CN107034234A - A kind of kit for being used to knock out two kinds of genes of FUT8 and DHFR in Chinese hamster ovary celI - Google Patents
A kind of kit for being used to knock out two kinds of genes of FUT8 and DHFR in Chinese hamster ovary celI Download PDFInfo
- Publication number
- CN107034234A CN107034234A CN201710357070.6A CN201710357070A CN107034234A CN 107034234 A CN107034234 A CN 107034234A CN 201710357070 A CN201710357070 A CN 201710357070A CN 107034234 A CN107034234 A CN 107034234A
- Authority
- CN
- China
- Prior art keywords
- fut8
- genes
- dhfr
- seq
- chinese hamster
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0681—Cells of the genital tract; Non-germinal cells from gonads
- C12N5/0682—Cells of the female genital tract, e.g. endometrium; Non-germinal cells from ovaries, e.g. ovarian follicle cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
- C12N9/0026—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on CH-NH groups of donors (1.5)
- C12N9/0028—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on CH-NH groups of donors (1.5) with NAD or NADP as acceptor (1.5.1)
- C12N9/003—Dihydrofolate reductase [DHFR] (1.5.1.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y105/00—Oxidoreductases acting on the CH-NH group of donors (1.5)
- C12Y105/01—Oxidoreductases acting on the CH-NH group of donors (1.5) with NAD+ or NADP+ as acceptor (1.5.1)
- C12Y105/01003—Dihydrofolate reductase (1.5.1.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/01—Hexosyltransferases (2.4.1)
- C12Y204/01068—Glycoprotein 6-alpha-L-fucosyltransferase (2.4.1.68), i.e. FUT8
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/10—Vectors comprising a non-peptidic targeting moiety
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Mycology (AREA)
- Reproductive Health (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention provides a kind of kit for being used to knock out FUT8 genes and DHFR genes in Chinese hamster ovary celI, it includes SEQ ID NO：1 and/or SEQ ID NO：SgRNA sequences described in 3, and SEQ ID NO：SgRNA sequences described in 23.Present invention also offers a kind of while knocking out the method and its engineering cell strain of FUT8 and DHFR genes in Chinese hamster ovary celI.Kit of the present invention can be used for FUT8 the and DHFR genes for fast and efficiently knocking out Chinese hamster ovary celI, the antibody class medicine modified available for high efficient expression without fucose, and antibody production height, and application prospect is good.
Description
Technical field
The invention belongs to genetic engineering field, and in particular to one kind is used to knock out FUT8 genes and DHFR bases in Chinese hamster ovary celI
The kit of cause.
Background technology
Chinese hamster ovary cell (Chinese hamster ovary cell, Chinese hamster ovary celI) is current production medicine egg
White the most frequently used host cell, is widely used in the research and development and production of the products such as antibody, recombinant protein medicine and vaccine.Antibody
Medicine is current topmost biotechnology class medicine, how further to improve the efficiency and yield of Chinese hamster ovary celI antibody drug, is
The focus studied at present.
α -1,6 fucosyltransferases (α -1,6fucosyltrasnferase, FUT8) are fucosyl transferase genes
A member of superfamily, the core fucosylation of FUT8 catalysis is the important posttranslational modification of glycoprotein and function controlling mode.
During using host cell expression antibody drug, its function and stability in vivo of the glycosylation modified influence of antibody.Study table
Bright, compared with the antibody of fucosylation, removing or reduce the antibody of fucosylation, to show stronger ADCC effects (anti-
Body dependent cellular cytotoxicity), antibody performance is good.Therefore, the FUT8 of engineering cell strain is knocked out, makes the antibody of expression without fucosido
Change modification, be the effective means for improving antibody performance.
Dihyrofolate reductase (dihydrofolate reductase, DHFR) is that one kind is catalyzed 5,6- dihydrofoilic acid also
Originally it was the protease of 5,6,7,8- tetrahydrofolic acids, and participated in intracellular purine metabolism process.When cell line has lacked DHFR genes,
The expression vector transfectional cell of DHFR genes will be carried, positive cell also just obtains DHFR genes, now adds in the medium
Enter methopterin (Methotrexate, MTX), DHFR gene magnifications can be caused, its related both sides fragment is also accordingly expanded,
The copy number of target gene, which can be made, increases by hundreds of Dao thousands of times, so that the high efficient expression for the gene that achieves the goal.Therefore, urgent need will strike
Except the DHFR genes of Chinese hamster ovary celI strain, to improve exogenous gene albumen expression quantity.
Crispr/Cas9 systems, are that one kind that bacterium and archeobacteria develop out during evolution is used to resist external
The immune intrusion system of infringement, in modern genetic engineering application field and TALEN (transcription activator-like
Effector nuclease) and ZFN (zinc-finger nuclease) technology side by side turn into three big genome editor works
Tool.CRISPR-Cas9 technologies have specific DNA recognition capability, and Cas9 endonucleases are in guide ribonucleic acid (guide
RNA, sgRNA) the lower cutting double-stranded DNA of guiding, causes genome double-strand break, the unstability repaired using cellular genome is produced
Raw non-specific restructuring repairs mistake (insertion is lacked) to produce, and gene function is caused so as to produce frameshift mutation
Lose, realize the purpose of gene knockout.TALEN and ZFN technologies are compared to, its sgRNA design and synthetic work amount are much
Less than the building process of TALEN and ZFN identification modules, it is easy to operate, and it is more efficient, be easier to obtain homozygous mutation
Body.
At present in research, have no by CRISPR-Cas9 systems, knock out two kinds of genes of FUT8 and DHFR in Chinese hamster ovary celI
Report.
The content of the invention
It is an object of the invention to provide a kind of kit for being used to knock out FUT8 genes and DHFR genes in Chinese hamster ovary celI
And application thereof.
FUT8 genes：For α-(1,6)-fucosyl transferase gene；
DHFR genes：For dihydrofolate reductase gene.
The invention provides a kind of kit for being used to knock out FUT8 genes and DHFR genes in Chinese hamster ovary celI, it includes SEQ
ID NO：1 and/or SEQ ID NO：SgRNA sequences described in 3, and SEQ ID NO：SgRNA sequences described in 23.
Present invention also offers a kind of kit for being used to knock out FUT8 genes and DHFR genes in Chinese hamster ovary celI, it includes
SEQ ID NO：13、SEQ ID NO：17 and SEQ ID NO：SgRNA sequences described in 31
Present invention also offers mentioned reagent box in the purposes for knocking out two kinds of genes of FUT8 and DHFR in Chinese hamster ovary celI.
Present invention also offers purposes of the mentioned reagent box in the cell line that FUT8 and DHFR genes are lacked is prepared simultaneously.
Present invention also offers a kind of while knocking out the method for FUT8 and DHFR genes in Chinese hamster ovary celI, it is to utilize
CRISPR/Cas9 systems are transformed two kinds of genes in Chinese hamster ovary celI, and step is as follows：
A, synthesis SEQ ID NO：Sequence and its complementary strand described in 1 and/or 3, denaturation, annealing, form double-strand, are inserted into
The multiple cloning sites of Cas9 expression vectors, obtain recombinant expression plasmid；
B, the recombinant expression carrier transfection CHO cell by step a, picking individual cells, inoculated and cultured；
C, after individual cells propagation be monoclonal after, identify and confirm that FUT8 genes are knocked, and obtain FUT8 genes lack
The cell line FUT8- of mistake/-, it is standby；
D, synthesis SEQ ID NO：Sequence and its complementary strand described in 23, denaturation, annealing, form double-strand, are inserted into Cas9
The multiple cloning sites of expression vector, obtain recombinant expression plasmid；
E, the FUT8-/- cell line for taking step c, are transfected, picking individual cells, inoculation with step d recombinant expression carrier
Culture；
F, after individual cells propagation be monoclonal after, identify and confirm that DHFR genes are knocked, and obtain FUT8 genes and
The cell line that DHFR genes are lacked simultaneously.
Wherein, the Chinese hamster ovary celI is CHO-S sub-types of cells.
Wherein, the Cas9 expression vectors are CRISPR/Cas9 carriers.
Present invention also offers the FUT8 deletion cells strain that the above method is prepared.
FUT8 the and DHFR genes prepared present invention also offers the above method are while the cell line lacked.
The present invention include the kits of sgRNA sequences, can be used for it is quick, efficiently simultaneously the FUT8 of knockout Chinese hamster ovary celI and
DHFR genes, realize the silence to FUT8 and DHFR genes in genomic level, easy to operation；The FUT8 of acquisition and
The cell line that DHFR genes are lacked simultaneously, has identical cellular morphology and growth characteristics, but expand with wild type CHO-S cells
Increasing Efficiency is higher, the antibody class medicine modified available for high efficient expression without fucose, and antibody production is high, is that antibody expression is carried
For a kind of good engineering cell strain selection.
Obviously, according to the above of the present invention, according to the ordinary technical knowledge and customary means of this area, do not departing from
Under the premise of the above-mentioned basic fundamental thought of the present invention, the modification of other diversified forms can also be made, replaces or changes.
The embodiment of form, remakes further specifically to the above of the invention by the following examples
It is bright.But the scope that this should not be interpreted as to above-mentioned theme of the invention is only limitted to following example.It is all to be based on the above of the present invention
The technology realized belongs to the scope of the present invention.
Brief description of the drawings
Fig. 1 is CHO-S/FUT8-/-/SD8 cell growth characteristics figures.
Fig. 2 is CHO-S/FUT8-/-/SD8 cell detection of mycoplasma figures (PC:Positive control；NC:Negative control；SE2/
SD8/SE7:Monoclonal cell strain is numbered).
Fig. 3 is that cell surface fucosido is detected and cellular morphology observation figure,
Upper left and lower-left：WtCHO-S cells；Upper right and bottom right：CHO-S/FUT8-/-/SD8 cells.
Fig. 4 is TNFR2-Fc Identification of Fusion Protein figures.
Fig. 5 is capillary electrophoresis analysis TNFR2-Fc glycans size figures.
Fig. 6 is CHO-S cell DHFR gene Exon1 partial sequences and sgRNA targeting sequence charts.
Fig. 7 is that fluorescein enzyme process identifies that each sgRNA guiding Cas9 cuts the efficiency chart of target dna.
Fig. 8 is CHO-S/DHFR-/-/G3 monoclonal cell speed of growth figures.
Fig. 9 is that cellular morphology observes figure,
Left figure：CHO-S/DHFR-/-/G3 monoclonal cells；Right figure：Wild type CHO-S cells (control)；
Figure 10 is CHO-S/DHFR-/-/G3 cell detection of mycoplasma figures (PC：Positive control；NC：Negative control；A2, G3：
Monoclonal cell strain is numbered).
Figure 11 is the lower TNFR2-Fc expression spirograms of different MTX dosage processing.
Figure 12 is CHO-S/FUT8-/-/DHFR-/-/G3 cell growth characteristics figures.
Figure 13 is CHO-S/FUT8-/-/DHFR-/-/G3 cell detection of mycoplasma figures (PC:Positive control；NC:It is negative right
According to；B8/D11:Monoclonal cell strain is numbered).
Embodiment
It is described further below with embodiment, but the present invention is not limited to these embodiments.
Experiment reagent used in the present invention is as follows：
Lipofectamine 2000, Invitrogen company, REF.11668-030, lot.1828123；
Trypsin0.25%, Hyclone company, SH42605.01, Cas.9002-07-7；
DEME/F-12, Gibco company, REF.C11330500CP, Lot.8115411；
Foetal Bovine Serum, Hyclone companies, Cat.SH30084.03, Lot.YK0119；
Opti-MEM, Gibco company, REF.31985-062, Lot.1800574；
Phosphate Buffered Saline, Hyclone companies, Cat.SH30256.01B, Lot.NAG1428
DEME, Gibco company, REF.C11995500CP, Lot.8116413；
Renilla Luciferase Assay Substrate, Promega companies, REF.E289A,
Lot.0000119245；
Renilla Luciferase Assay Buffer, Promega companies, REF.E290A, Lot.0000141517；
Stop＆Glo Substrate, Promega companies, REF.E640A, Lot.0000133610；
HT Supplement, Gibco companies, REF.11067-030, Lot.1797757；
UCA CRISPR/Cas9 rapid builds and activity detection kit, hundred Ao Saitu companies, Cat.BCG-DX001,
Lot.BBCTG201409。
CHO-S cells：Purchased from invitrogen companies, article No.：A1155701.
Embodiment 1 knocks out FUT8 the and DHFR genes of Chinese hamster ovary celI using kit of the present invention
First, the intracellular FUT8 genes of CHO-S are knocked out
1st, the sgRNA of design targeting CHO-S cell FUT8 genes
According to the FUT8 gene orders of the Genbank Chinese hamster ovary celIs announced, design is for different extrons (Exon)
SgRNA sequences, the sgRNA sequences such as table 1 of design：
The sgRNAs sequences of table 1
| Sequence number | SgRNA sequences (5---3) | Direction | PAM sequences | SgRNA sequence locations |
| SgRNA2‐f(SEQ ID NO：1) | UGGGAUACCCACCACACUGC | Reversely | AGG | Exon8 |
| SgRNA4‐f(SEQ ID NO：2) | ACAUGGACUCUGGGGAGAAG | Reversely | TGG | Exon9 |
| SgRNA5‐f(SEQ ID NO：3) | GUCCAGCUUUGCAAGAAUCU | Reversely | TGG | Exon1 |
CHO-S cell genomic dnas are extracted, using the primer amplifying genom DNA of table 2, gel reclaims amplified production, connection
To precut pUCA (LUC) carrier, apply Amp resistant panels, 4 clones of picking (mark respectively precut pUCA (LUC)-
FUT8-2/precut pUCA (LUC)-FUT8-4/precut pUCA (LUC)-FUT8-5, correspondence sgRNA2,4 and 5) surveyed
Sequence, and the FUT8 gene orders comparison announced with Genbank, detection sgRNA target position sequences whether there is mutation, as a result shown
SgRNA target sequences are without mutation.
Table 2 expands FUT8 gene sgRNA target spot the primers
SEQ ID NO：10 FUT8 gene sgRNA2-f target spot surrounding DNA sequences
SEQ ID NO：11 FUT8 gene sgRNA4-f target spot surrounding DNA sequences
SEQ ID NO：12 FUT8 gene sgRNA5-f target spot surrounding DNA sequences
2nd, the CRISPR/Cas9/sgRNA carriers of targeting FUT8 genes are built
SgRNA forward and reverse complementary series is respectively synthesized, and CACC joint sequences are added at the positive end of sequence 5, anti-
AAAC joint sequences are added to the end of sequence 5, composition sequence such as table 3 sets up double-strand sgRNA fragments by being denatured method for annealing.
Table 3 sets up CRISPR/Cas9/sgRNA carriers with each sgRNA forward and reverses sequence
| Sequence number | Direction | SgRNA sequences (5---3) |
| SgRNA2-f(SEQ ID NO：13) | It is positive | CACCGTGGGATACCCACCACACTGC |
| SgRNA2-f(SEQ ID NO：14) | Reversely | AAACGCAGTGTGGTGGGTATCCCAC |
| SgRNA4-f(SEQ ID NO：15) | It is positive | CACCGACATGGACTCTGGGGAGAAG |
| SgRNA4-f(SEQ ID NO：16) | Reversely | AAACCTTCTCCCCAGAGTCCATGTC |
| SgRNA5-f(SEQ ID NO：17) | It is positive | CACCGTCCAGCTTTGCAAGAATCT |
| SgRNA5-f(SEQ ID NO：18) | Reversely | AAACAGATTCTTGCAAAGCTGGAC |
With BsmB I digestion CRISPR/Cas9 carrier (the UCA CRISPR/Cas9 rapid builds of hundred Olympic Competition figure companies and work
Property detection kit in reagent), 1% Ago-Gel reclaims purpose fragment, and T4DNA ligases connect each sgRNA fragments and enzyme
Carrier is cut, and converts DH5a competent cells, Amp resistant panels are applied, each flat board selects 5 positive colonies and carries out sequencing core
It is real.Sequencing correct plasmid is purified and preserved with high-purity kit.
4th, for the sgRNA activity identifications of FUT8 genes
PCR sequencing PCR is taken to identify that each sgRNA guiding Cas9 cuts the activity of target gene.Concretely comprise the following steps：Pass on CHO-S thin
(cell culture medium is born of the same parents：DEME/F12+10%FBS) to 24 orifice plates, secondary daily lipofection transfection CRISPR-Cas9-
SgRNA-f and precut pUCA (LUC)-FUT8 carriers (wherein, Lipofectamine 2000 transfection reagent 2ul, CRISPR-
Cas9-sgRNA-f carriers 0.8ug, precut pUCA (LUC)-FUT8 0.2ug), transfection extracts cellular genome after 72 hours
DNA, PCR expand each sgRNA target areas domain gene, are connected to conversion DH5a competent cells after carrier T, then apply Amp flat boards, often
Each 30 bacterial clones of picking are sequenced on individual sgRNA correspondences flat board, analyze sgRNA target gene site sequence catastrophes.
Sequencing situation is shown in Table 4.
Each sgRNA guiding Cas9 of the sequencing analysis of table 4 cuts the efficiency of target dna
| Total sequencing number | Mutant target gene number | Mutation rate | |
| SgRNA2-f | 30 | 10 | 33% |
| SgRNA4-f | 30 | 4 | 13% |
| SgRNA5-f | 30 | 8 | 26% |
It can be seen that, after the plasmid-transfected cells for carrying SgRNA2-f, SgRNA5-f, to target gene FUT8 mutation effect compared with
Good, mutation rate reaches as high as 33%, and carries after SgRNA4-f plasmid-transfected cells, not good to the mutation effect of target gene.
To improve the efficiency of the inactivation intracellular FUT8 gene functions of CHO-S, using mixing transfection CRISPR-Cas9- in follow-up test
SgRNA2-f and CRISPR-Cas9-sgRNA5-f.
5th, the intracellular FUT8 genes of CHO-S are knocked out
Recovery CHO-S cells, reach 6 orifice plates, using lipofection, selection CRISPR-Cas9-sgRNA2-f and
Two plasmid co-transfection CHO-S cells of CRISPR-Cas9-sgRNA5-f are (during transfection：The transfection reagents of Lipofectamine 2000
4ul, CRISPR-Cas9-sgRNA2-f carrier 1ug, CRISPR-Cas9-sgRNA5-f carrier 1ug), next day reaches 25cm2Side
In bottle, pressurization screening is carried out from the serum free growth medium containing 75ug/ml LcAs, it is every more to renew within 2-3 days
Fresh culture medium, after pressurizeing 2 weeks, limiting dilution assay monoclonal is carried out to survivaling cell and (is coagulated in culture medium containing 50ug/ml lens
Collection element), cultivate into 4 piece of 96 orifice plate, continue to cultivate 2 weeks.
6th, CHO-S/FUT8-/- monoclonal cell screening
Cell culture about 2 weeks in 96 orifice plates, select that 30 cellular morphologies are good, fast growth monoclonal is digested,
1/3 cell reaches one piece of 48 orifice plate (A plates), and another 2/3 cell reaches another piece of 48 orifice plates (B plates), and next day extracts cell base on B plates
Because of a group DNA (30 DNA samples), sequence around sgRNA2-f and sgRNA5-f target spots, agar are expanded respectively using the primer of table 2
Sugared gel reclaims purpose fragment, is then connected to carrier T, converts DH5a competent cells, applies Amp resistant panels and (puts down for totally 60 pieces
Plate), next day is from 5 cloning and sequencings of picking on each flat board.
It is compared with former sequence, all missense mutations of selection, cell growth state are good, fast growth list
Clone carries out secondary Colony Culture.5 monoclonals are selected from secondary monoclonal to be identified, select all wrong meanings prominent
The negative monoclonal of change, good cell growth state, fast growth and detection of mycoplasma is amplified culture and frozen.
The speed of growth, cellular morphology observation point are carried out to monoclonal (CHO-S/FUT8-/-/SD8) cell finally chosen
Analysis and detection of mycoplasma, as a result show the CHO-S/FUT8-/-/SD8 monoclonal cell speeds of growth for knocking out FUT8 genes (see figure
1), form (see Fig. 3) and wild type CHO-S cell no significant differences, and without mycoplasma infection (see Fig. 2).
Wherein, the catastrophe of CHO-S/FUT8-/-/SD8 monoclonal cells is as follows：Double-stranded DNA breaks are different, and
Insertion/deletion bp numbers are not 3 integral multiples, wherein a chain (mutant A-) lacks 4bp, another chain (mutant B-) is more
1bp。
SEQ ID NO：19 CHO-S/FUT8-/-/SD8 monoclonal cells sequencing (mutant A- lacks 4bp)
SEQ ID NO：20 CHO-S/FUT8-/-/SD8 monoclonal cells sequencing (many 1bp of mutant B-)
7th, the performance verification of CHO-S/FUT8-/- cell
7.1 cell surface fucoses are detected
CHO-S/FUT8-/-/SD8 cells and wtCHO-S cells are spread to 48 orifice plates, next day removes culture medium, adds 10ug/
The LcA of ml luciferase mark, 37 degree are incubated 20 minutes, and PBS 2 times adds 100ul PBS, uses fluorescence
Micro- sem observation cell situation.As a result CHO-S/FUT8-/-/SD8 cell redgreen fluorescence is shown, and on wtCHO-S cell membranes
Green fluorescence is presented (see Fig. 3).
It can be seen that, the CHO-S/FUT8-/-/SD8 cell lines for knocking out FUT8 do not express fucose.
The glycosylation modified detection of 7.2 expression products
1) CHO-S/FUT8-/-/SD8 cells and CHO-S cells expression TNFR2-Fc
Build the expression vector containing TNFR2-Fc fusions (i.e. Tumor Necrosis Factor Receptors-Fc fusion proteins)
(construction method is pcDNA3.1-TNFR2-Fc：Synthesize TNFR2-Fc genes, using NheI and XhoI double digestions TFNR2-Fc and
PcDNA3.1,1% Ago-Gel reclaims purpose fragment, converts DH5a competent cells after the connection of T4DNA ligases, applies Amp
Resistant panel, chooses cloning and sequencing, and the correct clone of selection sequencing extracts plasmid using high-purity plasmid extraction kit), turn
Contaminate CHO-S/FUT8-/-/SD8 cell lines and wtCHO-S cell lines, and carry out cell pressurization culture (G418,800ug/ml) and
Monoclonal is screened, and is selected and is expressed higher cell line, in 225cm2Cell culture and protein expression are carried out in square vase.
TNFR2-Fc Identification of Fusion Protein：Purify recovery Fc fusion proteins (in detail with the Protein A affinity columns of GE companies
Method is shown in company's specification), protein concentration, PAGE gel analyzing proteins purity are determined by BCA determination of protein concentration method
And size.As a result show that recovery protein band is single, purity is up to 97%, and molecular weight is with being expected unanimously.At deglycosylating enzyme
Manage TNFR2-Fc fusion proteins, PAGE gel electrophoresis showed glycans size about 3kda.As a result Fig. 4 is seen.
2) the TNFR2-Fc protein glycosylations analysis of CHO-S/FUT8-/-/SD8 cells expression
The glycosyl of TNFR2-Fc fusion proteins, capillary electrophoresis analysis glycosyl size, molecule are cut with glycosylase
Ladder is mannose Marker.As a result Fig. 5 is seen, the antibody glycosyl of CHO-S/FUT8-/-/SD8 cell lines expression compares wtCHO-S
The small mannose molecules size of antibody glycosyl of cell expression, molecular weight about 160, and fucosido is also about 160, from figure
As a result it is consistent with being contemplated to be from the point of view of, illustrate that CHO-S/FUT8-/-/SD8 fucose generation key gene FUT8 is destroyed
Afterwards, the recombinant protein molecule of fucose missing can be produced.
It can be seen that, after the FUT8 genes using sgRNA sequence knockouts Chinese hamster ovary celI of the present invention, (TNFR2-Fc melts the antibody of expression
Hop protein) without fucose modification, and then improve the ADCC efficiency of antibody.
2nd, the sgRNA designs and knockout compliance test result of targeting CHO-S cell DHFR genes
1st, the sgRNA of design targeting CHO-S cell DHFR genes
According to the DHFR gene orders of the Genbank Chinese hamster ovary celIs announced, for First Exon (Exon1), design is different
SgRNA sequences, the sgRNA sequences of design are shown in Table 5：
The sgRNAs sequences of table 5
| Sequence number | SgRNA sequences (5---3) | Direction | PAM sequences | SgRNA sequence locations |
| SgRNA1‐h(SEQ ID NO：21) | GCAAGAACGGAGACCUUCCC | It is positive | TGG | Exon1 |
| SgRNA2‐h(SEQ ID NO：22) | GUCGCCGUGUCCCAGAAUAU | It is positive | GGG | Exon1 |
| SgRNA3‐h(SEQ ID NO：23) | GCCAAUGCUCAGGUACUGGC | It is positive | TGG | Exon1 |
CHO-S cell DHFR gene Exon1 partial sequences and sgRNA targetings sequence are shown in Fig. 6.
CHO-S cell genomic dnas are extracted, using the primer amplifying genom DNA of table 6, gel reclaims amplified production, connection
To precut pUCA (LUC) carrier (UCA CRISPR/Cas9 rapid builds and activity detection kit of hundred Olympic Competition figure companies
Middle reagent), labeled as precut pUCA (LUC)-DHFR, Kna resistant panels are applied, 4 clones of picking are sequenced, and and
The DHFR gene orders that Genbank is announced are compared, and detection sgRNA target position sequences whether there is mutation, as a result show sgRNA target spots
Sequence is without mutation.
Table 6 expands DHFR gene sgRNA target spot the primers
SEQ ID NO：26 DHFR gene SgRNA1-h, 2-h, 3-h target spot surrounding DNA sequences
2nd, the CRISPR/Cas9/sgRNA carriers of targeting DHFR genes are built
SgRNA forward and reverse complementary series is respectively synthesized, and CACC joint sequences are added at the positive end of sequence 5, anti-
AAAC joint sequences are added to the end of sequence 5, composition sequence is shown in Table 7, double-strand sgRNA fragments are set up by being denatured method for annealing.
Table 7 sets up CRISPR/Cas9/sgRNA carriers with each sgRNA forward and reverses sequence
| Sequence number | SgRNA sequences (5---3) |
| SgRNA1-h- forward directions (SEQ ID NO：27) | CACCGCAAGAACGGAGACCTTCCC |
| Reverse (the SEQ ID NO of SgRNA1-h-：28) | AAACGGGAAGGTCTCCGTTCTTGC |
| SgRNA2-h- forward directions (SEQ ID NO：29) | CACCGTCGCCGTGTCCCAGAATAT |
| Reverse (the SEQ ID NO of SgRNA2-h-：30) | AAACATATTCTGGGACACGGCGAC |
| SgRNA3-h- forward directions (SEQ ID NO：31) | CACCGCCAATGCTCAGGTACTGGC |
| Reverse (the SEQ ID NO of SgRNA3-h-：32) | AAACGCCAGTACCTGAGCATTGGC |
With BsmB I digestion CRISPR/Cas9 carrier (the UCA CRISPR/Cas9 rapid builds of hundred Olympic Competition figure companies and work
Property detection kit in reagent), 1% Ago-Gel reclaims purpose fragment, and T4DNA ligases connect each sgRNA fragments and enzyme
Carrier is cut, and converts DH5a competent cells, Amp resistant panels are applied, each flat board selects 5 positive colonies and carries out sequencing core
It is real.Sequencing correct plasmid is purified and preserved with high-purity kit.
3rd, for the sgRNA activity identifications of DHFR genes
Take luciferase methods to identify that each sgRNA guiding Cas9 cuts the activity of target gene, concretely comprise the following steps：Passage
(293 cell culture mediums are 293 cells：High sugar DEME+10%FBS) to 24 orifice plates, secondary daily lipofection transfection
CRISPR-Cas9-sgRNA-h and SSA luciferase-cut-gene carriers (every kind of sgRNA does 3 transfections) are (wherein,
Lipofectamine 2000 transfection reagent 2ul, CRISPR-Cas9-sgRNA-h carrier 0.8ug, SSA-luciferase-
Cut-gene 0.2ug), transfected with CRISPR-Cas9 the and SSA luciferase-cut-gene carriers containing active sgRNA
It is used as positive control (being labeled as positive).
Transfection takes supernatant 40ul after 72 hours, and adds 10ul luciferase substrates, detects luciferase intensity.
Testing result is shown in Table 8 and Fig. 7.
The fluorescein enzyme process of table 8 identifies that each sgRNA guiding Cas9 cuts the efficiency of target dna
| SgRNA1-h | SgRNA2-h | SgRNA3-h | Positive | |
| A | 435880 | 538070 | 1554960 | 858650 |
| B | 441770 | 632550 | 1455950 | 1075760 |
| C | 427220 | 515720 | 1672710 | 1011520 |
| Ave. | 434956.7 | 562113.3 | 1561207 | 981976.7 |
| sgRNA/PC | 0.44294 | 0.57243 | 1.589861 | 1 |
It can be seen that, after the plasmid-transfected cells for carrying SgRNA3-h, the fluorescence intensity of generation is significantly better than positive control, explanation
Its activity is good, cuts the efficiency high of target dna, and other sgRNA effect is not good.
4th, the intracellular DHFR genes of CHO-S are knocked out
Recovery CHO-S cells, reach 6 orifice plates, using lipofection, select CRISPR-Cas9-SgRNA3-h plasmids
Transfected CHO-S cells are (during transfection：Transfection reagent 4ul, the CRISPR-Cas9-SgRNA3-h carriers of Lipofectamine 2000
2ug), next day reaches 25cm2In square vase, from containing 750ug/ml G418,0.5mM hypoxanthine sodium, 0.08mM thymidines
Serum free growth medium carry out pressurization screening, per 2-3 days change fresh culture, pressurization 2 weeks after, to survivaling cell progress
Limiting dilution assay monoclonal, is cultivated into 4 piece of 96 orifice plate, continues to cultivate 2 weeks.
5th, CHO-S/DHFR-/- monoclonal cell is selected
Select that 30 cellular morphologies are good, fast growth monoclonal is digested, cell reaches one piece of 48 orifice plate, next day
Cell genomic dna on 48 orifice plates (30 DNA samples) is extracted, is expanded respectively around SgRNA3-h target spots using the primer of table 6
Sequence, Ago-Gel reclaims purpose fragment, is then connected to carrier T, converts DH5a competent cells, applies Amp resistant panels
(totally 60 pieces of flat boards), next day is from 5 cloning and sequencings of picking on each flat board.It is compared, selects all with former sequence
Missense mutation, cell growth state are good, the monoclonal of fast growth carries out secondary Colony Culture.Chosen from secondary monoclonal
Select 5 monoclonals to be identified, select good all missense mutations, cell growth state, fast growth and detection of mycoplasma
Negative monoclonal is amplified culture and frozen.
The speed of growth (Fig. 8), cell are carried out to the monoclonal cell (numbering CHO-S/DHFR-/-/G3, A2) finally chosen
(Fig. 9) and detection of mycoplasma (Figure 10) are analyzed in morphologic observation, and the obtained monoclonal cell speed of growth and open country are selected in as a result display
Raw type CHO-S cells are close, cellular morphology no significant difference, and without mycoplasma contamination.
Wherein, the catastrophe of CHO-S/DHFR-/-/G3 monoclonal cells is as follows：Double-stranded DNA breaks are different, and
Insertion/deletion bp numbers are not 3 integral multiples, wherein many 2bp of chain (mutant A-), another chain (mutant B-) is few
4bp。
SEQ ID NO：33 CHO-S/DHFR-/-/G3 monoclonal cells sequencing (many 2bp of mutant A-)
SEQ ID NO：34 CHO-S/DHFR-/-/G3 monoclonal cells sequencing (the few 4bp of mutant B-)
Understand, sgRNA sequences of the present invention can be used for the dihydrofolate reductase gene for knocking out Chinese hamster ovary celI, and obtain
The strain of dihydrofolate reductase gene deletion cells.The cell line of acquisition has identical cell shape with wild type CHO-S cells
State and multiplication speed, the expression available for follow-up functional recombinant protein.
6th, after DHFR gene knockouts, the compliance test result of foreign protein is expressed
According to molecular cloning method, building the expression vector containing TNFR2-Fc and DHFR genes, (construction method is：Will
Neo resistance fragments on pcDNA3.1 carriers replace with DHFR genes, are named as pcDNA3.1/DHFR, synthesize TNFR2-Fc bases
Cause, inserts it into the multiple cloning sites area of pcDNA3.1/DHFR carriers).And the CHO-S/ of the present invention is transfected respectively
DHFR-/-/G3 cell lines and wtCHO-S cell lines (wild type), being pressurizeed 5 days using 2ug/ml puromycin, (kill does not turn
Contaminate the Chinese hamster ovary celI of plasmid).Equal cell is taken into 6 orifice plates, the MTX of addition various dose pressurizes 2 weeks, the growth training more renewed
Base is supported, Fc expressing fusion protein situations in culture medium, ELISA detection culture supernatants are collected after 24 hours.
As a result show that the TNFR2-Fc of CHO-S/DHFR-/- cell expression is far above CHO-S cells, and as MTX is dense
The rise of degree, its TNFR2-Fc expression quantity is also improved (Figure 11).
3rd, the DHFR genes of CHO-S/FUT8-/-/SD8 cells are knocked out
Recovery CHO-S/FUT8-/-/SD8 cells, reaches 6 orifice plates, using lipofection, selects CRISPR-Cas9-
SgRNA3-h plasmid transfections CHO-S/FUT8-/-/SD8 cells are (during transfection：The transfection reagent 4ul of Lipofectamine 2000,
CRISPR-Cas9-SgRNA3-h carrier 2ug), next day reaches 25cm2In square vase, from containing 750ug/ml G418,0.5mM
Hypoxanthine sodium, the serum free growth medium of 0.08mM thymidines carry out pressurization screening, and fresh cultured was changed per 2-3 days
Base, after pressurizeing 2 weeks, limiting dilution assay monoclonal is carried out to survivaling cell, is cultivated into 4 piece of 96 orifice plate, continues to cultivate 2 weeks.Afterwards
It is continuous to select DHFR and FUT8 genes while the method for lacking monoclonal cell (selects CHO-S/DHFR-/- Dan Ke with the 5 of step 2
Grand cell).
Choose DHFR and FUT8 genes simultaneously lack monoclonal cell (numbering CHO-S/FUT8-/-/DHFR-/-/B8 with
D11), detected, as a result show that its growth characteristics compares no significant difference with archaeocyte before mutation, also without mycoplasma contamination.
(see Figure 12,13)
Wherein, the catastrophe of CHO-S/FUT8-/-/DHFR-/-/B8 monoclonal cells is as follows：Double-stranded DNA breaks differ
Sample, and insertion/deletion bp numbers are not 3 integral multiples, wherein the few 7bp of a chain (mutant A-), another chain (mutant
B-) few 1bp.
SEQ ID NO：35 CHO-S/FUT8-/-/DHFR-/-/B8 monoclonal cells sequencing (the few 7bp of mutant A-)
SEQ ID NO：36 CHO-S/FUT8-/-/DHFR-/-/B8 monoclonal cells sequencing (the few 1bp of mutant B-)
Therefore, sgRNA sequences of the present invention can be used for FUT8 the and DHFR genes for knocking out Chinese hamster ovary celI, and obtain two
Plant the cell line that gene is lacked simultaneously.After two kinds of genes are knocked, the antibody of Chinese hamster ovary celI strain expression is modified without fucosylation,
And yield is high, application prospect is good.
SEQUENCE LISTING
<110>Sichuan Feng Xun developments in science and technology Co., Ltd
<120>A kind of kit for being used to knock out two kinds of genes of FUT8 and DHFR in Chinese hamster ovary celI
<130> GY456-17P1185
<160> 36
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> RNA
<213>SgRNA2-f sequences
<400> 1
ugggauaccc accacacugc 20
<210> 2
<211> 20
<212> RNA
<213>SgRNA4-f sequences
<400> 2
acauggacuc uggggagaag 20
<210> 3
<211> 20
<212> RNA
<213>SgRNA5-f sequences
<400> 3
guccagcuuu gcaagaaucu 20
<210> 4
<211> 20
<212> DNA
<213>Fut8-2sg12-U1 primers
<400> 4
agtggtcgag ctccccattg 20
<210> 5
<211> 21
<212> DNA
<213>Fut8-2sg12-D1 sequences
<400> 5
gcagaaggac acactgcacc a 21
<210> 6
<211> 22
<212> DNA
<213>Fut8-2sg34-U1 primers
<400> 6
tctgttgatt ccaggttccc at 22
<210> 7
<211> 23
<212> DNA
<213>Fut8-2sg34-D1 sequences
<400> 7
tgcatcagat acagctagta agg 23
<210> 8
<211> 25
<212> DNA
<213>Fut8-2sg5-U1 sequences
<400> 8
gtaagagtca tcacagtata ccaga 25
<210> 9
<211> 24
<212> DNA
<213>Fut8-2sg5-D1 sequences
<400> 9
gactatatag atgtatcact gact 24
<210> 10
<211> 413
<212> DNA
<213>FUT8 gene sgRNA2-f target spot surrounding DNA sequences
<400> 10
agtggtcgag ctccccattg tagacagcct ccatcctcgt cctccttact tacccttggc 60
tgtaccagaa gaccttgcag atcgactcct gagagtccat ggtgatcctg cagtgtggtg 120
ggtatcccag tttgtcaaat acttgatccg tccacaacct tggctggaaa gggaaataga 180
agaaaccacc aagaagcttg gcttcaaaca tccagttatt gggtaagaat ctatccccct 240
ccccttaaac agtaatatat agcagtagtt gtatgtgttt actttttact gtagatttta 300
taatatttaa tagtcatagt cccaccaaag aacaaagatt ctaaaactta aaagactatt 360
ctccctttgt tcagttaggg cagcagagca aatggtgcag tgtgtccttc tgc 413
<210> 11
<211> 621
<212> DNA
<213>FUT8 gene sgRNA4-f target spot surrounding DNA sequences
<400> 11
tctgttgatt ccaggttccc atatattctt ggatatgcca attacttttt ctgtaagcaa 60
gtgtttcata aaacttttac ttaactttca tattgacctg tactattcaa cattcagcta 120
tgttaaagta tttgtgaagt gttttgaaat gattttatat tttctaaggt gagaataaat 180
gagaaaatgt tttaatatgt ctccagtgcc cccatgacta gggatactaa ttgagtacca 240
gtacattatc agtgtgctct ccacttctcc ccagagtcca tgtcagacgc actgacaaag 300
tgggaacaga agcagccttc catcccattg aggaatacat ggtacacgtt gaagaacatt 360
ttcagcttct cgaacgcaga atgaaagtgg ataaaaaaag agtgtatctg gccactgatg 420
acccttcttt gttaaaggag gcaaagacaa agtaagttag accaacaagt ggttctgtat 480
gggattatct cttagttgaa gaaaatcctt aattctggga acttgtggtt cttgttgcta 540
actaataggt tccaaaatca aagactacat gtgcaaatat taatctaatc aagtcatacc 600
ttactagctg tatctgatgc a 621
<210> 12
<211> 524
<212> DNA
<213>FUT8 gene sgRNA5-f target spot surrounding DNA sequences
<400> 12
gtaagagtca tcacagtata ccagagagac taattttgtc tgaagcatca tgtgttgaaa 60
caacagaaac ttattttcct gtgtggctaa ctagaaccag agtacaatgt ttccaattct 120
ttgagctccg agaagacaga agggagttga aactctgaaa atgcgggcat ggactggttc 180
ctggcgttgg attatgctca ttctttttgc ctgggggacc ttattgtttt atataggtgg 240
tcatttggtt cgagataatg accaccctga ccattctagc agagaactct ccaagattct 300
tgcaaagctg gagcgcttaa aacaacaaaa tgaagacttg aggagaatgg ctgagtctct 360
ccggtaggtt tgaaatactc aaggatttga tgaaatactg tgcttgacct ttaggtatag 420
ggtctcagtc tgctgttgaa aaatataatt tctacaaacc gtctttgtaa aattttaagt 480
attgtagcag actttttaaa agtcagtgat acatctatat agtc 524
<210> 13
<211> 25
<212> DNA
<213>SgRNA2-f forward primers
<400> 13
caccgtggga tacccaccac actgc 25
<210> 14
<211> 25
<212> DNA
<213>SgRNA2-f reverse primers
<400> 14
aaacgcagtg tggtgggtat cccac 25
<210> 15
<211> 25
<212> DNA
<213>SgRNA4-f forward primers
<400> 15
caccgacatg gactctgggg agaag 25
<210> 16
<211> 25
<212> DNA
<213>SgRNA4-f reverse primers
<400> 16
aaaccttctc cccagagtcc atgtc 25
<210> 17
<211> 24
<212> DNA
<213>SgRNA5-f forward primers
<400> 17
caccgtccag ctttgcaaga atct 24
<210> 18
<211> 24
<212> DNA
<213>SgRNA5-f reverse primers
<400> 18
aaacagattc ttgcaaagct ggac 24
<210> 19
<211> 523
<212> DNA
<213>CHO-S/FUT8-/sequencing of -/SD8 monoclonal cells, chain A
<400> 19
ttggtaccga gctcggatcc actagtaacg gccgccagtg tgctggaatt gcccttcagc 60
agaaggacac ctgcaccatt tgctctgctg ccctaactga acaaagggag aatagtcttt 120
taagttttag aatctttgtt ctttggtggg actatgacta ttaaatatta taaaatctac 180
agtaaaaagt aaacacatac aactactgct atatattact gtttaagggg agggggatag 240
attcttaccc aataactgga tgtttgaagc caagcttctt ggtggtttct tctatttccc 300
tttccagcct tgtggacgga tcaagtattt gacaaactgg gatacccacc acactgcagg 360
atcaccatgg actctcagga gtcgatctgc aaggtcttct ggtacagcca agggtaagta 420
aggaggacga ggatggaggc tgtctacaat ggggagcaag ggcaattctg cagatatcca 480
tcacactggc ggccgctcga gcatgcatct agagggccca att 523
<210> 20
<211> 528
<212> DNA
<213>CHO-S/FUT8-/sequencing of -/SD8 monoclonal cells, chain B
<400> 20
ttggtaccga gctcggatcc actagtaacg gccgccagtg tgctggaatt gcccttcagc 60
agaaggacca ctgcaccatt tgctctgctg ctctaactga acaaagggag aatagtcttt 120
taagttttgg aatctttgtt ctttggtggg actatgacta ttaaatatta taaaatctac 180
agtaaaaagt aaacacatac aactactgct atatattact gtttaagggg agggggatag 240
attcttaccc aataactgga tgtttgaagc caagcttctt ggtggtttct tctatttccc 300
tttccagcca aaggttgtgg acggatcaag tatttgacaa actgggatac ccaccacact 360
gcaggatcac catggactct caggagtcga tctgcaaggt cttctggtac agccaagggt 420
aagtaaggag gacgaggatg gaggctgtct acaatgggga gcaagggcaa ttctgcagat 480
atccatcaca ctggcggccg ctcgagcatg catctagagg gcccaatt 528
<210> 21
<211> 20
<212> RNA
<213>SgRNA1-h sequences
<400> 21
gcaagaacgg agaccuuccc 20
<210> 22
<211> 20
<212> RNA
<213>SgRNA2-h sequences
<400> 22
gucgccgugu cccagaauau 20
<210> 23
<211> 20
<212> RNA
<213>SgRNA3-h sequences
<400> 23
gccaaugcuc agguacuggc 20
<210> 24
<211> 25
<212> DNA
<213>DHFR-EXO1-F2 primers
<400> 24
cggggcctct gatgttcaaa tagga 25
<210> 25
<211> 25
<212> DNA
<213>DHFR-EXO1-R2 primers
<400> 25
tgaggaggtg gtggtcattc tttgg 25
<210> 26
<211> 584
<212> DNA
<213>DHFR gene SgRNA1-h, 2-h, 3-h target spot surrounding DNA sequences
<400> 26
cggggcctct gatgttcaaa taggatgcta ggcttgttga gggcgtggcc tccgattcac 60
aagtgggaag cagcgccggg cgactgcaat ttcgcgccaa acttggggga agcacagcgt 120
acaggctgcc taggtgatcg ctgctgctgt catggttcga ccgctgaact gcatcgtcgc 180
cgtgtcccag aatatgggca tcggcaagaa cggagacctt ccctggccaa tgctcaggta 240
ctggctggat tgggttaggg aaaccgaggc ggttcgctga atcgggtcga gcacttggcg 300
gagacgcgcg ggccaactac ttagggacag tcatgagggg taggcccgcc ggctgcagcc 360
cttgcccatg cccgcggtga tccccatgct gtgccagcct ttgcccagag gcgctctagc 420
tgggagcaaa gtccggtcac tgggcagcac caccccccgg acttgcatgg gtagccgctg 480
agatggagcc tgagcacacg tgacagggtc cctgttaacg cagtgtttct ctaactttca 540
ggaacgaatt caagtacttc caaagaatga ccaccacctc ctca 584
<210> 27
<211> 24
<212> DNA
<213>SgRNA1-h- forward primers
<400> 27
caccgcaaga acggagacct tccc 24
<210> 28
<211> 24
<212> DNA
<213>SgRNA1-h- reverse primers
<400> 28
aaacgggaag gtctccgttc ttgc 24
<210> 29
<211> 24
<212> DNA
<213>SgRNA2-h- forward primers
<400> 29
caccgtcgcc gtgtcccaga atat 24
<210> 30
<211> 24
<212> DNA
<213>SgRNA2-h- reverse primers
<400> 30
aaacatattc tgggacacgg cgac 24
<210> 31
<211> 24
<212> DNA
<213>SgRNA3-h- forward primers
<400> 31
caccgccaat gctcaggtac tggc 24
<210> 32
<211> 24
<212> DNA
<213>SgRNA3-h- reverse primers
<400> 32
aaacgccagt acctgagcat tggc 24
<210> 33
<211> 472
<212> DNA
<213>CHO-S/DHFR-/sequencing of -/G3 monoclonal cells, chain A
<400> 33
ggggcctctg atgttcaaat aggatgctag gcttgttgag ggcgtggcct ccgattcaca 60
agtgggaagc agcgccgggc gactgcaatt tcgcgccaaa cttgggggaa gcacagcgta 120
caggctgcct aggtgatcgc tgctgctgtc atggttcgac cgctgaactg catcgtcgcc 180
gtgtcccaga atatgggcat cggcaagaac ggagaccttg tccctggcca atgctcaggt 240
actggctgga ttgggttagg gaaaccgagg cggttcgctg aatcgggtcg agcacttggc 300
ggagacgcgc gggccaacta cttagggaca gtcatgaggg gtaggcccgc cggctgcagc 360
ccttgcccat gcccgcggtg atccccatgc tgtgccagcc tttgcccaga ggcgctctag 420
ctgggagcaa agtccggtca ctgggcagca ccaccccccg gacttgcatg gg 472
<210> 34
<211> 466
<212> DNA
<213>CHO-S/DHFR-/sequencing of -/G3 monoclonal cells, chain B
<400> 34
ggggcctctg atgttcaaat aggatgctag gcttgttgag ggcgtggcct ccgattcaca 60
agtgggaagc agcgccgggc gactgcaatt tcgcgccaaa cttgggggaa gcacagcgta 120
caggctgcct aggtgatcgc tgctgctgtc atggttcgac cgctgaactg catcgtcgcc 180
gtgtcccaga atatgggcat cggcaagaac ggagaccctg gccaatgctc aggtactggc 240
tggattgggt tagggaaacc gaggcggttc gctgaatcgg gtcgagcact tggcggagac 300
gcgcgggcca actacttagg gacagtcatg aggggtaggc ccgccggctg cagcccttgc 360
ccatgcccgc ggtgatcccc atgctgtgcc agcctttgcc cagaggcgct ctagctggga 420
gcaaagtccg gtcactgggc agcaccaccc cccggacttg catggg 466
<210> 35
<211> 540
<212> DNA
<213>CHO-S/FUT8-/-/DHFR-/sequencing of -/B8 monoclonal cells, chain A
<400> 35
ggaatctacg actgagcttg atatcgaatt cgcgtgtcgc ccttcggggc ctctgatgtt 60
caaataggat gctaggcttg ttgagggcgt ggcctccgat tcacaagtgg gaagcagcgc 120
cgggcgactg caatttcgcg ccaaacttgg gggaagcaca gcgtacaggc tgcctaggtg 180
atcgctgctg ctgtcatggt tcgaccgctg aactgcatcg tcgccgtgtc ccagaatatg 240
ggcatcggca agaacggaga ccttcaatgc tcaggtactg gctggattgg gttagggaaa 300
ccggggcggt tcgctgaatc gggtcgagca cttggcggag acgcgcgggc caactactta 360
gggacagtca tgaggggtag gcccgccggc tgcagccctt gcccatgccc gcggtgatcc 420
ccatgctgtg ccagcctttg cccagaggcg ctctagctgg gagcaaagtc cggtcactgg 480
gcagcaccac cccccggact tgcatgggta gccgctgaga tggagcctga gcacacgtga 540
<210> 36
<211> 480
<212> DNA
<213>CHO-S/FUT8-/-/DHFR-/sequencing of -/B8 monoclonal cells, chain B
<400> 36
ggggctctcg actgagcttg atatcgaatt cgctgtcgcc cttgaggagg tggtggtcat 60
tctttggaag tacttgaatt cgttcctgaa agttagagaa acactgcgtt aacagggacc 120
ctgtcacgtg tgctcaggct ccatctcagc ggctacccat gcaagtccgg ggggtggtgc 180
tgcccagtga ccggactttg ctcccagcta gagcgcctct gggcaaaggc tggcacagca 240
tggggatcac cgcgggcatg ggcaagggct gcagccggcg ggcctacccc tcatgactgt 300
ccctaagtag ttggcccgcg cgtctccgcc aagtgctcga cccgattcag cgaaccgcct 360
cggtttccct aacccaatcc agccagtacc tgagcattgg ccagggaggt ctccgttctt 420
gccgatgccc atattctggg acacggcgac gatgcagttc agcggtcgaa ccatgacagc 480
Claims (9)
1. a kind of kit for being used to knock out FUT8 genes and DHFR genes in Chinese hamster ovary celI, it is characterised in that it includes SEQ ID
NO：1 and/or SEQ ID NO：SgRNA sequences described in 3, and SEQ ID NO：SgRNA sequences described in 23.
2. a kind of kit for being used to knock out FUT8 genes and DHFR genes in Chinese hamster ovary celI, it is characterised in that it includes SEQ ID
NO：13、SEQ ID NO：17 and SEQ ID NO：SgRNA sequences described in 31.
3. kit described in claim 1 or 2 is in the purposes for knocking out two kinds of genes of FUT8 and DHFR in Chinese hamster ovary celI.
4. purposes of the kit described in claim 1 or 2 in the cell line that FUT8 and DHFR genes are lacked is prepared simultaneously.
5. it is a kind of while knocking out the method for FUT8 and DHFR genes in Chinese hamster ovary celI, it is characterised in that it is to utilize CRISPR/
Cas9 systems are transformed two kinds of genes in Chinese hamster ovary celI, and step is as follows：
A, synthesis SEQ ID NO：Sequence and its complementary strand described in 1 and/or 3, denaturation, annealing, form double-strand, are inserted into Cas9
The multiple cloning sites of expression vector, obtain recombinant expression plasmid；
B, the recombinant expression carrier transfection CHO cell by step a, picking individual cells, inoculated and cultured；
C, after individual cells propagation be monoclonal after, identify and confirm that FUT8 genes are knocked, and obtain FUT8 gene delections
Cell line FUT8-/-, it is standby；
D, synthesis SEQ ID NO：Sequence and its complementary strand described in 23, denaturation, annealing, form double-strand, are inserted into Cas9 expression
The multiple cloning sites of carrier, obtain recombinant expression plasmid；
E, the FUT8-/- cell line for taking step c, are transfected, picking individual cells, inoculated and cultured with step d recombinant expression carrier；
F, after individual cells propagation be monoclonal after, identify and confirm that DHFR genes are knocked, and obtain FUT8 genes and DHFR
The cell line that gene is lacked simultaneously.
6. method according to claim 5, it is characterised in that the Chinese hamster ovary celI is CHO-S sub-types of cells.
7. method according to claim 5, it is characterised in that the Cas9 expression vectors are CRISPR/Cas9 carriers.
8. the FUT8 deletion cells strain that claim 5-7 any one methods describeds are prepared.
9. the cell line that the FUT8 and DHFR genes that claim 5-7 any one methods describeds are prepared are lacked simultaneously.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710357070.6A CN107034234B (en) | 2017-05-19 | 2017-05-19 | A kind of kit for being used to knock out two kinds of genes of FUT8 and DHFR in Chinese hamster ovary celI |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710357070.6A CN107034234B (en) | 2017-05-19 | 2017-05-19 | A kind of kit for being used to knock out two kinds of genes of FUT8 and DHFR in Chinese hamster ovary celI |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107034234A true CN107034234A (en) | 2017-08-11 |
| CN107034234B CN107034234B (en) | 2018-04-10 |
Family
ID=59538865
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710357070.6A Active CN107034234B (en) | 2017-05-19 | 2017-05-19 | A kind of kit for being used to knock out two kinds of genes of FUT8 and DHFR in Chinese hamster ovary celI |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107034234B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107952074A (en) * | 2017-09-29 | 2018-04-24 | 四川大学华西医院 | Use of agents inhibiting SMC1B gene expression |
| CN113061605A (en) * | 2020-07-13 | 2021-07-02 | 中山大学 | Construction method and application of fucose transferase 8(FUT8) function-deficient cell strain |
| CN114934053A (en) * | 2022-06-30 | 2022-08-23 | 澳斯康生物(南通)股份有限公司 | Fucosyltransferase 8-deficient CHO cell line and preparation method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101883850A (en) * | 2007-07-12 | 2010-11-10 | 桑格摩生物科学股份有限公司 | Methods and compositions for inactivating alpha-1,6 fucosyltransferase (FUT 8) gene expression |
-
2017
- 2017-05-19 CN CN201710357070.6A patent/CN107034234B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101883850A (en) * | 2007-07-12 | 2010-11-10 | 桑格摩生物科学股份有限公司 | Methods and compositions for inactivating alpha-1,6 fucosyltransferase (FUT 8) gene expression |
Non-Patent Citations (2)
| Title |
|---|
| 孙涛: "利用Crispr技术敲除CHO细胞FUT8基因生产完全无岩藻糖抗体", 《中国学位论文全文数据库》 * |
| 孙涛等: "Crispr/Cas9 技术在CHO 细胞中基因敲除的应用", 《中国医药工业杂志》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107952074A (en) * | 2017-09-29 | 2018-04-24 | 四川大学华西医院 | Use of agents inhibiting SMC1B gene expression |
| CN113061605A (en) * | 2020-07-13 | 2021-07-02 | 中山大学 | Construction method and application of fucose transferase 8(FUT8) function-deficient cell strain |
| CN113061605B (en) * | 2020-07-13 | 2022-11-29 | 中山大学 | Construction method and application of fucose transferase 8 (FUT 8) function-deficient cell strain |
| CN114934053A (en) * | 2022-06-30 | 2022-08-23 | 澳斯康生物(南通)股份有限公司 | Fucosyltransferase 8-deficient CHO cell line and preparation method and application thereof |
| CN114934053B (en) * | 2022-06-30 | 2024-02-06 | 澳斯康生物(南通)股份有限公司 | Fucosyltransferase 8-defective CHO cell line and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107034234B (en) | 2018-04-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113831407B (en) | Methods for disrupting immune tolerance using multiple guide RNAs | |
| CN106103699B (en) | Body cell monoploid Human cell line | |
| DK3350327T3 (en) | CONSTRUCTED CRISPR CLASS-2-NUCLEIC ACID TARGETING-NUCLEIC ACID | |
| CA3111432A1 (en) | Novel crispr enzymes and systems | |
| EP3744844A1 (en) | Extended single guide rna and use thereof | |
| CN107828738A (en) | A kind of dnmt rna deficiency Chinese hamster ovary celI system and preparation method and application | |
| CN107949641A (en) | CRISPR/CAS9 compounds for genome editor | |
| CN106795521A (en) | The method and composition of target gene seat for modifying | |
| CN106755091A (en) | Gene knockout carrier, MH7A cell NLRP1 gene knockout methods | |
| CN106893739A (en) | For the new method and system of target gene operation | |
| TW202118873A (en) | Compositions and methods for treatment of disorders associated with repetitive dna | |
| EP3940078A1 (en) | Off-target single nucleotide variants caused by single-base editing and high-specificity off-target-free single-base gene editing tool | |
| CN107034234B (en) | A kind of kit for being used to knock out two kinds of genes of FUT8 and DHFR in Chinese hamster ovary celI | |
| CN102296073B (en) | Specific target site for site-directed knockout of gene Myostatin by zinc finger nuclease | |
| CA3236802A1 (en) | Serine recombinases | |
| CN106754949B (en) | Pig flesh chalone gene editing site 864-883 and its application | |
| CN105671045B (en) | A kind of method of sheep embryo fibroblast homologous recombination repair frequency after raising gene editing | |
| CN108138165A (en) | The ovum of birds, the production method of birds and birds | |
| CN102627692B (en) | A pair of transcription activator-like effector nucleases and coding engines as well as application thereof | |
| CN107201365B (en) | A kind of sgRNA sequences of specific knockdown dihydrofolate reductase gene and its application | |
| CN102627690B (en) | Pair of transcription activator-like effector nucleases (TALENs) and coding genes and application thereof | |
| Blitz | Primordial germ cell transplantation for CRISPR/Cas9-based leapfrogging in Xenopus | |
| Lohar | Biotechnology | |
| JPWO2020036181A1 (en) | Methods and cell populations for isolating or identifying cells | |
| CN102627691B (en) | Pair of transcriptional activation subsample effect factor nucleases and coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |