene (NtXERICO) fall within protection scope of the present invention.

NtXERICOEncoding gene, can have one of following nucleotide sequence：1) SEQ ID No in sequence table：1 DNA sequence dna；2) SEQ ID No in polynucleotide：The polynucleotides of 2 protein sequences；3) can be with sequence under high high stringency conditions SEQ ID No in list：The nucleotide sequence of the 1 DNA sequence dna hybridization for limiting；4) with SEQ ID No in sequence table：1 restriction DNA sequence dna has more than 70% homology, and encodes identical function protein DNA sequence.

Containing the present inventionNtXERICOExpression vector, clone and Host Strains belong to protection scope of the present invention.Expand IncreaseNtXERICOIn the primer pair of arbitrary fragment fall within protection scope of the present invention.

Present invention also offers being the above-mentioned plant of overexpression in plant using the method for the genes amplification plant drought resistance Thing drought resistance related protein encoding gene.

The above-mentioned plant drought resistance related protein encoding gene of overexpressionNtXERICOCan such as be planted by accomplished in many ways The method of thing viral vector mediated gene overexpression, agrobacterium mediation converted over-express vector is rectified to gene code and is optimized Modification, is optimized to reach the realization of the methods such as overexpression effect to the gene promoter.The side of overexpression gene of the present invention Method is not limited to above-mentioned several method, as long as can overexpressionNtXERICO.

Should using any gene overexpression or genetic modification methodNtXERICOPlant performance is set to be drought resisting；Using any A kind of carrier that foreign gene can be guided to express in plant, will be provided by the present inventionNtXERICOIn proceeding to plant, plant It is insensitive that thing just shows arid.

The present invention'sNtXERICOGene can add when being building up in plant expression vector before its transcription initiation nucleotides Upper any enhancing promoter or inducible promoter.For the ease of transgenic plant cells or plant are identified and sieved Choosing, can be processed to the carrier for being used, such as add plant it is alternative mark (gus gene, luciferase genes) or Antibiotic marker (gentamicin, kanamycins etc.) with resistance.The plant host being converted both can be that unifacial leaf is planted Thing, or dicotyledon, such as：Tobacco, paddy rice, wheat, corn, cucumber, tomato, willow, turfgrass or lucerne place etc..From The security consideration of genetically modified plants, can be not added with any selected marker, directly be come with plant seedling stage leaves water loss degree Screening transformed plant.Carry the present inventionNtXERICOThe expression vector of gene can be by using Ti-plasmids, Ri plasmids, phytopathy The conventional biology methods such as poisonous carrier, directly delivered DNA, microinjection, conductance, agriculture bacillus mediated convert plant cell or group Knit, and by the plant Jing tissue cultivatings of conversion into plant.

For crops, especially tobacco Drought-resistant Breeding provides base to the plant drought GAP-associated protein GAP and its encoding gene of the present invention Because of the support with technology.

In the present invention, in the tobacco seedling blade of Osmotic treatment, described ubiquitin E3 connection enzyme coding gene NtXERICO It is induced expression.Albumen NtXERICO of the present invention is the crucial enzyme in Plant Ubiquitin PD approach, so The expression of regulation and control NtXERICO can adjust resistance of the plant to arid.Therefore the gene NtXERICO of described responses of drought stress exists Plant drought field has broad application prospects, and its economic efficient latent is huge.

Description of the drawings

Fig. 1 is in tobacco leaf of the present inventionNtXERICOGene response drought stress block diagram；

Fig. 2NtXERICOPCR primer electrophoretogram；

Fig. 3 is pdonr-zeo carrier figures；

Fig. 4 isNtXERICOGene plant expression vector PB2GW7 schemes；

Fig. 5 is to turnNtXERICOThe tobacco line expression block diagram of gene；

Fig. 6 isNtXERICOThe growth phenotype photo that the tobacco plant of gene overexpression is processed drought stress.

Specific embodiment

With reference to embodiment and accompanying drawing, the present invention is further illustrated, but never in any form to the present invention in addition Limit, based on present invention teach that any conversion for being made or replacement, belong to protection scope of the present invention.

The nucleotide sequence such as SEQ ID NO of tobacco responses of drought stress gene NtXERICO of the present invention：Shown in 1.

The amino acid sequence such as SEQ ID NO of described tobacco responses of drought stress gene NtXERICO codings：Shown in 2.

The cloning process of tobacco responses of drought stress gene NtXERICO of the present invention, comprises the following steps：

Primer described in step B is：

Forward primer：5’-ATGGGCCTTTCACAGTATCCAAC-3’

Reverse primer：5’-TCACATAGGACAAGTATCTTC-3’.

PCR reaction systems and amplification condition described in step B is as follows：

The PCR reaction systems of table 1 and condition

The concrete operations of the sequencing described in step B are sequenced to deliver invitrogen companies.

The concrete operations of recovery and purifying pcr amplification product described in step B are as follows：

After gel electrophoresis, the glue with purpose fragment is cut down with clean blade, in putting into centrifuge tube, glue should not be cut Too much, DNA fragmentation solution contains substantial amounts of impurity during avoiding reclaiming.

The QG solution of 3 times of volumes is added in centrifuge tube（Volume/colloid amount）Afterwards, 10 min of temperature bath under the conditions of 50 DEG C, Until glue melts completely；Solution in centrifuge tube is moved on in the adsorption column of 2 ml, 1 min is centrifuged, discard liquid phase；Again to suction The QG solution of 0.5 ml is added in attached column, 1 min is centrifuged, discard liquid phase；The PE solution of 0.75 ml, centrifugation 1 are added to adsorption column Min, discards liquid phase；After 1 min is centrifuged again, adsorption column is placed on a new centrifuge tube, adds the dissolving of 50 μ l Liquid, stands 1 min, and 1 min is finally centrifuged, and the liquid phase for obtaining is the DNA solution for reclaiming.

The application of tobacco responses of drought stress gene NtXERICO of the present invention, it is characterised in that described tobacco arid is rung Answer applications of the gene NtXERICO in drought-resistant transgenic tobacco plant is obtained.

The method for obtaining drought-resistant transgenic tobacco plant is comprised the following steps：

A, carrier construction：

According to what is filtered out in tobacco gene groupNtXERICOGene order designs primer, and the BP in Gateway systems Reaction is required, plus 5 ' GGGGACAAGTTTGTACAAAAAAGCAGGCTGC3 ' sequences before forward primer, before reverse primer Plus 5 ' GGGGACCACTTTGTACAAGAAAGCTGGGTC3 ' sequence.PCR reactions are adoptedPhusionExo+ polymerase is carried out PCR is cloned.These fragments are cloned into pDONR-Zeocin carriers by BP reactions, are then reacted these fragments by LR In being cloned into respective purpose carrier respectively.

Using Gateway technique construction carriers, its principle can be summarized as follows：

attB1-gene-attB2 × attP1-ccdB-attP2 ⇔ attL1-gene-attL2 × attR1-ccdB- attR2(expression clone) ( pDONR™) (entry clone) (destination vector)

BP reacts

（1）Prepare the reaction system of 8 μ l in 200 μ l centrifuge tubes, including：The attB-PCR products of 1 ~ 7 μ l（About 15 ~ 150 ng, concentration >=10 ng/ μ l）, 1 μ l pDONR carriers（150 ng/μl）With appropriate TE buffer solutions（pH8.0）, in room Temperature is lower to be mixed；

（2）BP Clonase II enzymatic mixtures are stood into 2 min on ice to melt, is gently shaken 2 times, mixed stand-by；

（3）To（1）The BP Clonase II enzymatic mixtures of 2 μ l are added in the sample of preparation, lightly mixes system；

（4）BP Clonase II enzymatic mixtures are put back into -20 °C or -80 °C preservations；

（5）Reaction system is placed on into 25 °C of temperature 1 h of bath；

（6）The Proteinase K Solution of 1 μ l is added in reaction system, is gently shaken, then sample is placed on into 37 °C of temperature baths 10 Min, to terminate BP reactions；

（7）Mixed liquor is converted after Escherichia coli, transformed bacteria solution is taken and is coated on the LB flat boards containing Zeacin resistances, picking colony is extremely Bacterium culture is shaken in culture medium solution containing corresponding antibiotic, the plasmid that positive colony is extracted after confirmation is standby.

LR reacts

（1）Prepare the reactant of 8 μ l in 200 μ l centrifuge tubes, including：The pDONR- that the 2.2.10.1 of 1 ~ 7 μ l is obtained Zeocin plasmids（50 ~ 150 ng）, 1 μ l purpose carrier（150 ng/μl）With appropriate TE buffer solutions（pH8.0）, in room Temperature is lower to be mixed；

（2）LR Clonase II enzymatic mixtures are rested on into 2 min on ice to melt, gently shakes 2 times to mix；

（3）The LR Clonase II enzymatic mixtures of 2 μ l are added, is gently shaken and is mixed system；

（4）LR Clonase II enzymatic mixtures are put back into -20 °C or -80 °C of Refrigerator stores；

（5）Reaction system is placed on into 25 °C of temperature bath 1 h of reaction；

（6）Add the Proteinase K Solution of 1 μ l to terminate LR reactions in reaction system, after gently shaking, sample is placed on into 37 ° C stands 10 min；

（7）LR product is converted coated plate after Escherichia coli, screening positive clone, extracts plasmid, yeast is then carried out double miscellaneous Test with Agrobacterium-mediated Transformation etc..

B, Agrobacterium-mediated Transformation：

By 1 μ g（200 ng/μl）Purpose plasmid is added in 100 μ l competence Agrobacteriums, and 5 are stood on ice after mixing Min, is put into liquid nitrogen and freezes 5 min, then takes out from liquid nitrogen, is put into the min of water-bath 5 in 37 DEG C of water-baths, then quiet on ice After putting 5 min, 500 μ l LB solution are added, the h of renewal cultivation 4, finally uniformly applies bacterium solution under the conditions of 28 DEG C, fully shaking Smear on selective plating medium, 48 h are cultivated at 28 DEG C.

C, culture transfer-gen plant：

(1) under aseptic condition, tobacco seed is put into EP pipes with aseptic water washing 2-3 time；

(2) 30-60sec is soaked in 75% alcohol；

(3) with 0.1% mercuric chloride 5min is processed again, finally with aseptic water washing 5 times；

(4) it is seeded on MS culture mediums, cultivates in Yunnan tobacco academy of agricultural science tissue culture room, light culture 4 days. 25 DEG C of illumination cultivations 20-30 days.

(5) when tobacco seedling length is to 3-5cm（20-30 days）, take terminal bud and be put in MS+BA0.2 mg/L（Strong bud so as to fast Short-term training is long）On culture medium, squamous subculture.

(6) squamous subculture is after 14 days（There are vanelets）, blade is taken, size 1cmX1cm cuts petiole, blade surface And leaf edge torn, it is put on the precultivation medium of MS+ BA1.0mg/L pH6.0-6.5, face down is close to culture medium and is put Put, preculture 2-3 days under dark condition.

(7) pre-incubated blade or stem section are then taken out, is put into infect in liquid and is infected.Evening before that day is infected, is shaken 2 bottles of bacterium Agrobacterium.2ml centrifuge tubes are filled into bacterium solution, 4000rpm centrifugation 5min are cleaned twice with outstanding bacterium solution.With 1:10 ratios （The outstanding bacterium solutions of 10ml put 1 pipe 1.5ml thalline）Outstanding bacterium solution is put into, As25mg/L is added（Add 40ulAs in 40ml）Constantly rock and infect Liquid so as to be fully contacted with blade and stem section incision, after 10min, takes out, and is put on sterilized dry filter paper and blots bacterium Liquid；

(8) blade and stem section are put back on pre-culture medium, are co-cultured 2-3 days under 28 DEG C of dark conditions, to around paddle cutout There is germ spot to be formed；

(9) wash bacterium, take out the tobacco leaf and stem section for co-culturing, with the aseptic water washing 5 times of addition 500mg/LCef, first The secondary shaking table that is positioned over shakes 30min, behind each 5min, to wash away the Agrobacterium on explant surface；

(10) after taking out, blotted with filter paper, be transferred to tobacco and lure on bud culture medium, lure bud culture medium to be MS+ BA 1.0mg/L + Hyg25mg/L + Cef 500mg/L pH5.8；Observation in 2 weeks is crossed, if it find that not long bacterium, then reduce Cef concentration.If long Bacterium, then continue to keep Cef concentration.

(11) subculture is changed every two weeks, until growing adventitious bud（Ordinary circumstance is 2 weeks）.Cut the little of regeneration Seedling（1cm or so）, proceed to subculture medium MS+ BA0.2-0.1mg/L+ Hyg25mg/L+Cef500mg/L pH5.8；

(12) to seedling length to 2cm it is long when（There is budlet）, transfer on root media MS+ NAA0.2-0.1mg/L, 24 1 DEG C of scholars, 12h illumination, 1500lx grow sturdy root system by cultivating three weeks or so.

(13) plant to taking root enters performing PCR Preliminary detection, and the plant that result is positive moves on to mud after hardening Charcoal：Vermiculite=7:In 1 matrix, it is put into phjytotron and is cultivated, and its growing state is observed, recorded.

Agrobacterium infects the preparation of liquid

(1) Agrobacterium containing expression vector of -80 DEG C of Refrigerator stores is taken, flat board culture is drawn, is added in LB solid plates 50mg/L Kan and 50mg/L Rif；

(2) picking list bacterial plaque is put into 28 in shaking table in the 5mL LB fluid nutrient mediums of Kan containing 50mg/L and 50mg/L Rif DEG C, 200rpm overnight incubations（12h-16h）；

(3) bacterial classification is preserved, 750ul bacterium solutions add sterilized glycerine 250ul, and -80 DEG C of Refrigerator stores are standby.

(4) bacterium is shaken, LB fluid nutrient medium 10ml add Kan（Desired concn 50mg/L）10ul、Rif（Desired concn 50mg/ L）10ul and bacterium solution 10ul, 28 DEG C, 200rpm incubated overnights（12h-16h）.

(5) when bacterial concentration reaches OD600=1.5 or so, 2mL bacterium solutions are taken and is added in centrifuge tube, 4000rpm centrifugations 5min；

(6) supernatant is outwelled, the new MS fluid nutrient mediums of 1mL, resuspended Agrobacterium, 4000rpm centrifugation 5min is inhaled.

(7) repeat step（6）Once；

(8) after with the resuspended bacterium of MS fluid nutrient mediums of 1mL, in being then added to the fluid nutrient medium of the MS of 40mL（Containing 40ul The As of 25mg/L）, as infect liquid.More than 2h is placed, then is infected.

200ml hangs bacterium solution

The a large amount of 10ml of 20x

The organic 1ml of 200x

200x molysite 1ml

The micro 1ml of 200x

Sucrose 5.6g

Below to be embodied as case, the present invention will be further described：

Embodiment 1

The seed of cloud and mist 87 Jing after 24 DEG C of water plantings are sprouted, temperature be 24-26 °C, humidity be 12h/ in 60%, alternation of light and darkness cycle Cultivate in the illumination cultivation room of 12h.When seedling length to four leaves wholeheartedly (about 14 days), whole strain is taken out, and suck dry moisture is air-dried Arid compels to process experiment.The time of process is respectively 0.5 hour, 2 hours；Not do the tobacco seedling of Stress treatment as control Group, takes control and the tobacco leaf material of process to carry out high flux RNA-seq.There are 1386 gene expressions to raise 2 times altogether （Containing 2 times）More than, whereinNtXERICORaise significantly as ubiquitination E3 ligase, show that the gene is drought-induced（Fig. 1）.

Embodiment 2

1. tobacco leaf cDNA synthesis

Using TRIZOL (Invitrogen, USA) reagent extract tobacco leaf total serum IgE, by the quantitative 1 μ g of tobacco leaf total serum IgE in In 1.5ml centrifuge tubes, carry out according to the First Strand cDNA Synthesis Kit descriptions of product of invitrogen companies Reverse transcription, it is final to obtain tobacco leaf cDNA.

2. NtXERICOThe PCR amplifications of gene

With tobacco leaf cDNA as template, primer is designed according to tobacco gene group database information, carried outNtXERICOGene PCR is expanded, and obtains pcr amplification product.

Primer is：

Forward primer：5’-ATGGGCCTTTCACAGTATCCAAC-3’

Reverse primer：5’-TCACATAGGACAAGTATCTTC-3’.

Agarose gel electrophoresis of the PCR primer that amplification is obtained 0.8%, Gel electrophoresis results are (as shown in Figure 2), Obtain the fragment of 462bp sizes.

After electrophoresis terminates, using Qiagen companies PCR primer purification kit, according to described in description of product recovery purifying PCR primer, and send invitrogen to be sequenced, sequence results are verified, as a result show that the sequence is complete with data in genome database It is exactly the same.

Embodiment 3

1. the structure of plant expression vector

With in embodiment 2NtXERICOFull length fragment is template, and with the primer containing gateway joint sequences performing PCR amplification is entered, Amplified production Jing PCR primers after purification, are inserted into invitrogen companies pdonr-zeo carriers through BP reactions.To build Good BP reaction carriers will by LR reactionsNtXERICOFragment is replaced in PB2GW7 carriers.

Gateway reaction primer sequences are as follows：

NtXERICO_F：

5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGCATGGGCCTTTCACAGTATCCAAC-3’

NtXERICO_R：

5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACATAGGACAAGTATCTTC-3’。

2. the identification of agriculture bacillus mediated Transformation of tobacco and transfer-gen plant

To react and be sequenced through PCR, identify that correct recombinant plasmid converts Agrobacterium LBA4404 using freeze-thaw method, by bacterium The PCR that falls determines positive agrobacterium strains, using agriculture bacillus mediated leaf disk method transformation of tobacco kind cloud and mist 87.

Concrete grammar is as follows:

(2) 30-60sec is soaked in 75% alcohol；

(13) treat root growth to 2-3cm.During height of seedling 7-10cm or so, remove triangular flask wash away root culture medium, transplant in In flowerpot, hot-house culture.

Using Qiagen companies DNA extraction kit, the genomic DNA of transgene tobacco seedling is extracted, design Basta resists Property gene primer enter performing PCR amplification, screen positive plant, detect 25 plants of positive plants.

WT lines are extracted according to method described in example 2 and 25 plants turnNtXERICOGene T0 for plant total serum IgE, Real time-PCR analyses are carried out, reference gene is 26s, the expression of the different strains of analysis.Choose expression highest three Strain plant（Fig. 3）.Individual plant is collected seed and is sowed respectively, with basta antibiotic-screenings Tl for the separation situation of plant, so repeats Until in T3 generations, obtain the transgenic line of inheritance stability.

NtXERICOQRT primers

NtXERICO_qRT_F：5’-AGTCATACCCCTGCAATTCG-3’

NtXERICO_qRT_R：5’-GGCCACATGAGAGATGGTTT-3’

26s reference gene primers

26s_F：5’-GAAGAAGGTCCCAAGGGTTC-3’

26s_R：5’-TCTCCCTTTAACACCAACGG-3’

Embodiment 4

The plant of wild-type tobacco cloud and mist 87 and 3 transgenosis system (0E-1,0E_2 and OE_3) Transgenic Tobacco Seeds are uniformly broadcast In the little basin containing Nutrition Soil, it is placed in illumination cultivation room and cultivates.When seedling length is to 5-6 piece leaves (30 days), stopping waters 1 In week, plant strain growth situation is observed, and record related data.2., tobacco plant is Jing after Osmotic treatment 1 week,NtXERICOTransgenosis Tobacco growing situation is substantially better than wild-type tobacco plants, and here rotaring gene plant blade withers, and WT lines wilting situation is more Substantially, here most of blade withers (Fig. 5).ShowNtXERICOThe transgene tobacco of overexpression shows preferably to drought stress Resistance.

SEQUENCE LISTING

<110>Yunnan Academy of Tobacco Agricultural Science

<120>One grows tobacco responses of drought stress gene NtXERICO and its cloning process and application

<130> 2016

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 462

<212> DNA

<213>NtXERICO nucleotides

<400> 1

atgggccttt cacagtatcc aactccagca gatgcaggag tgctctgtgt gattctaatg 60

aacacagcca tatccatctc cgttctcaag gagatagtcc gatcaatcct tcacgtgatt 120

ggcatccgca ttgcagcatg ggacgactat tctatcgaag gaggaccctt ggatctgttt 180

gaatgtcgtg gaaccccatc agaatcatat atggaggaat tcagaagtca tacccctgca 240

attcgttatg actcaatctg tatctctaac catgctgaga aagagtgctc ggtctgccta 300

acggattttg agcctgatgc agaaataaac catctctcat gtggccatgt tttccacaag 360

caatgtctag agaaatggct caagtattgg aacgtaactt gtccgctttg caggaattac 420

atgatgcctc aagaaggcga agaagatact tgtcctatgt ga 462

<210> 2

<211> 153

<212> PRT

<213>NtXERICO amino acid

<400> 2

Met Gly Leu Ser Gln Tyr Pro Thr Pro Ala Asp Ala Gly Val Leu Cys

1 5 10 15

Val Ile Leu Met Asn Thr Ala Ile Ser Ile Ser Val Leu Lys Glu Ile

20 25 30

Val Arg Ser Ile Leu His Val Ile Gly Ile Arg Ile Ala Ala Trp Asp

35 40 45

Asp Tyr Ser Ile Glu Gly Gly Pro Leu Asp Leu Phe Glu Cys Arg Gly

50 55 60

Thr Pro Ser Glu Ser Tyr Met Glu Glu Phe Arg Ser His Thr Pro Ala

65 70 75 80

Ile Arg Tyr Asp Ser Ile Cys Ile Ser Asn His Ala Glu Lys Glu Cys

85 90 95

Ser Val Cys Leu Thr Asp Phe Glu Pro Asp Ala Glu Ile Asn His Leu

100 105 110

Ser Cys Gly His Val Phe His Lys Gln Cys Leu Glu Lys Trp Leu Lys

115 120 125

Tyr Trp Asn Val Thr Cys Pro Leu Cys Arg Asn Tyr Met Met Pro Gln

130 135 140

Glu Gly Glu Glu Asp Thr Cys Pro Met

145 150

<210> 3

<211> 23

<212> DNA

<213>Forward primer

<400> 3

atgggccttt cacagtatcc aac 23

<210> 4

<211> 21

<212> DNA

<213>Reverse primer

<400> 4

tcacatagga caagtatctt c 21

<210> 5

<211> 31

<212> DNA

<213>Forward primer presequence

<400> 5

ggggacaagt ttgtacaaaa aagcaggctg c 31

<210> 6

<211> 30

<212> DNA

<213>Reverse primer presequence

<400> 6

ggggaccact ttgtacaaga aagctgggtc 30

<210> 7

<211> 54

<212> DNA

<213> NtXERICO_F

<400> 7

ggggacaagt ttgtacaaaa aagcaggctg catgggcctt tcacagtatc caac 54

<210> 8

<211> 51

<212> DNA

<213> NtXERICO_R

<400> 8

ggggaccact ttgtacaaga aagctgggtc tcacatagga caagtatctt c 51

<210> 9

<211> 20

<212> DNA

<213> NtXERICO_qRT_F

<400> 9

agtcataccc ctgcaattcg 20

<210> 10

<211> 20

<212> DNA

<213> NtXERICO_qRT_R

<400> 10

ggccacatga gagatggttt 20

<210> 11

<211> 20

<212> DNA

<213> 26s_F

<400> 11

gaagaaggtc ccaagggttc 20

<210> 12

<211> 20

<212> DNA

<213> 26s_R

<400> 12

tctcccttta acaccaacgg 20

Claims

1. one grow tobacco responses of drought stress gene NtXERICO, it is characterised in that described tobacco responses of drought stress gene NtXERICO's Nucleotide sequence such as SEQ ID NO：Shown in 1.

2. tobacco responses of drought stress gene NtXERICO according to claim 1, it is characterised in that described tobacco arid is rung The amino acid sequence such as SEQ ID NO for answering gene NtXERICO to encode：Shown in 2.

3. the cloning process of the tobacco responses of drought stress gene NtXERICO described in a kind of claim 1 or 2, it is characterised in that include Following steps：

4. the cloning process of tobacco responses of drought stress gene NtXERICO according to claim 3, it is characterised in that in step B Described primer is：

Forward primer：5’-ATGGGCCTTTCACAGTATCCAAC-3’

Reverse primer：5’-TCACATAGGACAAGTATCTTC-3’.

5. the cloning process of tobacco responses of drought stress gene NtXERICO according to claim 3, it is characterised in that in step B Described PCR reaction systems and amplification condition is as follows：

。

6. the cloning process of tobacco responses of drought stress gene NtXERICO according to claim 3, it is characterised in that in step B Described recovery and the concrete operations of purifying pcr amplification product is as follows：

After gel electrophoresis, the glue with purpose fragment is cut down with clean blade, in putting into centrifuge tube, glue should not be cut Too much, DNA fragmentation solution contains substantial amounts of impurity during avoiding reclaiming；

After the QG solution of 3 times of volumes is added in centrifuge tube, 10 min of temperature bath under the conditions of 50 DEG C, until glue melts completely；Will Solution in centrifuge tube is moved on in the adsorption column of 2 ml, and 1 min is centrifuged, and discards liquid phase；Add 0.5 ml in adsorption column again QG solution, be centrifuged 1 min, discard liquid phase；The PE solution of 0.75 ml is added to adsorption column, 1 min is centrifuged, discard liquid phase；Again After 1 min of secondary centrifugation, adsorption column is placed on a new centrifuge tube, adds the lysate of 50 μ l, stand 1 min, finally 1 min is centrifuged, the liquid phase for obtaining is the DNA solution for reclaiming.

7. a kind of application of the tobacco responses of drought stress gene NtXERICO described in claim 1 or 2, it is characterised in that described cigarette Applications of the careless responses of drought stress gene NtXERICO in drought-resistant transgenic tobacco plant is obtained.