CN107034217A

CN107034217A - Promoter, recombinant mesenchymal stem cell, and preparation method and application thereof

Info

Publication number: CN107034217A
Application number: CN201611200969.9A
Authority: CN
Inventors: 闫立; 连祺周
Original assignee: Zhong Ji Hengrun International Holdings Ltd
Current assignee: Zhong Ji Hengrun International Holdings Ltd
Priority date: 2016-05-16
Filing date: 2016-12-22
Publication date: 2017-08-11
Also published as: HK1217268A2

Abstract

The invention discloses a promoter, a recombinant mesenchymal stem cell, and a preparation method and application thereof. The promoter has the sequence shown in SEQ ID NO. 2, and can positively activate and express TNF alpha antibody gene in the presence of inflammatory factor TNF alpha. A preparation method of the recombinant mesenchymal stem cells utilizes the promoter to prepare the recombinant mesenchymal stem cells. The invention also provides the recombinant mesenchymal stem cell prepared by the preparation method of the recombinant mesenchymal stem cell, and the recombinant mesenchymal stem cell can be activated by an inflammatory factor TNF alpha under an inflammatory environment and can be stably combined with an inflammatory site, so that the anti-inflammatory and immunoregulatory capacity of the mesenchymal stem cell is enhanced, and the recombinant mesenchymal stem cell can be used for treating osteoarthritis and has a good treatment effect. The invention also provides application of the recombinant mesenchymal stem cells, the recombinant mesenchymal stem cells are used for preparing a medicament for treating osteoarthritis, and the obtained medicament has a good effect of treating osteoarthritis.

Description

Promoter, restructuring interstital stem cell and its preparation method and application

【Technical field】

The present invention relates to biomedicine technical field, and in particular to a kind of promoter, restructuring interstital stem cell and its preparation Methods and applications.

【Background technology】

Osteoarthritis (OA, osteoarthritis) also known as degenerative osteoarthritis, are the retrogression of articular cartilage, and There is spur to be formed in joint margins.With the extension of average human life, the incidence of disease more and more higher of osteoarthritis.Inflammation can be led The regression of cartilage is caused, and cartilage degeneration can stimulate the deterioration of inflammation, so that the state of an illness is further serious.

Treatment osteoarthritis method mainly have physical treatment and drug therapy, physical treatment mainly for patients with mild, Reach the purpose for mitigating pain and maintaining function of joint.The medicine that drug therapy is used mainly has：Antalgesic, cox 2 inhibitor, Steroids, synovia replenishers etc..However, the limited efficacy of these treatment methods, specificity is not obvious, it is impossible to be effectively improved disease Feelings.

【The content of the invention】

To overcome the technical problem that existing osteoarthritis treatment method effect is poor, the present invention provides a kind of promoter, again Group interstital stem cell and its preparation method and application.

The present invention is to provide a kind of promoter, the sequence of the promoter to solve a technical scheme of above-mentioned technical problem Such as SEQ ID NO:Shown in 2.

The present invention also provides a kind of preparation method for recombinating interstital stem cell, including：There is provided TNF Alpha antibodies gene and above-mentioned Promoter, structure obtain slow virus expression plasmid；Wherein, the sequence of the TNF Alpha antibodies gene such as SEQ ID NO:1 institute Show；The slow virus expression plasmid is subjected to slow virus packaging, virus liquid is obtained；Mesenchyma is infected in the virus liquid dry thin Born of the same parents, obtain required restructuring interstital stem cell.

Preferably, the structure of the slow virus expression plasmid includes：Step S11：By the TNF Alpha antibodies gene and described Promoter is cloned into shuttle plasmid pGFP, obtains shuttle plasmid TNF α-GFP；Step S12：With the shuttle plasmid TNF α- GFP adds the TNF Alpha antibodies gene and obtains TNF α-AB plasmid vectors as carrier；Step S13：Convert the TNF α- AB plasmid vectors simultaneously carry out plasmid extraction and obtain the slow virus expression plasmid.

Preferably, the TNF Alpha antibodies gene by using endonuclease Xho1 and endonuclease Xba1 to described Shuttle plasmid TNF α-GFP carry out double digestion and obtained.

Preferably, the time of the double digestion is 3-24h.

Preferably, the step S12 is to be attached instead using TNF Alpha antibodies gene and shuttle plasmid TNF α-GFP Should, obtain TNF α-AB plasmid vectors；The concentration of shuttle plasmid TNF α-GFP described in the reaction system of the coupled reaction is 2-3ng/ μ L, the TNF Alpha antibodies gene molal quantity is 2-4 times of the shuttle plasmid TNF α-GFP molal quantitys.

Preferably, the step S12, which is additionally included in reaction system, adds DNA ligase and connection buffer solution；It is described anti- The percent by volume for answering DNA ligase in system is 2-3%, and the percent by volume of connection buffer solution is 8-12%.

Preferably, the TNF α-AB plasmid vectors are converted and specifically includes following steps：TNF α-AB the plasmids are carried Body is added in bacillus coli DH 5 alpha competent cell, and mixed solution is obtained after being well mixed；By mixed solution ice bath 20- 50min, ice bath 1-4min again after acting on 30-90s through 40-45 DEG C of heat shock；Then mixed solution is placed in culture medium and cultivated, Obtain the nutrient solution containing the slow virus expression plasmid.

The present invention also provides a kind of restructuring interstital stem cell, and the restructuring interstital stem cell is integrated with promoter and TNF α are anti- Body gene；The sequence of the promoter such as SEQ ID NO:Shown in 2, the sequence such as SEQ ID NO of the TNF Alpha antibodies gene:1 It is shown.

The present invention also provides a kind of application for recombinating interstital stem cell, and above-mentioned restructuring interstital stem cell is used to prepare and treated The medicine of osteoarthritis.

Relative to prior art, a kind of promoter provided by the present invention, the promoter can be deposited in inflammatory factor TNF α Positive activation expression TNF Alpha antibodies genes, can obtain being used to treat osteoarthritis and treatment using the promoter in case The good restructuring interstital stem cell of effect.

A kind of preparation method for restructuring interstital stem cell that the present invention is also provided, restructuring is prepared using above-mentioned promoter Interstital stem cell, the restructuring interstital stem cell can be activated under inflammatory environment by inflammatory factor TNF α, can be stably coupled to inflammation Disease site, so as to strengthen the anti-inflammatory and immunoregulation capability of mescenchymal stem cell, thus can be used to treat osteoarthritis and treatment Effect is good.

The present invention also provides in a kind of restructuring interstital stem cell, the restructuring interstital stem cell and is integrated with promoter and TNF α Antibody gene, can be activated by inflammatory factor TNF α under inflammatory environment, inflammation sites can be stably coupled to, so that between strengthening The anti-inflammatory and immunoregulation capability of mesenchymal stem cells, thus can be used to treat osteoarthritis and therapeutic effect is good.

The present invention also provides a kind of application for recombinating interstital stem cell, and above-mentioned restructuring interstital stem cell is used to prepare and treated The medicine of osteoarthritis, the effect of resulting drug therapy osteoarthritis is good.

【Brief description of the drawings】

Fig. 1 is the schematic flow sheet of the preparation method of restructuring interstital stem cell in the present invention.

Fig. 2 is the step S1 of the preparation method of restructuring interstital stem cell in present invention schematic flow sheet.

Fig. 3 is the collection of illustrative plates of shuttle plasmid pGFP in the present invention.

Fig. 4 is the collection of illustrative plates of shuttle plasmid TNF α-GFP in the present invention.

Fig. 5 is the collection of illustrative plates of third generation slow virus packaging plasmid in the present invention.

Fig. 6 is the structural representation of the promoter of addition translation sequences and green fluorescent protein sequence in the present invention.

Fig. 7 is the efficiency qualification figure after slow-virus infection MSC in the present invention.

Fig. 8 is that RT-PCR detects MSC after slow-virus infection in the present invention, TNF α-AB expression.

Fig. 9 is the expression of TNF α-AB in western blotting detection cells.

Figure 10 is whether HE dyeing detections tissue inflammation Infiltrating after treatment improves.

Figure 11 detects for the propagation of elisa technique inflammation Mouse spleen cells after treatment.

Figure 12 is the expression that elisa technique detects the inflammation mouse inflammatory factor after treatment.

Figure 13 is the expression that Real-time round pcrs detect the inflammatory factor in inflammation mouse mRNA level in-site after treatment.

【Embodiment】

In order that the purpose of the present invention, technical scheme and advantage are more clearly understood, below in conjunction with accompanying drawing and embodiment, The present invention will be described in further detail.It should be appreciated that the specific embodiments described herein are merely illustrative of the present invention, It is not intended to limit the present invention.

Embodiment one

The present invention provides a kind of promoter, the sequence such as SEQ ID NO of the promoter:Shown in 2.The promoter can be Positive activation expression TNF Alpha antibodies genes in the presence of inflammatory factor TNF α, can obtain being used to treat using the promoter Osteoarthritis and the good restructuring interstital stem cell of therapeutic effect.

Promoter provided by the present invention positive activation expression TNF Alpha antibodies in the presence of inflammatory factor TNF α The mechanism of action of gene is：Inflammatory factor TNF α have multiple downstream signaling pathways, one downstream signaling pathway of most important of which It is the activation of NF- κ B transcription factors；And inflammatory factor TNF α activation NF- κ B paths have numerous signaling molecules to participate in, such as TNFR phases Close the factor, receptor interacting protein (RIP, Receptor-interacting protein), MAPK 3 (MAP3K, mitogen-activated protein kinase ki-nase 3), IKK compounds, IL-10 (IL-10) Deng；The present invention IL-10 in close relations with inflammatory factor TNF α is filtered out in numerous signaling molecules, by by IL-10 with CAG promoters are combined to obtain the promoter.Therefore when inflammatory factor TNF alpha expressions are raised, it can activate IL-10's Expression, the promoter designed accordingly can positive activation expression TNF Alpha antibodies genes.

Embodiment two

As shown in figure 1, a kind of preparation method for recombinating interstital stem cell, including：

Step S1：TNF Alpha antibodies gene and above-mentioned promoter are provided, structure obtains slow virus expression plasmid；Wherein, institute State the sequence such as SEQ ID NO of TNF Alpha antibodies genes:Shown in 1；

Step S2：The slow virus expression plasmid is subjected to slow virus packaging, virus liquid is obtained；

Step S3：Mescenchymal stem cell is infected in the virus liquid, required restructuring interstital stem cell is obtained.Wherein, Mescenchymal stem cell (MSC) can directly be bought, or be extracted from marrow.In the concrete operations of the present invention It is to extract to obtain MSC from C57/BL6 mouse bone marrow cells, C57/BL6 mouse are purchased from Hong Kong University's Experimental Animal Center.

Restructuring interstital stem cell is prepared using above-mentioned promoter, the restructuring interstital stem cell can quilt under inflammatory environment Inflammatory factor TNF α are activated, and inflammation sites can be stably coupled to, so as to strengthen anti-inflammatory and the immunological regulation of mescenchymal stem cell Ability, thus can be used to treat osteoarthritis and therapeutic effect is good.

It is preferred that, also referring to Fig. 2, the structure of step S1 namely the slow virus expression plasmid includes：

Step S11：The TNF Alpha antibodies gene and the promoter are cloned into shuttle plasmid pGFP, shuttle matter is obtained Grain TNF α-GFP；

Step S12：Using the shuttle plasmid TNF α-GFP as carrier, add the TNF Alpha antibodies gene and obtain TNF α-AB plasmid vectors；

Step S13：Convert the TNF α-AB plasmid vectors and carry out plasmid extraction and obtain the slow virus expression plasmid.

By the way that TNF Alpha antibodies gene and promoter are cloned into shuttle plasmid pGFP, and with the shuttle plasmid TNF of acquisition α-GFP are carrier, TNF Alpha antibodies genes are added, so that the TNF containing TNF Alpha antibodies gene and promoter stablized α-AB plasmid vectors；And the promoter can be allowed to work and expression TNF Alpha antibodies genes；Inverted TNF α-AB plasmid vectors And carry out the slow virus expression plasmid needed for plasmid extraction is obtained.

Wherein shuttle plasmid pGFP is provided by Guangzhou FulenGen Co., Ltd., and the collection of illustrative plates of the shuttle plasmid pGFP is as schemed Shown in 3.Shuttle plasmid TNF α-GFP collection of illustrative plates is as shown in figure 4, the IL-CAG promoter in Fig. 4 are the promoter.

Preferably, the TNF Alpha antibodies gene by using endonuclease Xho1 and endonuclease Xba1 to described Shuttle plasmid TNF α-GFP carry out double digestion and obtained.TNF Alpha antibodies genes are obtained using the shuttle plasmid TNF α-GFP, are protected The uniformity of TNF Alpha antibodies genes used in whole preparation process is demonstrate,proved, so as to ensure that the restructuring interstitial of final gained is dry thin The stability of born of the same parents.And according to shuttle plasmid TNF α-GFP gene order, restriction endonuclease is selected, i.e., from core Sour restriction endonuclease Xho1 and endonuclease Xba1 carry out double digestion, so as to ensure to obtain complete and stable TNF Alpha antibodies genes. Certainly in other embodiment, due to having been given by the sequence of TNF Alpha antibodies genes, directly it can also synthesize or utilize PCR amplification techniques obtain the TNF Alpha antibodies gene.

Preferably, the time of the double digestion is 3-24h.It so can guarantee that the effect of digestion, i.e. digestion are complete.Wherein more It is 6-12h the times of double digestion that good, which is,.

By determining shuttle plasmid TNF α-GFP concentration and TNF Alpha antibodies gene with shuttle plasmid TNF α-GFP's Amount ratio between molal quantity, the coupled reaction is relatively stable, and can effectively reduce the impurity in reaction product, miscellaneous herein Matter refers to the material in addition to required TNF α-AB plasmid vectors.It is preferred that the shuttle plasmid TNF α-GFP's is dense Spend for 2.5ng/ μ L, the TNF Alpha antibodies gene molal quantity is 3 times of the shuttle plasmid TNF α-GFP molal quantitys.

Preferably, the step S12, which is additionally included in reaction system, adds DNA ligase and connection buffer solution；It is described anti- The percent by volume for answering DNA ligase in system is 2-3%, and the percent by volume of connection buffer solution is 8-12%.By determining DNA ligase and the percent by volume for connecting buffer solution, it is ensured that the rapidity and stability of reaction.Wherein, DNA ligase is T4 DNA ligase, connection buffer solution is 10 × Ligation Buffer；In preferably embodiment, DNA in the reaction system The percent by volume of ligase is 2.5%, and the percent by volume of connection buffer solution is 10%.

Specifically, so that the reaction system cumulative volume of coupled reaction is 20 μ L as an example, including 50ng in reaction system and shuttling Plasmid TNF α-GFP, 2 μ 10 × Ligation of L Buffer, 0.5 μ L T4 DNA ligase, then add distilled water or ultrapure Water is to 20 μ L.

Preferably, TNF α-AB plasmid vectors in the step S13 are converted and specifically include following steps：By the TNF α- AB plasmid vectors are added in bacillus coli DH 5 alpha competent cell, and mixed solution is obtained after being well mixed；By the mixed solution ice 20-50min is bathed, ice bath cools down 1-4min again after acting on 30-90s through 40-45 DEG C of heat shock；Then mixed solution is placed in culture Cultivated in base, obtain the nutrient solution containing the slow virus expression plasmid.First, by thin from bacillus coli DH 5 alpha competence Born of the same parents, both can guarantee that the expression of TNF α-AB plasmid vectors, and will not cause negative shadow to the conversion of TNF α-AB plasmid vectors Ring, the negative effect at this refers to that the TNF α-AB plasmid vectors that can degrade are not present in bacillus coli DH 5 alpha competent cell Special inscribe enzyme system, and the DNA of TNF α-AB plasmid vectors is not modified etc..Secondly, by by mixed solution Heat shock after ice bath 20-50min, is and then placed in the operation of 1-4min on ice, it is ensured that transformation efficiency.

Specifically, it is thin the reaction product obtained after coupled reaction directly can be directly added into bacillus coli DH 5 alpha competence In born of the same parents.Such as, reaction product described in taking 12 μ L is added in 50 μ L bacillus coli DH 5 alpha competent cells, is gently mixed, ice bath 30min；Carry out heat shock again, 42 DEG C of metal bath 50s, ice bath 1-2min again, adds 500 μ L and has been incubated to 37 DEG C of nonreactives rapidly The LB culture mediums of property；At 37 DEG C, shaking table culture 1h under conditions of 200rpm is centrifuged with 8000rpm rotating speed after culture, goes to part It is coated on after supernatant on the LB flat boards containing adenylic acid (AMP, adenosine monophosphate), training is inverted at 37 DEG C Support overnight；Picking monoclonal bacterium colony is in the LB culture mediums of non-resistant, and by volume 1:300 add AMP, in 37 DEG C, 200rpm Under conditions of shaking table culture 12h, obtain nutrient solution.

Plasmid extraction is carried out after conversion obtains the nutrient solution can obtain the slow virus expression plasmid.Plasmid extraction It is to remove the impurity such as RNA, protein, obtain relatively pure slow virus expression plasmid.Specifically, can use plasmid Small extraction reagent kit Lot# L0802 carry out plasmid extraction, and step is as follows：

1) column equilibration, adsorption column adds 500 μ L equilibrium liquids, 12000rpm centrifugations 1min；

2) nutrient solution 3mL overnight is taken, is added in two times in 1.5mLEP pipes, 12000rpm centrifugation 1min are suctioned out as far as possible Clear liquid, collects somatic cells；

3) 250 μ L solution P1 are added into precipitation, thoroughly suspended precipitation with rifle；

4) 250 μ L solution P2 are added, gently spins upside down 6~8 times, thalline is fully dissolved；

5) 350 μ L solution P3 are added, are gently spun upside down immediately 6~8 times until there is flocculent deposit, 12000rpm is centrifuged 10min；

6) supernatant is added in adsorption column, 12000rpm centrifugation 30s repeat step operation once；

7) 600 μ L rinsing liquid is added, 12000rpm centrifugation 30s repeat step operation once；

8) 12000rpm centrifuges 2min, removes rinsing liquid, room temperature, which is uncapped, dries；

9) 40 μ L ddH2O elutions are added, are stood in 2min, 12000rpm centrifugation 2min obtain slow virus expression plasmid TNF α-GFP。

Wherein, equilibrium liquid used, solution P1, solution P2, solution P3 and rinsing liquid are the small extraction reagent kit Lot# of plasmid There is provided in L0802.

Be further, in step s 2, slow virus packaging be by the slow virus expression plasmid and package carrier together Transfection of packaging cells, you can obtain required virus liquid.It can be specifically to select 239FT cells as incasing cells, and make Slow virus is carried out with the kits of Lipofectamine 2000 to pack.Preferably, before slow virus packaging, namely transfection is carried out 24h, digests 293FT cells and counts, with 5 × 10⁶It is inoculated in 10cm culture dishes, 293FT cell confluencies when transfecting it Up to 80%~90%.

The step of can then proceed in 2000 specifications of Lipofectamine, by slow virus expression plasmid TNF α-GFP And shuttle plasmid pGFP is separately added into after slow virus packaging plasmid, Transfection of packaging cells 293FT.Plasmid consumption is respectively (10 μ g PGFP+6.52 μ g pMDL+2.52 μ g pRSV-REV+3.52 μ g pMD2.G) and (36 μ g TNF α-GFP+12 μ g pMDL+6 μ g pRSV-REV+18μg pMD2.G).Transfect after 48h, the viral supernatants that harvest incasing cells 293FT is produced are placed in 4 DEG C of temperature It is lower temporary.Fresh 293FT culture mediums are added, 24h is further cultured for, on second of collection viral supernatants, with the virus of first time collection Clear mixing, through 0.45 μm of membrane filtration and according to Peg-it specifications by viral concentration.Virus liquid after packing concentration, be placed in- Preserved at a temperature of 80 DEG C.

Wherein, the third generation slow virus packaging plasmid that slow virus packaging plasmid provides for addgene companies, the third generation is slow The collection of illustrative plates of viral packaging plasmid is as shown in Figure 5.

As it was noted above, mescenchymal stem cell (MSC) can be extracted from marrow.MSC extraction can be with It is to be obtained by bone marrow irrigation method：Heteroproteose cell is gone by stationary culture, about pass on 4 times after, under microscope visible MSC be compared with The spindle shape of rule, arranges directional, swirling, radial growth tendency is presented.

The infection of mescenchymal stem cell is specifically as follows in step s3：Digestion MSC cells are simultaneously counted, with 1 × 10⁶Per hole Density be inoculated in 6 orifice plates, viral supernatants and Polybrene (final concentration of 8 μ g/mL) are added in 6 orifice plates.

Embodiment three

One kind restructuring interstital stem cell, is integrated with promoter and TNF Alpha antibodies genes；The sequence of the promoter such as SEQ ID NO:Shown in 2, the sequence such as SEQ ID NO of the TNF Alpha antibodies gene:Shown in 1.Use above-mentioned restructuring interstital stem cell Preparation method prepare.Promoter and TNF Alpha antibodies genes are integrated with the restructuring interstital stem cell, under inflammatory environment It can be activated by inflammatory factor TNF α, inflammation sites can be stably coupled to, so as to strengthen the anti-inflammatory of mescenchymal stem cell with being immunized Regulating power, thus can be used to treat osteoarthritis and therapeutic effect is good.

Example IV

A kind of application for recombinating interstital stem cell, above-mentioned restructuring interstital stem cell is used for the medicine for preparing treatment osteoarthritis Thing, the effect of resulting drug therapy osteoarthritis is good.The restructuring interstital stem cell can be administered alone, or with medicine The form administration of composition.It is appreciated that described pharmaceutical composition includes restructuring interstital stem cell and carrier or excipient.It is made Dosage form formula depends on selected method of administration, can be manufactured according to general knowledge well known in the art, and the restructuring interstitial is done Cell is present in the medium of cytocompatibility, in such as 0.9% physiological saline or is made slow controlling agent.

An experimental group, an empty vector control group and a blank control group is set to be tested.Experimental group is with this The MSC infected in invention using the slow virus expression plasmid, that is, the restructuring interstitial obtained after being recombinated are dry carefully Born of the same parents, are designated as MSC-TNF α-AB.Empty vector control group is the MSC using shuttle plasmid pGFP infection, is designated as MSCe.Blank control Group is the MSC for not carrying out slow-virus infection, is designated as MSC.

And be identified through successfully infecting in virus liquid made from the slow virus expression plasmid for convenience it is described between fill Matter stem cell, can be that one section of translation sequences and fluorescent protein sequence are designed in the promoter.As shown in fig. 6, described Translation sequences (IRES) and green fluorescent protein sequence (GFP, Green Fluorescent Protein) are added in promoter. Cell so after mescenchymal stem cell infects successfully, by microscope it is observed that cell sends green fluorescence.Specifically , the expression of green fluorescent protein (GFP) is observed under fluorescence inverted microscope after infection 48h.I.e. in 488nm wavelength Under exciting light, it is seen that most cells send green fluorescence.

First, the efficiency identification after slow-virus infection

To above-mentioned experimental group, empty vector control group and blank control group carry out infection test, as a result as shown in fig. 7, Occurs green fluorescent protein (GFP) expression in MSC-TNF α-AB and MSCe, the expression without GFP in MSC.

2nd, the expression identification of TNF Alpha antibodies gene (TNF α-AB)

The table of TNF Alpha antibodies gene (TNF α-AB) is carried out to above-mentioned experimental group, empty vector control group and blank control group Up to identification.Concrete operations are：

1 × 10 is collected respectively⁶MSC, MSCe and MSC-TNF α-AB, according to the RNeasy Mini of QIAGEN companies Kit (catalog number (Cat.No.) 74104) extracts cell total rna, according to the Prime Script First StOAndcDNA of TakaOA companies Synthesis Kit (catalog number (Cat.No.) 6110A) Reverse Transcriptase kit specification, is cDNA by total serum IgE reverse transcription, uses TaKaOATaq^TM (catalog number (Cat.No.) R001A) and it is that annealing temperature enters performing PCR with 60 DEG C.

PCR the primer sequences are as follows：

Mouse MSC-TNF α-AB gene outcomes length (257bp)：

F：5’-GCTAGAGTGGCTCTCGCA-3’(SEQ ID NO:3)

R：5’-CGAAGGGGCGGAACTTAA-3’(SEQ ID NO:4)

Mouse β-actin gene (Genbank accession numbers：NM_007393.3) (product length 448bp)：

F：5’-AGAGGGAAATCGTGCGTGAC-3’(SEQ ID NO:5)

R：5’-TGCTGGAAGGTGGACAGTGAG-3’(SEQ ID NO:6)

As a result show, compared to blank control group MSC and empty vector control group MSCe, experimental group MSC-TNF α-AB viruses TNF α-AB expressions are significantly improved (Fig. 8) in metainfective MSC-TNF α-AB cells, it was demonstrated that and experimental group MSC-TNF α- AB virus infection MSC works well, and can stabilize it overexpression TNF α-AB.

3rd, the MSC-TNF α-AB that detection is built can be started by inflammatory factor TNF α specific regulatings

To detect the expression of the TNF α-AB after inflammatory factor TNF α are added in external MSC cell culture.

1.MSC-TNF α-AB cell culture：

MSC-TNF α-AB cell culture mediums are：Contain 10% hyclone (FBS) in DMEF/F12 culture mediums, 100U/mL mycillins, 1% nonessential amino acid, 0.1% beta -mercaptoethanol, 5ng/mL EGF, 5ng/mL FGF.

1) before sterile culture is carried out, by laboratory material requested autoclaving；Ultra violet lamp 30min；Dress cell Between Special experimental clothes and gloves, with 75% alcohol wipe both hands；Under microscope, cell state is observed, cell density is converged to More than 70% then needs passage, closes uviol lamp, opens blower fan, while wiping super-clean bench with cotton ball soaked in alcohol, lights alcolhol burner.

2) culture dish lid is being opened, is removing cells and supernatant, after PBS washings, remove PBS.

3) pancreatin is added in culture dish, 13min is placed in incubator.Observed at any time under microscope, see the prominent of cell Rise and disappear, become bowlder, isometric complete medium is added immediately and terminates digestion.It is careful not to digestion time long, otherwise cell It can be digested by pancreatin.

4) pipettor is gently blown and beaten after terminating, and makes it from being come off in bottle wall and being distributed to culture medium, draws cell suspension simultaneously It is transferred in EP pipes, 400xg centrifugations 3min.Be resuspended cell, and according to experiment purpose and cell habit by different proportion point ware after Continuous culture.

5) observed after passing on, pass on or change 24~48h of liquid, notice whether cell is contaminated, the cell culture fluid of pollution becomes It is visible under muddiness, mirror to have a large amount of mycelia or other suspended things.If cell growth is slow, growth characteristics change, kytoplasm endoparticle Property material increases, although nutrient solution does not become cloudy, it is considered to may have mycoplasma contamination.

2.Western Blot detect that MSC-TNF α-AB activate situation by inflammatory factor TNF α

The TNF α inflammatory factors for choosing 50 μm of oL/L concentration handle the MSC-TNF α-AB cells of logarithmic phase, are placed in light microscopic Lower observation, cell in-vitro growth is good, and cell is in fusiformis, and profile understands.In order to determine TNF α-AB expression, it have chosen MSC groups (control group), TNF α-group (not plus inflammatory factor TNF α stimulate) and TNF α+group are (plus inflammatory factor TNF α are pierced Swash) while having carried out total protein extraction.The protein extraction uses RIPA (Sigma, catalog number (Cat.No.) R0278) reagent, according to explanation Book is carried out.

Adjustment cell density is 70%-80%, and PBS washes cell twice, adds 8mL without phenol red DMEM (GIB CO, catalog number (Cat.No.) 21063-029).Albumen is collected after cell is cracked, gained cell protein passes through (BOAdford (BIO-OAD), catalog number (Cat.No.) 5000202) method is carried out after quantifying, for the experiment of conventional western blotting (immunoblotting).Detect target protein For TNF α-AB, internal reference is β-actin (Santa Cruz, catalog number (Cat.No.) SC-47778), and Western Blot results show TNF α+group TNF α-AB expression is substantially (Fig. 9).

TNF α are one of important inflammatory factors, add TNF α inflammatory factors processing MSC-TNF α-AB cells and meet inflammation The actual conditions of disease infiltration.Experiment shows that the novel cell lines transformed by the present invention are stimulated without TNF α inflammatory factors When, TNF α-AB will not be expressed.And under the stimulation of TNF α inflammatory factors, play its positive feedback regulation up-regulation TNF α-AB's Clearly, the cell line MSC-TNF α-AB of this explanation present invention reach expected experiment purpose for expression.

4th, HE dyeing identification inflammatory tissue

Mouse osteoarthritis is classical transplantation model, and the present embodiment applies the transplantation model.

1. prepare osteoarthritis inflammatory infiltration mouse model

The solution that concentration is 1mg/mL, the freund adjuvant with equivalent is made in the acetic acid that the natural collagen of purifying is dissolved in 11M Or Freund's incomplete adjuvant is mixed into stable emulsion；Intracutaneous, the injection site meeting with 1mL 4~6 injection location mouse backs of emulsion point There is aphtha (self-healing after 7~10 days)；After 21 days, in the acetic acid that 15mg collagens are dissolved in 15mL 1M, mouse peritoneal is injected It is immunized again.

After initial injection after 14~60 days, there is redness and swelling of joints, typically occur in joint distal end, metapedes ankle-joint is most normal The position of accumulation.Acute stage pathological change can be divided into for two phases, after being immunized 10 days, intra-articular only some fibre deposit and synovial membrane Cell is without change；After 12 days, the visible ankle-joint of naked eyes is red and swollen, and red and swollen, light microscopic inferior synovial membrane cytosis, stratum synoviale occurs in knee joint Number increases to 3~7 layers, and is creeped to cartilage bone face, and synovial membrane and synovial membrane the following group are woven with fiber deposition.Then see that synovial cell becomes under Electronic Speculum Circle, cell contact is reduced, and filopodia increases, and intracellular lysosome and endoplasmic reticulum increase, increased；Enter second after 19 days Phase, the synovial membrane of hyperplasia is thickened by 6~10 μm to 200~250 μm, pannus is formed, wherein having a large amount of monocytes, polymorphonuclear huge Cell, macrophage, form microabscess around capilary, it is seen that the soft tissue of monocyte intrusion cartilage junction；6~ After 7 weeks, inflammation enters chronic phase, and oedema is still suffered from, and the cell of infiltration is intra-articular scar occur based on CD+4 T cell, Granular hyperplastic tissue, cartilage and subchondral bone are destroyed, and are finally resulted in osteoarthritis and are formed.

2. transplanting detection

Respectively by 2 × 106MSC-TNF α-AB, MSC, and isometric PBS (Control groups) is transplanted to affected part.One Zhou Yihou puts to death mouse anesthesia, cervical dislocation, gathers mouse tissue, and 4% paraformaldehyde carries out routine paraffin wax embedding after fixing With HE dyeing, the preservation situation of transplantation site cell and the Infiltrating of immunocyte are observed.HE staining analysis shows, Control group inflammatory cell infiltrations are obvious.MSC-TNF α-AB groups significantly reduce the infiltration of inflammatory cell, and MSCs groups inflammation is delayed Solution situation randomly selects three sections of every Recipient mice and counts (400 times) under high power field between two groups, system Count the inflammatory cell number of Recipient mice.

As a result show, the average inflammation cell number of PBS groups infiltration organizes the flat of infiltration for 235 ± 70.4, MSC-TNF α-AB Equal inflammatory cell number is that the average inflammation cell number of 103.4 ± 29.6, MSCs groups infiltration is 112.8 ± 15.2.The as shown by data, MSC-TNF α-AB transplantation groups more obviously reduce inflammatory reaction, alleviate inflammatory symptom, have reached the expected treatment of the present invention Effect (Figure 10).

5th, inflammatory factor change detection

The present invention acquires Recipient mice spleen, and separating mouse spleen cell has carried out Spleen cell proliferation detection, and CD4+T is thin Born of the same parents, CD3+T cells, the analysis detection of TH1 and TH2 cell subsets, and conventional inflammation in inflammatory factor mRNA level in-site and serum The detection of factor protein level.

By mouse boosting cell in vitro culture 72h, before 12h is reached, 1 × BrdU is added.And carry out BrdU and MTT detections. As a result as shown in figure 11, in the optical density (OD values) that (A) obtains for the 450nm wavelength of progress BrdU detections in Figure 11, Figure 11 (B) To carry out the optical density (OD values) that the 570nm wavelength of MTT detections is obtained.As a result show：In terms of cell propagation, Control groups Substantially, MSC-TNF α-AB groups have relatively low propagation level to proliferation of inflammatory cells, and MSC groups are between the two.This shows MSCs-TNF AB can effectively suppress the proliferative conditions (Figure 11) of inflammatory cell.

The subgroup change of present invention analysis detection splenocyte kind T cell.Detection find, MSC-TNF α-AB group treatment by Body mouse boosting cell kind Th cells and Th2 and entirety CD4+T cell subsets ratios are substantially reduced, and are as a result represented, MSC-TNF α-AB treatments substantially inhibit T cell number in Mice Body, reduce Th1 cells and Th2 cell subsets ratios

In order to further determine that the expression of inflammatory cell, dropped present invention detects whether the ratio of overall T cell Low, CD3 is the surface marker of T cell, the present invention have detected treated mouse boosting cell CD3+ T cell ratio and FOXp3 regulatory T cells (Treg).As a result show, MSC-TNF α-AB group CD3T cell proportions are substantially reduced, by 23.1% Drop to 17.4%, Treg ratios substantially to rise, 4.32% is risen to by 2.9%.Result above shows, MSC-TNF α-AB energy It is enough effectively to suppress T cell ratio, promote regulatory T cells increase.In addition the present invention passes through Real-timePCR and elisa technique Conventional inflammatory factor interleukin-22 (IL-2), IL-4 (IL-4), IL-10, interferon in spleen and serum are have detected respectively (IFN-γ), transforming growth factor-β (TGF-β) and Foxp3 expression；That is (A) is to be detected using elisa technique in Figure 12 (B) is to detect that (C) is to utilize ELISA in obtained IL-4 concentration, Figure 12 using elisa technique in the IL-2 concentration arrived, Figure 12 (D) is that obtained IFN-γ concentration, Tu12Zhong are detected using elisa technique in the IL-10 concentration that technology for detection is obtained, Figure 12 (E) it is that obtained Foxp3 concentration is detected using elisa technique.ELISA experiments use kit (USCN, catalog number (Cat.No.) E91866Mu), carry out to specifications.Wherein IL-2, IFN-γ is the TH1 cellular inflammation factors, and TGF-β can effectively facilitate T Cell breaks up to Treg and induces Treg to express Foxp3 and IL-10.Detection finds that MSC-TNF α-AB inhibit IL- in serum 2, IL-4 expression, promotes IL-10, the expression (Figure 12) of IFN-γ and TGF-β 1.

In mRNA level in-site, MSC-TNF α-AB groups inhibit IL-2, IL-4 expression, promote IL-10, Foxp3 and The expression (Figure 13) of TGF-β 1.Specifically, (A) is IL-2 relative mRNA level in-site in Figure 13, (B) is the relative of IL-4 in Figure 13 (C) is IL-10 relative mRNA level in-site in mRNA level in-site, Figure 13, and (D) is Foxp3 relative mRNA level in-site, Tu13Zhong in Figure 13 (E) be IFN-γ relative mRNA level in-site, in Figure 13 (A) be in IL-2 relative mRNA level in-site, Figure 13 (A) for TGF-β 1 phase To mRNA level in-site.

Result above shows that MSC-TNF α-AB treat the expression and release for inhibiting proinflammatory inflammation factor, promotes suppression inflammation The expression and release of the factor.

As a kind of novel stem cells treatment method, the novel cell lines MSC-TNF α-AB that the present invention is built can substantially subtract Slow inflammatory reaction and suppression the inflammation factor, is that the inflammatory infiltration reaction of osteoarthritis serves effective mitigation.

Reagent needed for above-mentioned experiment is shown in Table 1.

The slow virus packaging plasmid of table 1 and shuttle plasmid information

293FT and mouse bone marrow cells MSC medium components are shown in Table 2 in above-mentioned experiment.

The slow virus of table 2 prepares and the required reagent information of MSC infection

293FT and mouse bone marrow cells MSC medium components are shown in Table 3 in above-mentioned experiment.

The 293FT cells of table 3 and mouse bone marrow cells MSC culture medium prescriptions

Compared with prior art, a kind of promoter provided by the present invention, the sequence such as SEQ ID NO of the promoter:2 It is shown.The promoter positive activation can express TNF Alpha antibodies genes in the presence of inflammatory factor TNF α, utilize this Promoter can be obtained for treating osteoarthritis and the good restructuring interstital stem cell of therapeutic effect.

The present invention also provides a kind of preparation method for recombinating interstital stem cell, including：There is provided TNF Alpha antibodies gene and above-mentioned Promoter, structure obtain slow virus expression plasmid；Wherein, the sequence of the TNF Alpha antibodies gene such as SEQ ID NO:1 institute Show；The slow virus expression plasmid is subjected to slow virus packaging, virus liquid is obtained；Mesenchyma is infected in the virus liquid dry thin Born of the same parents, obtain required restructuring interstital stem cell.Restructuring interstital stem cell is prepared using above-mentioned promoter, the restructuring interstitial is done Cell can be activated under inflammatory environment by inflammatory factor TNF α, can be stably coupled to inflammation sites, be done so as to strengthen mesenchyma The anti-inflammatory and immunoregulation capability of cell, thus can be used to treat osteoarthritis and therapeutic effect is good.

It is further that the structure of the slow virus expression plasmid includes：Step S11：By the TNF Alpha antibodies gene and The promoter is cloned into shuttle plasmid pGFP, obtains shuttle plasmid TNF α-GFP；Step S12：With the shuttle plasmid TNF α-GFP add the TNF Alpha antibodies gene and obtain TNF α-AB plasmid vectors as carrier；Step S13：Convert the TNF α-AB plasmid vectors simultaneously carry out plasmid extraction and obtain the slow virus expression plasmid.By by TNF Alpha antibodies gene and promoter Clone into shuttle plasmid pGFP, and using the shuttle plasmid TNF α-GFP of acquisition as carrier, add TNF Alpha antibodies genes, so that TNF α-AB the plasmid vectors containing TNF Alpha antibodies gene and promoter stablized；And the promoter can be allowed to work And expression TNF Alpha antibodies genes.

It is further that the TNF Alpha antibodies gene in the step S12 is by using in endonuclease Xho1 and nucleic acid Enzyme cutting Xba1 carries out double digestion to the shuttle plasmid TNF α-GFP and obtained.Obtained using the shuttle plasmid TNF α-GFP TNF Alpha antibodies genes, it is ensured that the uniformity of TNF Alpha antibodies genes used in whole preparation process, so as to ensure final institute The stability of the restructuring interstital stem cell obtained.And according to shuttle plasmid TNF α-GFP gene order, restriction endonuclease is entered Row selection, i.e., carry out double digestion from endonuclease Xho1 and endonuclease Xba1, so as to ensure to obtain complete and stably TNF Alpha antibodies genes.

It is further that the time of the double digestion is 3-24h.It so can guarantee that the effect of digestion, i.e. digestion are complete.

It is further that the step S12 is to be connected using TNF Alpha antibodies gene and shuttle plasmid TNF α-GFP It is reversed to answer, obtain TNF α-AB plasmid vectors；Shuttle plasmid TNF α's-GFP described in the reaction system of the coupled reaction is dense Spend for 2-3ng/ μ L, the TNF Alpha antibodies gene molal quantity is 2-4 times of the shuttle plasmid TNF α-GFP molal quantitys.Pass through Determine between shuttle plasmid TNF α-GFP concentration and TNF Alpha antibodies gene and shuttle plasmid TNF α-GFP molal quantity Amount ratio, the coupled reaction is relatively stable, and can effectively reduce the impurity in reaction product.

Being further that the step S12 is additionally included in reaction system adds DNA ligase and connection buffer solution；Institute The percent by volume for stating DNA ligase in reaction system is 2-3%, and the percent by volume of connection buffer solution is 8-12%.Pass through Determine DNA ligase and connect the percent by volume of buffer solution, it is ensured that the rapidity and stability of reaction.

It is further to convert the TNF α-AB plasmid vectors to be：TNF α-AB the plasmid vectors are added into large intestine In bacillus DH5 α competent cells, mixed solution is obtained after being well mixed；By mixed solution ice bath 20-50min, through 40-45 DEG C heat shock effect 30-90s under zero degree environment after cooling down 1-4min；Then mixed solution is placed in culture medium and cultivated, obtained To the nutrient solution containing the slow virus expression plasmid.First, by selecting bacillus coli DH 5 alpha competent cell, both it can guarantee that The expression of TNF α-AB plasmid vectors, and the conversion of TNF α-AB plasmid vectors will not be adversely affected.Secondly, pass through By heat shock after mixed solution ice bath 20-50min, the operation of 1-4min on ice is and then placed in, it is ensured that transformation efficiency.

The present invention also provides a kind of restructuring interstital stem cell, is integrated with promoter and TNF Alpha antibodies genes；The promoter Sequence such as SEQ ID NO:Shown in 2, the sequence such as SEQ ID NO of the TNF Alpha antibodies gene:Shown in 1.The restructuring interstitial is done Promoter and TNF Alpha antibodies genes are integrated with cell, can be activated under inflammatory environment by inflammatory factor TNF α, can be stably Inflammation sites are attached to, so as to strengthen the anti-inflammatory and immunoregulation capability of mescenchymal stem cell, thus can be used to treat Bones and joints It is scorching and therapeutic effect is good.

The present invention also provides a kind of application for recombinating interstital stem cell, and above-mentioned restructuring interstital stem cell is used to prepare and treated The medicine of osteoarthritis.The effect of resulting drug therapy osteoarthritis is good.

The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all originals in the present invention Any modification made within then, equivalent substitution and improvement etc. all should be comprising within protection scope of the present invention.

Sequence table

<110>Zhong Jihengrun International Holdings Ltds

<120>Promoter, restructuring interstital stem cell and its preparation method and application

<150>HK16105540.6

<151>2016-05-16

<160>6

<210>1

<211>465

<212>DNA

<213>Artificial sequence

<400>1

atgctacgctcttcgtcccagaactcatcggataagcctgtcgcgcacgtggtagccaat 60

caccaagtggaagagcagctagagtggctctcgcaacgcgccaatgcgctactggctaac 120

ggtatggacctgaaggacaatcaactggtagttccggcagacggtctatacctggtatac 180

tccaggtgcttttcaagggacaaggttgccctgactatgtgctgctaacgcacactgttt 240

cacggttcgctatttcgtaccaggaaaaggttaacctgctatccgcggttaaatccccgt 300

gcccaaaggacactcccgaaggggcggaacttaagccttggtacgaacctatttacctgg 360

gtggagttttccaacttgaaaaaggcgaccagctttcagccgaagtaaatcttcccaagt 420

catcaagtgtatcatatgccaagtacgccccctattgacgtcaatg 465

<210>2

<211>707

<212>DNA

<213>Artificial sequence

<220>

<223>Promoter

<400>2

tgggatctga gcttcttcgt gaaacacggg gcagaggagg caccagaact ctcctctgac 60

caactgcccc acagcacaca tatcctcaaa ggatagtctt gaatacgtga tggaagaatt 120

aaagagagtg aggtctgaag aaaatcagcc ctctcggggt ttcctttggg taactgagtg 180

ctaaggtgac ttccgagtca gcaagaaata tcggacgttc aacccaggtt gagtggagga 240

aacaattatt tctcaatcct aatatgttct ggaatagccc atttatccac gtcattatga 300

cctgggagtg cgtgaatgga atccacagat gagggcctct gtacatagaa cagctgtctg 360

cctcaggaaa tacaactttt agtattgaga agctaaaaag aaaaaaaaat taaaagagag 420

gtagcccata ctaaaaatag ctgtaatgca gaagttcatt ccgaccagtt ctttagcgct 480

tacaatgcaa aaaaaaggga aaggaaaaaa aaaaagaaag aaattaaact caaaaattgc 540

atggtttaga agagggagga ggagcctgaa taacaaaaac ctttgccagg aaggccccac 600

tgagccttca gtataaaagg gggaccaaga acaggaggtc tacatttaga gacttgctct 660

tgcactacca aagccacaag gcagccttgc agaaaagaga gctccat 707

<210>3

<211>18

<212>DNA

<213>Artificial sequence

<400>3

gctagagtggctctcgca 18

<210>4

<211>18

<212>DNA

<213>Artificial sequence

<400>4

cgaaggggcggaacttaa

18

<210>5

<211>20

<212> DNA

<213>Artificial sequence

<400>5

agagggaaatcgtgcgtgac 20

<210>6

<211>20

<212>DNA

<213>Artificial sequence

<400>6

tgctggaaggtggacagtgag 20

Claims

1. a kind of promoter, it is characterised in that：The sequence of the promoter such as SEQ ID NO:Shown in 2.

2. a kind of preparation method for recombinating interstital stem cell, it is characterised in that：Including：TNF Alpha antibodies gene is provided and right will The promoter described in 1 is sought, structure obtains slow virus expression plasmid；Wherein, the sequence of the TNF Alpha antibodies gene such as SEQ ID NO:Shown in 1；

The slow virus expression plasmid is subjected to slow virus packaging, virus liquid is obtained；

Mescenchymal stem cell is infected in the virus liquid, required restructuring interstital stem cell is obtained.

3. the preparation method of interstital stem cell is recombinated as stated in claim 2, it is characterised in that：The slow virus expression plasmid Structure include：

Step S11：The TNF Alpha antibodies gene and the promoter are cloned into shuttle plasmid pGFP, shuttle plasmid TNF is obtained α-GFP；

Step S12：Using the shuttle plasmid TNF α-GFP as carrier, add the TNF Alpha antibodies gene and obtain TNF α-AB Plasmid vector；

4. the preparation method of interstital stem cell is recombinated as claimed in claim 3, it is characterised in that：The TNF Alpha antibodies gene Double digestion is carried out by using endonuclease Xho1 and endonuclease Xba1 to the shuttle plasmid TNF α-GFP to obtain.

5. the preparation method of interstital stem cell is recombinated as claimed in claim 4, it is characterised in that：The time of the double digestion is 3-24h。

6. the preparation method of interstital stem cell is recombinated as claimed in claim 3, it is characterised in that：The step S12 is utilization TNF Alpha antibodies gene and shuttle plasmid TNF α-GFP are attached reaction, obtain TNF α-AB plasmid vectors；The connection The concentration of shuttle plasmid TNF α-GFP described in the reaction system of reaction is 2-3ng/ μ L, the TNF Alpha antibodies gene molal quantity For 2-4 times of the shuttle plasmid TNF α-GFP molal quantitys.

7. the preparation method of interstital stem cell is recombinated as recited in claim 6, it is characterised in that：The step S12 also includes DNA ligase and connection buffer solution are added in reaction system；The percent by volume of DNA ligase is 2- in the reaction system 3%, the percent by volume of connection buffer solution is 8-12%.

8. the preparation method of interstital stem cell is recombinated as claimed in claim 3, it is characterised in that：Convert the TNF α-AB matter Grain carrier specifically includes following steps：TNF α-AB the plasmid vectors are added in bacillus coli DH 5 alpha competent cell, mixed Mixed solution is obtained after closing uniformly；By mixed solution ice bath 20-50min, ice again after acting on 30-90s through 40-45 DEG C of heat shock Bathe 1-4min；Then mixed solution is placed in culture medium and cultivated, obtain the nutrient solution containing the slow virus expression plasmid.

9. one kind restructuring interstital stem cell, it is characterised in that：It is integrated with promoter and TNF Alpha antibodies genes；The promoter Sequence such as SEQ ID NO:Shown in 2, the sequence such as SEQ ID NO of the TNF Alpha antibodies gene:Shown in 1.

10. a kind of application for recombinating interstital stem cell, it is characterised in that：By the restructuring interstital stem cell described in claim 9 Medicine for preparing treatment osteoarthritis.