CN107987147A

CN107987147A - A kind of MG53 polymers preparation method and its usage

Info

Publication number: CN107987147A
Application number: CN201610950773.5A
Authority: CN
Inventors: 王惠琴
Original assignee: 王惠琴
Current assignee: Mudanjiang Youbo Pharmaceutical Co Ltd
Priority date: 2016-10-26
Filing date: 2016-10-26
Publication date: 2018-05-04

Abstract

The present invention provides the polymer of MG53 polymers and MG53 mutant, while also provides its of the polymer of these MG53 polymers or MG53 mutant and prepare purification process.The polymer of this MG53 polymers or MG53 mutant is mainly made of MG53 dimers.Research is found, the polymer of these MG53 polymers or MG53 mutant can be used for prevention or treatment and cell membrane damage relevant disease, for example, with myocardial cell injury relevant disease, with ulcer relevant disease, the wound with wound particularly Hard agglut wound, intestines leakage and kidney injury etc..

Description

A kind of MG53 polymers preparation method and its usage

Invention field

The present invention relates to MG53 polymers or the polymer and their preparation method of MG53 mutant.The application at the same time The polymer for further relating to the MG53 polymers or MG53 mutant is preventing or is treating and the use in cell membrane damage relevant disease On the way, for example, with myocardial cell injury relevant disease, with ulcer relevant disease, have wound particularly Hard agglut wound wound, Intestines leakage and kidney injury etc..With the relevant disease of myocardial cell injury may include selected from one in the relevant disease of following symptom Kind is a variety of：Myocardial ischemia, heart ischemia/reperfusion injury, miocardial infarction, heart failure, arrhythmia cordis and cardiac rupture etc..With Ulcer relevant disease includes the one or more selected from following disease：Chronic ulcer, peptic ulcer, diabetic foot ulcer, sugar Urinate foot disease gangrene and chronic gastric ulcer.The one or more of disease are selected from injury of kidney relevant disease：Nephrotic syndrome, kidney Preceding property, renal and postrenal acute injury of kidney, chronic renal failure.

Compared to MG53 monomers, the polymer of MG53 polymers or MG53 mutant is can preferably cardioprotection, treatment Caused by cell death while heart disease, it is thus also avoided that the same MG53 with cardioprotective effects at the same time with pancreas islet The side effect of element resistance, fat, diabetes and metabolic syndrome.And relative to MG53 monomers, this MG53 polymers or The polymer of MG53 mutant is in ulcer, especially chronic ulcer and peptic ulcer, such as diabetic foot ulcer, diabetes It is more efficient in the treatment of gangrene and chronic gastric ulcer.

Background of invention

MG53 is skeletal muscle specificity albumen mitsugumin53, abbreviation MG53 or TRIM72.MG53 is that a kind of muscle is special Different in nature tripartitemotiffamily (TRIM) family protein.The family protein often contains three specific motif structures, claims respectively For RING, B-BOX and frizzled domain (Coiled coil domains).Their collective effects are incorporated in what cell no longer needed On protein, by ubiquitin tag on these protein belts to degrade.MG53 is also the important composition portion of cell membrane repair mechanism Point.

In terms of medical application, MG53 treatments are received and are these as caused by Apoptosis the effect of heart disease Known to field technology personnel.MG53 can produce protective effect to heart, that is to say, that can be by increasing the content of MG53 Cardioprotection damages.But MG53 increases content at the same time there is very important and be considered as a counter productive endangered greatly MG53 while cardioprotection, insulin resistance, obesity, diabetes and metabolic syndrome can be caused.That is MG53 While cardioprotection, with side effects such as insulin resistance, obesity and diabetes.This side effect is of concern in the industry And it is undesirable, so far without solution channel.

Studies have shown that with cell interior MG53 is existed with monomer under field conditions (factors), and MG53 polymers are ground Study carefully fewer.

Summary of the invention

The present invention provides the polymer and their preparation method of MG53 polymers or MG53 mutant.This MG53 polies The polymer of body or MG53 mutant is expressed by eukaryotic cells.The polymer of this MG53 polymers or MG53 mutant Mainly it is made of the form of MG53 dimers.Research finds that the polymer of this MG53 polymers or MG53 mutant can be used for Prevention or treatment with cell membrane damage relevant disease, such as with myocardial cell injury relevant disease, with ulcer relevant disease, have Wound, intestines leakage and kidney injury of wound particularly Hard agglut wound etc..It may include to select with the relevant disease of myocardial cell injury From with the one or more in the relevant disease of following symptom：Myocardial ischemia, heart ischemia/reperfusion injury, miocardial infarction, mental and physical efforts Exhaustion, arrhythmia cordis and cardiac rupture etc..Include the one or more selected from following disease with ulcer relevant disease：It is chronic to burst Ulcer, peptic ulcer, diabetic foot ulcer, diabetic foot ulcers, diabetic foot gangrene and chronic gastric ulcer etc..

Especially, it is found by the applicant that compared to MG53 monomers, the polymer of MG53 polymers or MG53 mutant is can be more Well caused by cardioprotection, treatment cell death while heart disease, moreover it is possible to avoid the MG53 with cardioprotective effects Monomer at the same time with insulin resistance, obesity, diabetes and metabolic syndrome side effect.Also, compared to MG53 monomers, The polymer of MG53 polymers or MG53 mutant is in ulcer, such as chronic ulcer, peptic ulcer, diabetic foot ulcer, sugar It is more efficient in the treatment of the sick leg ulcer of urine, diabetic foot gangrene and chronic gastric ulcer.

MG53 can produce protective effect to heart, that is to say, that can be damaged by increasing the content protection heart of MG53 Wound.But find afterwards, the MG53 of incrementss while cardioprotection, insulin resistance, obesity, diabetes and generation can be caused Thank to syndrome.That is MG53 is while cardioprotection, with insulin resistance, obesity, diabetes and metabolic syndrome Side effect.To promote the optimization of MG53 protein functions, the application carries out substantial amounts of research work and MG53 albumen is optimized, One of purpose is intended to do not causing the premises such as the side effect of insulin resistance, obesity, diabetes and metabolic syndrome Under, MG53 albumen is retained Cardioprotective function, but be not accompanied by corresponding side effect.

The present invention provides a kind of MG53 polymers, wherein the mainly form composition of MG53 dimers.

The present invention also provides a kind of polymer of MG53 mutant, it is characterised in that the polymer of the MG53 mutant is Any one or two or more cysteine mutations in 7 cysteines of RING domains of the N-terminal of MG53 are non- The mutant of polar amino acid；7 cysteines be respectively the 14th site of RING domains, the 17th site, the 29th Point, the 34th site, the 37th site, the 53rd site, the 56th site.

Preferably, the polymer of the mutant of this MG53 mutant is mainly made of the form of MG53 dimers.

In one embodiment, in the polymer of this mutant, 7 half Guangs of RING domains of the N-terminal of MG53 Any one or two or more cysteine mutations in propylhomoserin is specially alanine, sweet ammonia into nonpolar amino acid Acid, valine, leucine, isoleucine, proline, phenylalanine, tryptophan or methionine.Preferably, the nonpolar ammonia Base acid is alanine, glycine, leucine, proline, valine or isoleucine.

It is highly preferred that in the polymer of the mutant of this MG53 mutant, the nonpolar amino acid is alanine, It is more that the polymer of the MG53 mutant is selected from MG53 polymer C14A, MG53 polymer C17A, MG53 polymers C29A, MG53 Any one in aggressiveness C34A, MG53 polymer C37A, MG53 polymer C53A, MG53 polymer C56A.

In another aspect, the present invention provides a kind of polymer of MG53 mutant, wherein in the Coiled- of MG53 albumen Mutant serine in coil domains is the amino acid in addition to threonine and tyrosine.In one embodiment, Mutant serine in Coiled-coil domains is nonpolar amino acid.

In one embodiment, in the polymer of this MG53 mutant, the silk ammonia in Coiled-coil domains Acid mutation is nonpolar amino acid, and the nonpolar amino acid is alanine, glycine, valine, leucine, different bright ammonia Acid, proline, phenylalanine, tryptophan or methionine.Preferably, nonpolar amino acid for alanine, glycine, leucine, Proline, valine and isoleucine.Most preferably, which is alanine.

In one embodiment, it is described when nonpolar amino acid is alanine in the polymer of MG53 mutant MG53 mutant is selected from any one in MG53 polymer S150A, MG53 polymer S189A, MG53 polymers S211A It is or a variety of.

In most of insulin target organs, people have seen clearly the substantially skeleton structure of insulin signaling network substantially, That is IR/IRSs-PI3K-Akt paths；However, the specific molecular mechanism for influencing this signal pathway, the research of people is at present but It is at the early-stage.MG53 can effectively ubiquitination insulin receptor (IR) and substrate 1 (IRS1), MG53 therein RING domains, the cysteine of the 14th particularly on amino acid sequence, IR and IRS1 ubiquitinations are catalyzed for MG53 It is required (CN103965342A).Currently used for treat ulcer, especially chronic ulcer of skin existing medicine effect all It is not ideal.Although prompting includes the composition of MG53 in some documents, such as CN103275980A and CN101511181B It is possibly used for treatment ulcer.But the experimental study of MG53 treatment ulcer is not carried out in the prior art.

Present invention design and the multiple Codon sequences and signal peptide sequence for optimizing MG53, pass through gene chemical synthesis, Ya Ke Grand, transfection, expression and purifying generate a kind of MG53 polymers (N >=2), and wherein MG53 mainly exists with dimeric forms.Shen Ask someone find MG53 polymers be significantly higher than natural MG53 albumen (monomer) to the ability of cell membrane reparation, and will not cause or Person induces lipid metaboli and glycometabolism syndrome.

In addition, present invention also offers the polymer of above-mentioned MG53 mutant, similar to MG53 polymers, this MG53 dashes forward The polymer of variation is significantly higher than the ability of cell membrane reparation natural MG53 albumen (monomer), and will not cause or induce Lipid metaboli and glycometabolism syndrome.

In one embodiment, the polymer of above-mentioned MG53 polymers or MG53 mutant provided by the invention compared to MG53 monomers, can preferably cardioprotection, avoid insulin caused by the same MG53 monomers with cardioprotective effects The side effect of resistance, fat, diabetes and metabolic syndrome.And compared to MG53 monomers, these MG53 polymers or MG53 The polymer of mutant is in ulcer, such as chronic ulcer, peptic ulcer, diabetic foot ulcer, diabetic foot ulcers, glycosuria More significant effect is achieved in the treatment of foot disease gangrene and chronic gastric ulcer.

In one embodiment, the category kind of the sequence of the polymer of MG53 polymers or MG53 mutant includes primate Animal, rat and mouse.

In one embodiment, this application provides a kind of method for preparing MG53 polymers, it comprises the following steps：

A. MG53 genes are connected to acquisition MG53 expression plasmids in expression vector, are preferably connected in the MG53 genes The MG53 genes are connected with signal peptide before to expression vector；

B. expression connects the MG53 expression plasmids of acquisition to produce MG53 polymers in the step a in eukaryotic Albumen.

In one embodiment, MG53 genes, this MG53 bases are obtained by codon optimization wild type MG53 genes Because can be used for the method for preparing MG53 polymers in the application, so as to express MG53 polymers preferably in eukaryotic. In a preferred embodiment, optimized MG53 genes have such as SEQ ID NO:Nucleotide sequence shown in 7.One In a preferred embodiment, the signal peptide has such as SEQ ID NO:Nucleotide sequence shown in 12.It is preferable at one In embodiment, MG53 expression plasmids have such as SEQ ID NO:Nucleotide sequence shown in 19.Preferably MG53 expression plasmids The polypeptide of coding has such as SEQ ID NO:Amino acid sequence shown in 25.

In a preferred embodiment, the above-mentioned method for preparing MG53 polymers is further included using chromatography such as Q-HP The MG53 multimeric proteins that column chromatography and the purifying of Mono Q column chromatographies produce in the step b.Preferably, in Q-HP column chromatographies In, be 20mM Tris, pH 8.5 with reference to liquid A, eluent B is 20mM Tris and 1.0M NaCl, pH 8.5, optionally with A and Eluent B is solution and/or the eluent B elutions of 5% (volume ratio) in the mixture of B, preferably with the mixture of A and B Eluent B is that the solution of 20% (volume ratio) elutes.In another preferred embodiment, in Mono Q column chromatographies, knot It is 20mM phosphate buffers (PB) to close liquid A, and pH 7.0, eluent B are 20mM phosphate buffers (PB) and 1.0M NaCl, PH 7.0, is optionally washed with the solution and/or the mixture of A and B that eluent B in the mixture of A and B is 10% (volume ratio) The solution for the gradient that de- liquid B is 10%-30% (volume ratio) and/or eluent B elutions.

In one embodiment, using eukaryotic such as Chinese hamster ovary cell (CHO), COS or HEK293-F (HEK293-FreeStyle) the MG53 polymers of the expression such as cell the application.

In one embodiment, in the method for preparing MG53 polymers, MG53 genes are being connected to expression vector Before, the MG53 genes are connected in cloning vector and are expanded, is preferably connected in the MG53 genes with signal peptide Afterwards, the MG53 genes are connected in cloning vector and are expanded.Preferably, cloning vector is pUC57, M13mp18/19 (RF) carrier, pALTER-1 carriers, pALTER-Ex1 carriers, pGEM-3Z carriers, pGEM-3Zf (+/-) carrier, pGEM-4Z are carried Body, pGEM-5Zf+/- carrier or pGEM-7Zf+/- carrier.In another embodiment, by MG53 genes and expression vector example As pGenHT10, Okayama-Berg cDNA expression vectors pcDV1 (Pharmacia), pCDM8, pRc/CMV, pcDNA1, PcDNA3 (Invitrogene) or pSPORT1 (GIBCO BRL) etc. are connected.

In yet another aspect, the present invention provides prepare the application MG53 mutant polymer method, it includes Following steps：

A. MG53 genes are mutated, obtain MG53 mutant genes；

B. MG53 mutant genes are connected to acquisition MG53 mutant expression plasmids in expression vector, preferably described The MG53 mutant genes are connected by MG53 mutant genes before being connected to expression vector with signal peptide；

C. expression connects the MG53 mutant expression plasmid of acquisition to obtain MG53 in the step b in eukaryotic The multimeric protein of mutant.In one embodiment, in the method for the polymer of MG53 mutant of the application is prepared, Wherein described MG53 genes are obtained by codon optimization wild type MG53 genes, preferably described optimized MG53 bases Because having such as SEQ ID NO:Nucleotide sequence shown in 7.

Preferably, in the method for the polymer of MG53 mutant of the application is prepared, the signal peptide has such as SEQ ID NO:Nucleotide sequence shown in 12.

In one embodiment, in the method for the polymer of MG53 mutant of the application is prepared, use is further included The polymer egg for the MG53 mutant that chromatography such as Q-HP column chromatographies and the purifying of Mono Q column chromatographies produce in the step c In vain.

Preferably, in the method for the polymer of MG53 mutant of the application is prepared, in the Q-HP column chromatographies, knot Close liquid A：20mM Tris, pH 8.5, eluent B：20mM Tris and 1.0M NaCl, pH 8.5, optionally with the mixing of A and B Eluent B is solution and/or the eluent B elutions of 5% (volume ratio) in thing.

Preferably, in the method for the polymer of MG53 mutant of the application is prepared, in the Mono Q column chromatographies, It is 20mM phosphate buffers (PB) with reference to liquid A, pH 7.0, eluent B are 20mM phosphate buffers (PB) and 1.0M NaCl, pH 7.0, optionally with the mixing for the solution and/or A and B that eluent B in the mixture of A and B is 10% (volume ratio) Eluent B is solution and/or the eluent B elutions of the gradient of 10%-30% (volume ratio) in thing.

In one embodiment, in the method for the polymer of MG53 mutant of the application is prepared, wherein described true Nucleus is Chinese hamster ovary cell (CHO), COS or HEK293-F (HEK293-FreeStyle) cell.

In a preferred embodiment, in the method for the polymer of MG53 mutant of the application is prepared, by institute MG53 mutant genes are stated to be connected to before the expression vector, by the MG53 mutant genes be connected in cloning vector into Row amplification, preferably after the MG53 mutant genes are connected with signal peptide, the MG53 mutant genes are connected to Expanded in cloning vector.Preferably, in the method for the polymer of MG53 mutant of the application is prepared, the expression carries Body is pGenHT10, Okayama-Berg cDNA expression vectors pcDV1 (Pharmacia), pCDM8, pRc/CMV, pcDNA1, PcDNA3 (Invitrogene) or pSPORT1 (GIBCO BRL).It is highly preferred that preparing the more of the MG53 mutant of the application In the method for aggressiveness, the cloning vector is pUC57, M13mp18/19 (RF) carrier, pALTER-1 carriers, pALTER-Ex1 loads Body, pGEM-3Z carriers, pGEM-3Zf (+/-) carrier, pGEM-4Z carriers, pGEM-5Zf+/- carrier or pGEM-7Zf+/- carry Body.

In one aspect, this application provides the drug regimen of the polymer comprising MG53 polymers or MG53 mutant Thing.Preferably, pharmaceutically useful excipient or carrier are included in the pharmaceutical composition.

In another aspect, the MG53 polymers or the polymer of MG53 mutant that the application provides are used for available for preparation Prevention and/or treatment and the pharmaceutical composition of cell membrane damage relevant disease.

In one embodiment, the one or more selected from following disease are included with cell membrane damage relevant disease：With Myocardial cell injury relevant disease, the wound with ulcer relevant disease, with wound particularly Hard agglut wound, intestines leakage and kidney Damage.

In a preferred embodiment, include to the relevant disease of myocardial cell injury selected from related with following symptom Disease in one or more：Myocardial ischemia, heart ischemia/reperfusion injury, miocardial infarction, heart failure, arrhythmia cordis and Cardiac rupture etc..

In a preferred embodiment, the one or more selected from following disease are included with ulcer relevant disease：Slowly Property ulcer, peptic ulcer, diabetic foot ulcer, diabetic foot ulcers, diabetic foot gangrene and chronic gastric ulcer etc..

In one aspect, this application provides the MG53 polymers comprising MG53 monomers or the application or MG53 mutant Dry powder formulations of polymer and preparation method thereof.In one embodiment, the MG53 comprising MG53 monomers or the application is prepared The method of the dry powder formulations of the polymer of polymer or MG53 mutant comprises the following steps：

(1) auxiliary material is dissolved, and by its polymer with the MG53 polymers or MG53 mutant of MG53 monomers or the application Solution mixes, and adjustment pH value to 6.5-8.0, obtains the protein solution for including 0.1-2.0mg/ml；

Comprising 0.5-2mg/ml described in (2) being freeze-dried by filtration sterilization and under the conditions of suitable freeze-drying The poly liquid solution of the MG53 polymers or MG53 mutant of MG53 monomers or the application obtains dry powder formulations.

In one embodiment, auxiliary material includes and is selected from following one or more：Polyol, carbohydrate, surface Activating agent and polymer.

In a preferred embodiment, polyol includes and is selected from following one or more：Glycerine, sweet dew Alcohol, sorbierite, inositol and polyethylene glycol.

In a preferred embodiment, carbohydrate includes and is selected from following one or more：Sucrose, glucose, lactose, Trehalose, mannose and maltose.

In a preferred embodiment, surfactant includes and is selected from following one or more：Tween80, ten Sodium dialkyl sulfate.

In a preferred embodiment, polymer includes and is selected from following one or more：Polyethylene glycol, polyethylene Compare pyrrolidone.

In a preferred embodiment, auxiliary material is mannitol, histidine, sucrose.It is highly preferred that including 0.5mg/ 50mg/ml mannitol, 25mg/ml sucrose and 25mg/ml histidines are included in the solution of ml protein.It is preferable real at another Apply in scheme, auxiliary material is sucrose, mannitol and Tween-80.

In a preferred embodiment, suitable freeze-drying condition is：

(1) pre-freeze is kept for 2 hours to -45 DEG C, forvacuum to 12 ± 2Pa,

- 6 DEG C are warming up within (2) 90 minutes, is kept for 10 hours,

(3) 1 are warming up to 15 DEG C, when holding 5 is small when small,

(4) it is further dried.

In one aspect, this application provides the MG53 polymers comprising MG53 monomers or the application or MG53 mutant Hydro-acupuncture preparation of polymer and preparation method thereof.

In one embodiment, the more of the MG53 polymers comprising MG53 monomers or the application or MG53 mutant are prepared The method of the hydro-acupuncture preparation of aggressiveness comprises the steps of：

(1) the MG53 monomers or the MG53 polymers of the application or the polymer of MG53 mutant freezed with solvent dissolving,

(2) pH value is adjusted, and is filtered,

(3) seal and sterilize, so that the MG53 polymers comprising MG53 monomers or the application or MG53 mutant be made The hydro-acupuncture preparation of polymer.In one embodiment, solvent is medicine common solvent, preferably water, such as water for injection or life Manage brine.

In one aspect, this application provides the MG53 polymers comprising MG53 monomers or the application or MG53 mutant Spray agent of polymer and preparation method thereof.In one embodiment, the MG53 comprising MG53 monomers or the application is prepared The method of the spray agent of the polymer of polymer or MG53 mutant comprises the following steps：

(1) MG53 monomers or the MG53 polymers of the application or the polymer of MG53 mutant are freezed,

(2) the lyophilized MG53 monomers or the MG53 polymers of the application or the poly of MG53 mutant are dissolved with solvent Body, to be configured to include 50ng-100 μ g/ml MG53 monomers or the MG53 polymers of the application or the polymer of MG53 mutant Spray agent.In one embodiment, solvent is medicine common solvent, preferably water, such as purified water or physiological saline.

In one aspect, this application provides the MG53 polymers comprising MG53 monomers or the application or MG53 mutant Gel preparation of polymer and preparation method thereof.In one embodiment, the MG53 comprising MG53 monomers or the application is prepared The method of the gel preparation of the polymer of polymer or MG53 mutant comprises the following steps：

(2) the lyophilized MG53 monomers or the MG53 polymers of the application or the poly of MG53 mutant are dissolved with solvent Body, is configured to gel solvent.

In one embodiment, solvent is that polyox-yethylene-polyoxypropylene block copolymer or carbomer, glycerine, shell gather The mixture of sugar and ethylparaben.In a preferred embodiment, polyox-yethylene-polyoxypropylene block copolymer be The polyox-yethylene-polyoxypropylene block copolymer of such as 4-8 DEG C preservation of low temperature.

In one aspect, this application provides the MG53 polymers comprising MG53 monomers or the application or MG53 mutant Emulsion of polymer and preparation method thereof.In one embodiment, the MG53 polies comprising MG53 monomers or the application are prepared The method of the emulsion of the polymer of body or MG53 mutant comprises the following steps：

(2) the MG53 polymers or MG53 mutant of the lyophilized MG53 monomers or the application are dissolved with chitosan solution Polymer, adds emulsion bases and glycerine, is configured to emulsion.In a preferred embodiment, emulsion bases includes tristearin Acid, glycerin monostearate, albolene, Tween-80, G ＆ W etc..

In particular it relates to following aspect：

1. mitsugumin 53 (MG53) polymer expressed by eukaryotic cells.

2. 1 MG53 polymers, it is mainly made of MG53 dimeric forms.

3. the polymer of mitsugumin 53 (MG53) mutant expressed by eukaryotic cells, it is characterised in that The polymer of the MG53 mutant is any one or two or two in 7 cysteines of RING domains of the N-terminal of MG53 Cysteine mutation above is the mutant of nonpolar amino acid；7 cysteines are the of RING domains respectively 14 sites, the 17th site, the 29th site, the 34th site, the 37th site, the 53rd site, the 56th site.

4. the polymer of 3 MG53 mutant, it is mainly made of the form of MG53 dimers.

5. the polymer of 3 or 4 MG53 mutant, it is characterised in that the nonpolar amino acid is alanine, sweet ammonia Acid, valine, leucine, isoleucine, proline, phenylalanine, tryptophan or methionine.

6. the polymer of 5 MG53 mutant, it is characterised in that the nonpolar amino acid is alanine, glycine, Leucine, proline, valine or isoleucine.

7. the polymer of 6 MG53 mutant, it is characterised in that the nonpolar amino acid is alanine, the MG53 The polymer of mutant is selected from MG53 polymer C14A, MG53 polymer C17A, MG53 polymer C29A, MG53 polymers Any one or more in C34A, MG53 polymer C37A, MG53 polymer C53A, MG53 polymer C56A.

8. the mutant of mitsugumin 53 (MG53) polymer expressed by eukaryotic cells, it is characterised in that Serine sites in the Coiled-coil domains of MG53 sport the amino acid in addition to threonine and tyrosine.

9. the polymer of 8 MG53 mutant, it is mainly made of the form of MG53 dimers.

10. the polymer of 8 or 9 MG53 mutant, it is characterised in that the mutant serine is nonpolar amino Acid.

11. the polymer of 10 MG53 mutant, it is characterised in that the nonpolar amino acid is alanine, sweet ammonia Acid, valine, leucine, isoleucine, proline, phenylalanine, tryptophan or methionine.

12. the polymer of 10 or 11 MG53 mutant, it is characterised in that the nonpolar amino acid is alanine, The polymer of the MG53 mutant is in MG53 polymer S150A, MG53 polymer S189A, MG53 polymers S211A Any one or more.

13. the method for the MG53 polymers of preparation 1 or 2, it comprises the following steps：

14. 13 method, wherein the MG53 genes are obtained by codon optimization wild type MG53 genes, it is excellent Optimized MG53 genes described in selection of land have such as SEQ ID NO:Nucleotide sequence shown in 7.

15. 13 or 14 method, wherein the signal peptide has such as SEQ ID NO:Nucleotide sequence shown in 12.

16. the method for an one of 13-16, wherein the MG53 expression plasmids have such as SEQ ID NO:Core shown in 19 Nucleotide sequence, or the polypeptide of MG53 expression plasmids coding have such as SEQ ID NO:Amino acid sequence shown in 25.

17. the method for an one of 13-16, it further includes pure using chromatography such as Q-HP column chromatographies and Mono Q column chromatographies Change the MG53 multimeric proteins produced in the step b.

18. 17 method, wherein in the Q-HP column chromatographies, with reference to liquid A：20mM Tris, pH8.5, eluent B： 20mM Tris and 1.0M NaCl, pH 8.5, optionally with the solution that eluent B in the mixture of A and B is 5% (volume ratio) And/or eluent B elutions.

19. 17 method, is 20mM phosphate buffers (PB) with reference to liquid A wherein in the Mono Q column chromatographies, PH 7.0, eluent B are 20mM phosphate buffers (PB) and 1.0M NaCl, pH 7.0, optionally with the mixture of A and B Eluent B is the ladder that eluent B is 10%-30% (volume ratio) in the solution of 10% (volume ratio) and/or the mixture of A and B Solution and/or eluent the B elution of degree.

20. the method for an one of 13-19, wherein the eukaryotic is Chinese hamster ovary cell (CHO), COS or HEK293-F (HEK293-FreeStyle) cell.

21. the method for an one of 13-20, wherein before the MG53 genes are connected to the expression vector, by institute State MG53 genes and be connected in cloning vector and expanded, preferably after the MG53 genes are connected with signal peptide, by institute State MG53 genes and be connected in cloning vector and expanded.

22. the method for an one of 13-21, wherein the expression vector is pGenHT10, Okayama-Berg cDNA tables Up to carrier pcDV1 (Pharmacia), pCDM8, pRc/CMV, pcDNA1, pcDNA3 (Invitrogene) or pSPORT1 (GIBCO BRL)。

23. 21 method, carried wherein the cloning vector is pUC57, M13mp18/19 (RF) carrier, pALTER-1 Body, pALTER-Ex1 carriers, pGEM-3Z carriers, pGEM-3Zf (+/-) carrier, pGEM-4Z carriers, pGEM-5Zf+/- carrier or PGEM-7Zf+/- carrier.

24. the method for the polymer of the MG53 mutant of one of preparation 3-12, it comprises the following steps：

A. MG53 genes are mutated, obtain MG53 mutant genes；

C. expression connects the MG53 mutant expression plasmid of acquisition to obtain MG53 in the step b in eukaryotic The multimeric protein of mutant.

25. 24 method, wherein the MG53 genes are obtained by codon optimization wild type MG53 genes, it is excellent Optimized MG53 genes described in selection of land have such as SEQ ID NO:Nucleotide sequence shown in 7.

26. 24 or 25 method, wherein the signal peptide has such as SEQ ID NO:Nucleotide sequence shown in 12.

27. the method for an one of 24-26, it further includes pure using chromatography such as Q-HP column chromatographies and Mono Q column chromatographies Change the multimeric protein of the MG53 mutant produced in the step c.

28. 27 method, wherein in the Q-HP column chromatographies, with reference to liquid A：20mM Tris, pH 8.5, eluent B：20mM Tris and 1.0M NaCl, pH 8.5, is the molten of 5% (volume ratio) optionally with eluent B in the mixture of A and B Liquid and/or eluent B elutions.

29. 27 method, is 20mM phosphate buffers (PB) with reference to liquid A wherein in the Mono Q column chromatographies, PH 7.0, eluent B are 20mM phosphate buffers (PB) and 1.0M NaCl, pH 7.0, optionally with the mixture of A and B Eluent B is the ladder that eluent B is 10%-30% (volume ratio) in the solution of 10% (volume ratio) and/or the mixture of A and B Solution and/or eluent the B elution of degree.

30. the method for an one of 24-29, wherein the eukaryotic is Chinese hamster ovary cell (CHO), COS or HEK293-F (HEK293-FreeStyle) cell.

31. the method for an one of 24-30, wherein by the MG53 mutant genes be connected to the expression vector it Before, the MG53 mutant genes are connected in cloning vector and are expanded, preferably the MG53 mutant genes with After signal peptide connection, the MG53 mutant genes are connected in cloning vector and are expanded.

32. the method for an one of 24-31, wherein the expression vector is pGenHT10, Okayama-Berg cDNA tables Up to carrier pcDV1 (Pharmacia), pCDM8, pRc/CMV, pcDNA1, pcDNA3 (Invitrogene) or pSPORT1 (GIBCO BRL)。

33. 31 method, carried wherein the cloning vector is pUC57, M13mp18/19 (RF) carrier, pALTER-1 Body, pALTER-Ex1 carriers, pGEM-3Z carriers, pGEM-3Zf (+/-) carrier, pGEM-4Z carriers, pGEM-5Zf+/- carrier or PGEM-7Zf+/- carrier.

34. pharmaceutical composition, it includes item 1 or 2 MG53 polymers or one of item 3-12 MG53 mutant it is more Aggressiveness.

35. the pharmaceutical composition in 34, it further includes pharmaceutically useful excipient or carrier.

36. the polymer of 1 or 2 MG53 polymers or the MG53 mutant of one of item 3-12 is used to prevent preparing And/or treatment and the purposes in the pharmaceutical composition of cell membrane damage relevant disease.

37. 36 purposes, wherein described include one kind or more selected from following disease with cell membrane damage relevant disease Kind：Leaked with myocardial cell injury relevant disease, with ulcer relevant disease, the wound with wound particularly Hard agglut wound, intestines And kidney injury.

38. 37 purposes, wherein described include selected from related with following symptom to the relevant disease of myocardial cell injury Disease in one or more：Myocardial ischemia, heart ischemia/reperfusion injury, miocardial infarction, heart failure, arrhythmia cordis and Cardiac rupture, and described pharmaceutical composition will not cause the secondary work of insulin resistance, obesity, diabetes and metabolic syndrome With.

39. the purposes in 37, wherein described include the one or more selected from following disease with ulcer relevant disease：Slowly Property ulcer, peptic ulcer, diabetic foot ulcer, diabetic foot ulcers, diabetic foot gangrene and chronic gastric ulcer.

40. the purposes in 37, wherein described include the one or more selected from disease once with injury of kidney relevant disease： Nephrotic syndrome, pre-renal, renal and postrenal acute injury of kidney, chronic renal failure.

40. the polymer of the MG53 mutant of MG53 polymers or one of item 3-12 comprising MG53 monomers or item 1 or 2 Dry powder formulations.

41. the MG53 mutant of MG53 polymer of the preparation comprising MG53 monomers or item 1 or 2 or one of item 3-12 is more The method of the dry powder formulations of aggressiveness, it comprises the following steps：

(1) auxiliary material is dissolved, and by its MG53 with the MG53 polymers or one of item 3-12 of MG53 monomers or item 1 or 2 The poly liquid solution mixing of mutant, adjustment pH value to 6.5-8.0, obtains the protein solution for including 0.1-2.0mg/ml；

Comprising 0.5-2mg/ml described in (2) being freeze-dried by filtration sterilization and under the conditions of suitable freeze-drying The poly liquid solution of the MG53 mutant of the MG53 polymers or one of item 3-12 of MG53 monomers or item 1 or 2 obtains dry powder system Agent.

42. according to the method for item 41, wherein the accessory package, which contains, is selected from following one or more：Polyol, Carbohydrate, surfactant and polymer.

43. according to the method for item 42, wherein the polyol, which includes, is selected from following one or more：Glycerine, Mannitol, sorbierite, inositol and polyethylene glycol, the carbohydrate include and are selected from following one or more：Sucrose, glucose, breast Sugar, trehalose, mannose and maltose, the surfactant include and are selected from following one or more：Tween80,12 Sodium alkyl sulfate, and/or the polymer include and are selected from following one or more：Polyethylene glycol, polyvinylpyrrolidone.

44. according to the method for item 41, wherein the auxiliary material is sucrose, mannitol and histidine.

45. according to the method for item 41, wherein the auxiliary material is sucrose, mannitol and Tween-80.

46. according to the method for item 41, wherein the suitable freeze-drying condition is：

(1) pre-freeze is kept for 2 hours to -45 DEG C, forvacuum to 12 ± 2Pa,

- 6 DEG C are warming up within (2) 90 minutes, is kept for 10 hours,

(3) 1 are warming up to 15 DEG C when small, keep 5 it is small when, and

(4) it is further dried.

47. the polymer of the MG53 mutant of MG53 polymers or one of item 3-12 comprising MG53 monomers or item 1 or 2 Hydro-acupuncture preparation.

48. the MG53 mutant of MG53 polymer of the preparation comprising MG53 monomers or item 1 or 2 or one of item 3-12 is more The method of the hydro-acupuncture preparation of aggressiveness, it comprises the following steps：

(1) dashed forward with the lyophilized MG53 monomers of solvent dissolving or the MG53 polymers of item 1 or 2 or the MG53 of one of item 3-12 The polymer of variation,

(2) pH value is adjusted, and is filtered,

(3) seal and sterilize, so that one of the MG53 polymers comprising MG53 monomers or item 1 or 2 or item 3-12 be made MG53 mutant polymer hydro-acupuncture preparation.

49. 48 method, wherein the solvent is medicine common solvent, preferably water or physiological saline.

50. the polymer of the MG53 mutant of MG53 polymers or one of item 3-12 comprising MG53 monomers or item 1 or 2 Spray agent.

51. the MG53 mutant of MG53 polymer of the preparation comprising MG53 monomers or item 1 or 2 or one of item 3-12 is more The method of the spray agent of aggressiveness, it comprises the following steps：

(1) poly of the MG53 polymers of MG53 monomers or item 1 or 2 or the MG53 mutant of one of item 3-12 is freezed Body,

(2) the MG53 polymers or one of item 3-12 of the lyophilized MG53 monomers or item 1 or 2 are dissolved with solvent The polymer of MG53 mutant, to be configured to the MG53 polymers or item comprising 50ng-100 μ g/ml MG53 monomers or item 1 or 2 The spray agent of the polymer of the MG53 mutant of one of 3-12.

52. 51 method, wherein the solvent is medicine common solvent, preferably water or physiological saline.

53. the polymer of the MG53 mutant of MG53 polymers or one of item 3-12 comprising MG53 monomers or item 1 or 2 Gel preparation.

54. the MG53 mutant of MG53 polymer of the preparation comprising MG53 monomers or item 1 or 2 or one of item 3-12 is more The method of the gel preparation of aggressiveness, it comprises the following steps：

(2) the lyophilized MG53 monomers or the MG53 polymers of item 1 or 2 or the MG53 of one of item 3-12 are dissolved with solvent The polymer of mutant, is configured to gel solvent.

55. 54 method, wherein the solvent be polyox-yethylene-polyoxypropylene block copolymer or carbomer, glycerine, The mixture of chitosan.

56. 55 method, wherein the polyox-yethylene-polyoxypropylene block copolymer is in such as 4-8 DEG C guarantor of low temperature The polyox-yethylene-polyoxypropylene block copolymer deposited.

57. the polymer of the MG53 mutant of MG53 polymers or one of item 3-12 comprising MG53 monomers or item 1 or 2 Emulsion.

58. the MG53 mutant of MG53 polymer of the preparation comprising MG53 monomers or item 1 or 2 or one of item 3-12 is more The method of the emulsion of aggressiveness, it comprises the following steps：

(2) one of described lyophilized MG53 monomers or the MG53 polymers of item 1 or 2 or item 3-12 are dissolved with chitosan solution MG53 mutant polymer, add emulsion bases and glycerine, be configured to emulsion.

59. 58 method, wherein the emulsion bases include stearic acid, glycerin monostearate, albolene, Tween-80, G ＆ W.

Brief description

Fig. 1 .MG53 structure charts.MG53 is respectively that the RING domains with E3 connection enzymatic activitys (are also referred to as from N-terminal to C-terminal Make RING finger areas), B-BOX domains, Coiled-coil domains and SPRY domains.

The MG53 codon optimizations for being used for eukaryotic CHO expression that Fig. 2 are carried out using signalase 11.Using signalase 11, Construct and include 5 kinds of different optimized MG53 codon plasmids, respectively TRIM72-S1-1, TRIM72-S1-2, TRIM72-S1-3, TRIM72-S1-4, TRIM72-S1-5.The plasmid for including natural MG53 gene orders is also constructed at the same time, TRIM72-S1-N.Every kind of MG53 plasmid sequences from N-terminal to C-terminal be respectively HindIII-Kozak sequences-signalase 11 --- optimization Codon sequences or wild-type codon sequence-terminator codon-EcoRI.

The MG53 codon optimizations for being used for eukaryotic CHO expression that Fig. 3 are carried out using signal peptide 2.Using signal peptide 2, Construct and include 5 kinds of different optimized MG53 codon plasmids, respectively TRIM72-S2-1, TRIM72-S2-2, TRIM72-S2-3, TRIM72-S2-4, TRIM72-S2-5.The plasmid for including natural MG53 gene orders is also constructed at the same time, TRIM72-S2-N.Every kind of MG53 plasmid sequences are respectively that HindIII-Kozak sequences-signal peptide 2--- optimizes from N-terminal to C-terminal Codon sequences or wild-type codon sequence-terminator codon-EcoRI.

Fig. 4 are used for the codon optimization of the MG53 of eukaryotic cell expression.The base that capitalization represents in consensus sequence For identical base, the base of lowercase letter is different bases.Compare for eukaryotic CHO expression wild type MG53 and Optimized MG53 nucleotide bases.It is according to Chinese hamster ovary cell (CHO) preference codon that MG53 progress codons is excellent Change, Chinese hamster ovary cell (CHO) codon usage frequency refers to Codon Usage Database (http:// www.kazusa.or.jp/codon/).Synthetic Gene are used on the basis of amino acid sequence is not changed Designer(http://www.evolvingcode.net/codon/sgd/index.php), codon uses optimal password Son, carries out local directed complete set, the especially more intensive place of secondary structure then referring to the secondary structure of mRNA, makes the freedom of mRNA Can be as high as possible, so as to be easy to translate.The nucleotide base of Fig. 4 A, wild type MG53 sequences and optimized MG53 sequences 1-4 Comparison.The comparison of the nucleotide base of Fig. 4 B, wild type MG53 sequences and optimized MG53 sequences 5-9.The numeral in left side 1-9 represents optimized MG53 nucleotide sequences 1-9 respectively.

Fig. 5 are used for the codon optimization of the MG53 of procaryotic cell expression.The base that capitalization represents in consensus sequence For identical base, the base of lowercase letter is different bases.Compare wild type MG53 and optimized be used for prokaryotic The MG53 nucleotide bases of expression.On the basis of amino acid sequence is not changed according to Escherichia coli preference codon to MG53 into Row codon optimization.Codon uses optimal codon, and local directed complete set, especially two level are carried out then referring to the secondary structure of mRNA The more intensive place of structure, makes the free energy of mRNA as high as possible, so as to be easy to translate.

Gram that Fig. 6 are used when structure is used for the optimized MG53 and wild type MG53 plasmids of eukaryotic CHO expression Grand carrier and expression vector.The cloning vector pUC57 and expression vector that Fig. 6 A. are used when expressing MG53 in eukaryotic CHO The collection of illustrative plates of pGenHT10.PUC57 is 4.3KB.PGenHT10 is 12.6KB.From collection of illustrative plates, pUC57 and pGenHT10 are respectively provided with HindIII and EcoRI multiple cloning sites.The expression that Fig. 6 B. are used when expressing MG53 in prokaryotic Escherichia coli BL-21 carries The collection of illustrative plates of body PET-22b.PET-22b sizes are 5.5KB.From collection of illustrative plates, PET-22b has the polyclonal positions of NdeI and XhoI Point.

Fig. 7 use signalase 11 and the 2 MG53 plasmids being loaded into pGenHT10 obtained.Fig. 7 A, are obtained using signalase 11 The MG53 plasmids being loaded into pGenHT10 obtained.These plasmids include 5 kinds it is different be used for eukaryotic CHO expression through close The MG53 sequences of numeral optimization.Verified by agarose gel electrophoresis (QC), obtain this 5 kinds it is different through codon optimization MG53 plasmids, respectively TRIM72-S1-1, TRIM72-S1-2, TRIM72-S1-3, TRIM72-S1-4, TRIM72-S1-5 ( S1-1, S1-2, S1-3, S1-4, S1-5 are briefly referred to as in figure).Meanwhile it have also obtained the MG53 matter of not optimized wild type Grain TRIM72-S1-N (is referred to as S1-N) in figure.Fig. 7 B, the MG53 being loaded into pGenHT10 obtained using signal peptide 2 Plasmid.These plasmids include 5 kinds of different MG53 sequences through codon optimization.Verified by agarose gel electrophoresis (QC), This 5 kinds different MG53 plasmids through codon optimization for being used for eukaryotic CHO expression are obtained, are respectively TRIM72-S2- 1, TRIM72-S2-2, TRIM72-S2-3, TRIM72-S2-4, TRIM72-S2-5 (S2-1, S2-2 are briefly referred to as in figure, S2-3, S2-4, S2-5).Meanwhile it have also obtained the MG53 plasmids TRIM72-S2-N of not optimized wild type (in figure referred to as For S2-N).

MG53 sequences (the SEQ ID through codon optimization that Fig. 8 will be expressed for prokaryotic Escherichia coli BL-21 NO:26) agarose gel electrophoresis figure of digestion is carried out with PET-22b plasmids.In Fig. 8 A, with NotI single endonuclease digestion PET-22b plasmids Agarose gel electrophoresis figure, result verification PET-22b plasmid sizes are correct, are 5.5KB, and wherein MK is 1Kb marks (Solarbio).Fig. 8 B, MG53 (the SEQ ID through codon optimization that will be expressed for prokaryotic Escherichia coli BL-21 NO:26) agarose gel electrophoresis figure of NdeI and XhoI double digestions is carried out.MK is 1Kb marks (Solarbio), and arrow, which represents, to be used In MG53 (the SEQ ID NO through codon optimization of prokaryotic Escherichia coli BL-21 expression:26) the MG53 pieces after digestion Section, size 1.47Kb.

After Fig. 9 .IPTG inductions, MG53 (the SEQ ID NO through codon optimization:26) in prokaryotic Escherichia coli BL- The SDS-PAGE figures of induced expression in 21.Swimming lane 1 is total protein before induction；Swimming lane 2-3 is total protein after IPTG inductions 2h and 4h Express spectra, swimming lane 4 are MG53 standard items (molecular weight 53kd), and swimming lane 5 is protein labeling, and swimming lane 6 is supernatant liquid eggs before induction In vain, swimming lane 7-8 is supernatant protein express spectra after IPTG inductions 2h and 4h, and swimming lane 9 is inclusion body before induction, and swimming lane 10 is induction 4h Inclusion body protein.Thus for figure it can be seen that under the fermentation volume of 5L, MG53 has expression in supernatant and inclusion body.

Figure 10 purify the tomographic map of the MG53 albumen expressed in prokaryotic Escherichia coli BL-21 with DEAE column chromatographies With polyacrylamide gel electrophoresis (SDS-PAGE) figure.Figure 10 A, are purified in prokaryotic Escherichia coli BL- with DEAE column chromatographies The tomographic map for the MG53 albumen expressed in 21, Cond therein represent electrical conductivity, and Conc B represent to elute in the mixture of A and B The concentration of liquid B.Figure 10 B. purify the SDS- of the MG53 albumen expressed in prokaryotic Escherichia coli BL-21 with DEAE column chromatographies PAGE schemes.Swimming lane 1 therein is sample after centrifugal filtration, swimming lane 2 refers to target protein and be adsorbed on column to penetrate peak The sample of chromatographic column is flowed out afterwards, and eluent B is the solution elution acquisition of 5% (volume ratio) in the mixture that swimming lane 3 be A and B Sample, swimming lane 4 are protein labeling；Swimming lane 5 is MG53 standard items, and eluent B is 5% (body in the mixture that swimming lane 6 is A and B Product ratio) solution elution obtain sample, swimming lane 7 for eluent B elution obtain sample.

Figure 11 with CM column chromatographies purify the MG53 albumen expressed in prokaryotic Escherichia coli BL-21 tomographic map and SDS-PAGE schemes.Figure 11 A, purify the chromatography of the MG53 albumen expressed in prokaryotic Escherichia coli BL-21 with CM column chromatographies Scheme, Cond expressions electrical conductivity therein, the concentration of eluent B in the mixture of Conc B expressions A and B.Will be in DEAE column chromatographies During purifying MG53 albumen, afforded with the solution that eluent B in the mixture of pH8.0, A and B is 5% (volume ratio) Eluting peak purified to obtain this tomographic map with CM column chromatographies.Figure 11 B, are purified in prokaryotic Escherichia coli BL- with CM column chromatographies The SDS-PAGE figures for the MG53 albumen expressed in 21.Swimming lane 1 therein is loading sample, and swimming lane 2 is to penetrate peak, i.e. target protein The sample of outflow chromatographic column after being adsorbed on column, swimming lane 3-4 be respectively A and B mixture in eluent B be 10% Eluting peak A, B that the solution elution of (volume ratio) obtains, swimming lane 5 is protein labeling；Swimming lane 6-8 is respectively the mixture of A and B Middle eluent B is eluting peak A, B and C that the solution elution of 20% (volume ratio) obtains, and swimming lane 9 is to be eluted in the mixture of A and B Liquid B is the eluting peak that the solution elution of 30% (volume ratio) obtains, and swimming lane 10 elutes the sample obtained for eluent B.

Figure 12 .SDS-PAGE detect optimized MG53 codons and wild type MG53 in Chinese hamster ovary cell (CHO) transient expression in cell.P therein represents MG53 standard items (the purified MG53 albumen of procaryotic cell expression), Molecular weight is 53KD.A variety of plasmids are expressed as S1-1, S1-2, S1-3, S1-4, S1-N, S2-1, S2-2 with its abbreviation, S2-3, S2-4 and S2-N.NC is negative control.As seen from the figure, in the case of identical optimization codon, expressed for MG53 The influence of amount, signal peptide 2 are better than signalase 11, and the MG53 Codon sequences 6 of optimization are close better than the MG53 of wild type and other optimizations Numeral.Meanwhile plasmid TRIM72-S2-1 (being abbreviated as S2-1) obtains highest supernatant titre.Therefore, in eukaryotic CHO In, TRIM72-S2-1 has highest expression yield.

Figure 13 are expressed by irreducibility SDS-PAGE and reproducibility SDS-PAGE detections in eukaryotic CHO The form of MG53.M therein, protein labeling；P, positive control, that is, MG53 standard items；S1-1, S1-N, S2-2, S2-N, S2-1 The expression of MG53 or wild type MG53 in eukaryotic CHO through codon optimization for eukaryotic CHO expression；NC, Negative control, sample-loading buffer.N represents to detect the shape of the MG53 expressed in eukaryotic CHO in irreducibility SDS-PAGE Formula, R represent to detect the form of the MG53 expressed in eukaryotic CHO in reproducibility SDS-PAGE.As seen from the figure, by true Nucleus CHO is expressed, and MG53 mainly has (mainly including MG53 dimers) with multimeric forms under non-reduced state, and also Under original state (in the case that i.e. wherein disulfide bond is destroyed), MG53 mainly exists with monomeric form.

Figure 14 purify the SDS- of the MG53 multimeric proteins that acquisition is expressed in eukaryotic CHO with Q-HP column chromatographies PAGE schemes.In this figure, swimming lane 1 is protein labeling, and swimming lane 2 is sample before loading, and for swimming lane 3 to penetrate peak, swimming lane 4 is with knot The sample that the solution elution that eluent B in the mixture of liquid A and eluent B is 5% (volume ratio) obtains is closed, swimming lane 5 is with washing The sample that de- liquid B elutions obtain.As seen from the figure, purified by Q-HP column chromatographies, eliminate the part included in MG53 polymers Impurity protein.

Figure 15 purify the SDS- of the MG53 multimeric proteins that acquisition is expressed in eukaryotic CHO with Mono Q column chromatographies PAGE schemes.(eluent B is 5% (body to the main eluting peak that Q-HP column chromatographies are purified in the mixture of pH8.5, A and B Product ratio) solution, and the eluting peaks that afford of eluent B) carry out Mono Q column chromatographies.Wherein A is loading sample, and B is Mono Q column chromatographies penetrate peak, and C, D and E are to be eluted with the solution that eluent B in the mixture of A and B is 20% (volume ratio) Obtain molecular weight of the eluting peak in reproducibility SDS-PAGE；MK is protein labeling, and F, G, H is corresponding C, and D, E is non- Band under reproducibility SDS-PAGE.As seen from the figure, the MG53 polymers of acquisition under non-reduced state mainly with MG53 bis- The form of aggressiveness exists, and molecular weight is respectively 110KD and 160KD or so, and the MG53 under reproducibility state is with monomeric form In the presence of.

Figure 16 are detected in irreducibility SDS-PAGE in prokaryotic Escherichia coli BL-21 and eukaryotic CHO expression Purify the expression-form of the MG53 albumen obtained.In this figure, 0 swimming lane is protein labeling, and 1,2 is in reproducibility SDS-PAGE In MG53 albumen, wherein 1 for TRIM72-S2-1 eukaryotic CHO expression and purifications MG53 albumen, 2 be through codon it is excellent MG53 (the SEQ ID NO of change:26) in the MG53 albumen of prokaryotic Escherichia coli BL-21 expression and purifications, 3,4 be non-reduced Property SDS-PAGE in MG53 albumen, wherein 3 be TRIM72-S2-1 expression and purifications in eukaryotic CHO MG53 polymers, 4 be MG53 (the SEQ ID NO through codon optimization:26) in prokaryotic Escherichia coli BL-21 expression and purification MG53 eggs In vain.Therefore, MG53 is mainly with multimeric forms in eukaryotic CHO, and the mainly form of MG53 dimers exists, in original The MG53 expressed in nucleus Escherichia coli BL-21 mainly exists with monomeric form.

Figure 17 .LDH methods detect the reparation of MG53 multimeric proteins and MG53 monomeric proteins to the mechanical damage of 293T cells Effect.As seen from the figure, the activity of the mechanical damage of MG53 multimeric proteins reparation 293T cells is significantly higher than MG53 monomeric proteins.

Figure 18 are relative to control group, using the SD rat blood sugars of MG53 multimeric proteins in Each point in time without significantly Difference, so as to efficiently avoid the side effect of insulin resistance, obesity, diabetes and metabolic syndrome.

Figure 19 .MG53 multimeric proteins promote fibroblast proliferation at diabetic foot ulcer, are conducive to diabetes and burst Ulcer and leg ulcer healing.

Figure 20 more effectively treat diabetic foot gangrene relative to MG53 monomeric proteins, MG53 multimeric proteins.Figure 20 A, Before diabetic foot complicated with gangrene treatment.Figure 20 B, the situation after January is treated with MG53 polymers treatment diabetic foot complicated with gangrene.

Detailed description of the invention

The present invention provides the polymer and their preparation method of MG53 polymers or MG53 mutant.These MG53 polies The polymer of body or MG53 mutant can be used for prevention or treatment with cell membrane damage relevant disease, such as with myocardial cell injury Relevant disease, the wound with ulcer relevant disease, with wound particularly Hard agglut wound, intestines leakage and kidney injury etc..With the heart The relevant disease of muscle cell damage may include selected from the one or more in the relevant disease of following symptom：Myocardial ischemia, the heart Dirty ischemia/reperfusion damage, miocardial infarction, heart failure, arrhythmia cordis and cardiac rupture etc..Include being selected from ulcer relevant disease The one or more of following disease：Chronic ulcer, peptic ulcer, diabetic foot ulcer, diabetic foot ulcers, diabetes Gangrene and chronic gastric ulcer etc..Injury of kidney disease is selected from the one or more of disease：Nephrotic syndrome, pre-renal, renal With postrenal acute injury of kidney, chronic renal failure.

Especially, it is found by the applicant that compared to MG53 monomers, that is, natural MG53 protein forms, MG53 polymers or MG53 The polymer of mutant can preferably cardioprotection, treatment cell death caused by heart disease while, moreover it is possible to avoid having Have the MG53 monomers of cardioprotective effects at the same time with insulin resistance, obesity, diabetes and metabolic syndrome side effect. Also, relative to MG53 monomers, the polymer of MG53 polymers or MG53 mutant is in ulcer, such as chronic ulcer, digestibility Ulcer, diabetic foot ulcer, diabetic foot ulcers, diabetic foot gangrene and chronic gastric ulcer treatment in it is more efficient.

MG53

MG53 is TRIM families (The superfamily of tripartite motif-containing Proteins a newfound protein in).Different from other family members, it is only expressed in skeletal muscle and cardiac muscle.MG53 Albumen be by generally acknowledge with the RING domains (can also be called RING finger areas) of E3 connection enzymatic activitys, B-BOX domains, Coiled-coil domains and SPRY domains composition (Fig. 1).The major function of MG53 is cell membrane reparation, be can use in theory In treatment with cell membrane damage relevant disease, such as with myocardial cell injury relevant disease, with ulcer relevant disease, there is wound The particularly wound of Hard agglut wound, intestines leakage and kidney injury etc..The prior art it has been reported that MG53 can be used for repair wound, Preventing from scar.

MG53 and Cardioprotective

The blocking of heart blood flowing causes acute myocardial infarction AMI, produces two distinct types of myocardial damage, including by Reperfusion injury caused by ischemia injury caused by initial abstraction in blood flow and the recovery of oxygenated blood stream.Although by that will be metabolized It is changed into anerobic glycolysis and aliphatic acid and utilizes and reduce shrinkage, cardiac muscle is tolerable of short duration is exposed to (about 20 points of ischaemic Clock), but lasting ischaemic causes irreversible myocardial damage, causes serious muscle cell death and amount of contraction (contractilemass) forever lost.The timely Reperfu- sion of ischemic heart is to maintain the unique of heart cell vigor Approach.But due to the oxidative stress through active oxygen (ROS)-induction, mitochondrial permeability transformation passage (MPEP) induction, Excess shrinkage and apoptosis and the cardiomyocyte cell death of necrosis, Reperfu- sion may excite the further damage to cardiac muscle, i.e., ischemic/ Reperfu- sion (IR) damages.

The research at initial stage shows that MG53 can be used as a kind of structural proteins to promote cell membrane damage in skeletal muscle and cardiac muscle Reparation, while can also adjust endocytic vesicle transhipment and Skeletal Muscle Cell regeneration；In addition in cardiac muscle, MG53 is also participated in Ischemic preconditioning process, it by two important ischemic preconditioning (IPC) molecular pathways, i.e., PI3K-Akt-GSK3 β paths and CaV3 pathways get up, by promoting the interaction of CaV3 and PI3K-p85, to activate Akt/GSK3 β paths, to heart Ischemia/reperfusion damage produces protective effect, and then important defencive function is played in Heart ischemic preconditioning (CN101797375A).Therefore, MG53 has a cell membrane repair function, participates in protection cardiac muscle cell and/or tissue, avoid due to Angiocardiopathy and/or heart ischemia/reperfusion injury, hypoxia injury, have repair to heart failure.

MG53 and insulin metabolism

Insulin is sugar and regulation and control hormone main in adipose energy metabolic process.Insulin first with cell surface pancreas islet Plain acceptor (INSR) combines, and activates the protein tyrosine kinase (protein Tyrosine kinase, PTK) of its B subunit.Pancreas Island element receptor substrate albumen (insuin receptor substrate, IRS) is used as a kind of anchorin (docking Protein), the signaling molecule with homology segment containing sarcoma 2 (srchomology 2domain, SH2) domain has combined activation Know that at least two bars approach combine：One is to activate phosphatidylinositol3 3 kinase (PI3K) approach, i.e. IR/IRSs- by IRS PI3K-Akt paths；Another is by Grb2/SOS and RAS protein activation blocking effect of mitogen activated protein kinases (Miogen Activated protein kinase, MAPK) approach.3 kinases of phosphinositides (PI3K) family, is growth factor superfamily Important molecule during signal transduction, can be activated by cytokine profiles and chemical factors, be that one kind is specifically catalyzed phosphorus 3 dis of ester acyl inositol, produce the kinases of the inositol lipid material with second messenger's effect.Two approach more than In, insulin mainly passes through the adjusting of IR/IRSs-PI3K-Akt approach mediated metabolics.AKT is in the center ring of this path Section, AKT Ser phosphorylation levels can be used as detection to glycometabolism, the key point thing of insulin resistance.

With the development of science and technology, it has been recognized that insulin resistance be type ii diabetes main feature and in Thimble section, insulin resistance refer to that body cannot effectively activate insulin receptor signal path (1,2) using insulin.Normally In the case of, once as described above, insulin is combined with insulin receptor, can catalytic receptor two multimerizing and autophosphorylations, It is allowed to fully activate, then recruits simultaneously phosphorylated insulin receptor substrate (IRSs) (3), and then causes intracellular extensive downstream Signal path is activated (4).These signal paths regulate and control cell vesicle transhipment jointly in a manner of cooperateing with, protein synthesizes, The bioprocess such as the activation and inactivation and gene expression of enzyme, so that finally to sugar, fat and protein this three major nutrient Metabolism be controlled (4).

In type ii diabetes, due to insulin action defect, cause sugar, fat and protein metabolism abnormal, with the course of disease Extend, the multisystem such as eye, kidney, nerve, heart and blood vessel progressive can be caused to damage, cause functional failure, make the life matter of patient Amount reduces, and the lost of life, case fatality rate increases.In China, the morbidity of type ii diabetes becomes younger increasingly, to social and economic development White elephant is brought, seriously endangers the life and health of the people.For this reason, have to actively prevent it, and the key prevented is just It is to improve insulin resistance.

The MG53 albumen of known MG53 gene expressions is only in heart and skeletal muscle (the insulin target organ of whole body maximum) Express (5), thus it is speculated that the expression of MG53 genes is likely to related with the function of insulin.It has been found that the expression of MG53 genes with Existing correlation between insulin resistance：In the case of insulin resistance, the expression of MG53 is substantially raised；The mistake of MG53 Expression can cause the generation of insulin resistance；MG53 defects significantly suppress the various illnesss of high fat diet induction, promote grape Glycometabolism and strengthen insulin sensitivity (CN101912617A).In addition, MG53 being capable of effectively ubiquitination insulin receptor (IR) and substrate 1 (IRS1).The RING domains of MG53, half Guang of the 14th particularly on amino acid sequence Propylhomoserin, is required (CN103965342A) for MG53 catalysis IR and IRS1 ubiquitinations.

MG53 can produce protective effect to heart, that is to say, that can be damaged by increasing the content protection heart of MG53 Wound.But be subsequently found, the MG53 of incrementss while cardioprotection, insulin resistance, obesity, diabetes and generation can be caused Thank to syndrome.That is MG53 is while cardioprotection, with insulin resistance, obesity, diabetes and metabolic syndrome Side effect.This area is intended to that function of the MG53 albumen in terms of cardioprotection can be being improved, but does not cause insulin at the same time The side effect of resistance, fat, diabetes and metabolic syndrome.

MG53 and ulcer

Skin ulcer is the local organization defect as caused by a variety of causes.Suffer from more than the 2 weeks non-healing persons of the surface of a wound of ulcer, be slow Property skin ulcer.The usual course of disease of chronic ulcer of skin is longer, and therapeutic advance is slow, and the body and spirit to patient all bring very big Pain, and very big influence is caused to the quality of life of patient.Diabetic and lower limb vascular Disease are slow The group of people at high risk of property skin ulcer.Skin ulcer can be divided into wound infection ulcer, pressure ulcer, quiet by different pathogenic factors Arteries and veins ulcer, diabetes and leg ulcer etc..

The main method of chronic ulcer of skin treatment is to carry out systemic drug treatment (as using antibiotic and using Chinese medicine Deng), the surgery of surface of a wound processing (such as part debridement and anti-infective medication) and locally accelerate wound healing measure.Promote body surface wound The method of face healing is more, local using external application of Chinese medicine etc. such as physical therapies such as the use of growth-factor medication, laser, but this The clinical efficacy of a little treatment methods is unsatisfactory.

Peptic ulcer is that the chronic of a kind of mucous membrane, muscular layer of mucosa and submucosa festers, and relates generally to gastric ulcer and ten Two Duodenalulcers, are a kind of frequently-occurring diseases and common disease.At present, the medicine that the medicine of peptic ulcer mainly includes reducing hydrochloric acid in gastric juice is treated The medicine of thing, the medicine of Eliminating H. pylori Infection by Means and enhancing gastric mucosal protective effect.But currently used for treating ulcer, especially It is that the effect of the existing medicine of chronic ulcer of skin is not ideal.Although in some documents, for example, CN103275980A and Composition of the prompting comprising MG53 is possibly used for treatment ulcer in CN101511181B, but does not carry out MG53 in the prior art and control Treat the experimental study of ulcer.

Intestines leak

Intestines leakage disease is illness caused by gut permeability increase, therefore also related with the damage of enterocyte.Leaked in intestines In disease patient, the cell for controlling nutrients to be discharged from enteron aisle is decomposed, and causes the efficiency that enteron aisle permeates to decline.Leaked in intestines In disease patient, most particles of the food digested, enter blood circulation by intestinal wall.These particles are considered as infectiousness by human body Pathogen, so as to trigger the immune response of immune system, is embodied in increase, inflammation, swelling and the tired power of essence of white blood corpuscle Exhaust.The immune response of triggering may result in more pathological symptoms, such as ulcer, pain and spasm etc., so as to damage body Health.

Many situations can cause intestines to leak, such as some intestinal surgeries, aging, certain form of food hypersenstivity, gluten Disease and irritable bowel syndrome etc..At present, also have no idea thoroughly to cure intestines leakage disease.It has been found that intestines leakage is not usually continuous, But intermittent breakthrough symptoms.

Embodiment

MG53 is only expressed in skeletal muscle and cardiac muscle.The research at initial stage shows that MG53 being capable of conduct in skeletal muscle and cardiac muscle A kind of structural proteins promote the reparation of cell membrane damage, at the same can also adjust endocytic vesicle transhipment and Skeletal Muscle Cell again It is raw；And in cardiac muscle, MG53 is also by mediating the combination of Caveolin-3 and PI3K, activation reperfusion injury rescue path (reperfusion injurysalvagekinase pathway, RISK pathway), and then in Heart ischemic preconditioning Play important defencive function.MG53 albumen includes 447 amino acid, molecular weight 52.7KD altogether.Under field conditions (factors) and carefully Intracellular portion MG53 is existed with monomer.Research for MG53 polymers is fewer.

Protein through procaryotic cell expression, purge process can not exclude the endotoxin that Bacillus coli cells cornice comes, heat The problems such as source.In contrast, the protein of eukaryotic cell expression, there is the processing and modification in later stage in eukaryotic after translation, Including modifications such as protein steric structure folding, glycosylations.Therefore, the albumen of the protein of eukaryotic cell expression and prokaryotic expression The secondary structure and protein modification of matter, protein active are all variant, can more keep the natural structure of protein.The present invention is set The multiple Codon sequences and signal peptide sequence of MG53 are counted and optimize, by gene chemical synthesis, subclone, transfection, thin in eucaryon Expression and purifying generate a kind of MG53 polymers (N >=2) in born of the same parents, and wherein MG53 mainly exists with the formation of dimer.These MG53 polymers have following characteristics：1) significantly improved relative to naturally occurring MG53 monomers, cell membrane remediation efficiency, 2) phase For naturally occurring MG53 monomers, cell membrane repairing activity significantly increases, and 3) relative to naturally occurring MG53 monomers, molecule Conformation, space structure, even regulatory region are all changed, and 4) relative to naturally occurring MG53 monomers, can be more effectively Cardioprotection, avoid insulin resistance caused by the same MG53 monomers with cardioprotective effects, obesity, diabetes and The side effect of metabolic syndrome, 5) ulcer can also be more effectively treated compared to MG53 monomers, these MG53 polymers, such as Chronic ulcer, peptic ulcer, diabetic foot ulcer, diabetic foot ulcers, diabetic foot gangrene and chronic gastric ulcer etc..

Preferably, the polymer of this MG53 mutant is mainly made of the form of MG53 dimers.

It is highly preferred that in the polymer of this MG53 mutant, the nonpolar amino acid is alanine, the MG53 The polymer of mutant is selected from MG53 polymer C14A, MG53 polymer C17A, MG53 polymer C29A, MG53 polymers Any one in C34A, MG53 polymer C37A, MG53 polymer C53A, MG53 polymer C56A.

In one embodiment, when nonpolar amino acid is alanine in MG53 mutant, MG53 mutation Body is selected from any one or more in MG53 polymer S150A, MG53 polymer S189A, MG53 polymers S211A.

With MG53 polymer class seemingly, the polymer of this MG53 mutant also has following characteristics：1) relative to naturally depositing MG53 monomers, cell membrane remediation efficiency significantly improves, 2) relative to naturally occurring MG53 monomers, cell membrane repairing activity Significantly increase, 3) all become relative to naturally occurring MG53 monomers, molecular conformation, space structure, even regulatory region Change, 4) relative to naturally occurring MG53 monomers, can more effectively cardioprotection, avoid same with cardioprotective effects The side effect of insulin resistance caused by MG53 monomers, obesity, diabetes and metabolic syndrome, 5) compared to MG53 monomers, The polymer of this MG53 mutant can also more effectively treat ulcer, such as chronic ulcer, peptic ulcer, diabetes Ulcer, diabetic foot ulcers, diabetic foot gangrene and chronic gastric ulcer etc..

In one embodiment, the polymer of above-mentioned MG53 polymers or MG53 mutant provided by the invention compared to MG53 monomers, can preferably cardioprotection, avoid the same MG53 monomers with cardioprotective effects at the same time with pancreas islet The side effect of element resistance, fat, diabetes and metabolic syndrome.Also, compared to MG53 monomers, this MG53 polymers or The polymer of MG53 mutant can also more effectively treat ulcer, such as chronic ulcer, peptic ulcer, diabetes are burst Ulcer, diabetic foot ulcers, diabetic foot gangrene and chronic gastric ulcer etc..

Effect of the MG53 polymers or the polymer of MG53 mutant that we build in cell membrane reparation is better than natural MG53 monomers, cause the cell membrane damage reaction time to shorten, and vesicle transport efficiency improves and remediation efficiency improves.Compared to natural MG53 monomers, the MG53 polymers of the application or the significant cell repair effect of the polymer of MG53 mutant result in preferably The effect of cardioprotection and treatment ulcer.

The expression and purifying of the polymer of MG53 polymers or MG53 mutant

In another aspect, this application provides a kind of method for preparing MG53 polymers, it comprises the following steps：

Meanwhile be to promote expression of the MG53 polymers in eukaryotic and facilitate its purifying, we compare two kinds of letters Number peptide, i.e. signalase 11 and signal peptide 2, are suitable for the signal peptide of the high-yield expression MG53 polymers in eukaryotic with screening.

Furthermore it is also possible to produced using chromatography such as Q-HP column chromatographies and the purifying of Mono Q column chromatographies in the step b MG53 multimeric proteins.

The MG53 poly physical efficiencys prepared using the present processes obtain more than 90% purity, are suitable for directly preparing Pharmaceutical composition.

In yet another aspect, the present invention provides the method for the polymer for the MG53 mutant for preparing the application, it is wrapped Include following steps：

A. MG53 genes are mutated, obtain MG53 mutant genes；

The poly physical efficiency of the MG53 mutant prepared using the present processes obtains very high purity, is suitable for directly Prepare pharmaceutical composition.

The method of the mutant of protein known to acquisition be well known to a person skilled in the art.Due to except mutation MG53 genes Outside, the method for preparing the polymer of MG53 mutant is similar with the method for preparing MG53 polymers.It is more to prepare MG53 below Exemplified by the method for aggressiveness, the present invention is explained in detail.

1.MG53 the structure of polymer plasmid

The application is first it was unexpectedly observed that MG53 genes can be expressed as mainly in eukaryotic by MG53 dimer groups Into MG53 polymers.In contrast, there is (Figure 16) in the MG53 genes expressed in prokaryotic with MG53 monomeric forms.

The optimization of codon

Codon optimization, refers to utilizing preference codon (Preferred codons), that is, avoids low dilute of utilization rate There is codon, simplify the secondary structure of mRNA after genetic transcription, remove the die body (Motif) for being unfavorable for high efficient expression, addition has Beneficial to the die body of high efficient expression, these methods such as adjustment G/C content redesign gene.The commercialization of gene chemical synthesis promotes significantly The scope of application and influence power of codon optimization.

The optimal expression of gene be by gene in itself, the System design of carrier, host system, condition of culture realizes 's.Following importance is primarily upon to the design optimization of gene and carrier：

1) codon preference

Different plant species are different to the frequency of use of synonym, and this codon preference has translation process Influence.If a mRNA has the rare codon of many clusters, this can adversely affect ribosomal movement velocity, greatly It is big to reduce protein expression level.If in the case where the synonym searching frequency of gene matches with expressive host, egg White expression can then significantly improve.Matching degree is often with codon adaptation indexI (Codon Adaption Index) come table Show, it is generally the case that CAI >=0.80 is considered as the standard for predicting recombinant protein high efficient expression.

In addition to the Preference of codon, it is also necessary to which consider codon is applied in combination efficiency.That is, in most of situation Under, only can't be best with the effect of high frequency AC pulse Link, it is contemplated that the effect that is applied in combination of high frequency and time high frequency AC pulse Link can be more It is good.

2) mRNA secondary structures

MRNA secondary structures are to influence another key factor of translation process, and the secondary structure that complexity is stablized can hinder to translate Process is smoothed out, particularly the secondary structure of ribosomes binding site (RBS) nearby.MRNA secondary structures are in DNA sequence dna In be mainly shown as hairpin structure (Hairpin), effectively identification and as far as possible reduction hairpin structure be codon optimization weight Want criterion.

3) removal of the transacting element and restriction enzyme site of expression is influenced

Optimization process not only needs to consider the element/sequence for having actively impact to translation, it is also necessary in view of to transcription There is element/sequence of negative influence with translation.Any transacting element for having negative consequence for transcription and translation needs logical Cross codon optimization and remove divided by eliminate multiple combination obstacle during transcription and translation.

Restriction enzyme site needs to carry out personalized exclusion according to Strategies For The Cloning, in case restriction enzyme site produces conflict, shadow Ring the operation of construction of expression vector.

4) G/C content

There are 2 hydrogen bonds between AT, there are 3 hydrogen bonds between GC, so the combination that G/C content directly affects DNA sequence dna is stablized Property and annealing temperature.It is of a relatively high in the conservative region G/C content such as promoter.In addition, to also contribute to mRNA thermodynamics steady for G/C content Qualitative and mRNA secondary structures.

5) translation initiation is with terminating efficiency

Protein stability, mRNA stability and translation efficiency play a major role protein yield and solubility.Translation process It is divided into starting, extension and terminates three phases.

First, initial period is smoothed out determining protein expression amount from scratch.For the starting of translation, protokaryon MRNA needs have one section of special ribosome binding sequence for being Shine-Dalgarno sequences in 5 ' end untranslated leaders. Eukaryotic, effective starting is dependent on the Kozak sequences (GCCGCCACC) for being centered around initiation codon ATG upstream and downstream.

The efficient extension stage determines the amount that protein can accumulate.This is in codon preference above and two level The chapter such as structure and transacting element had been discussed in detail.

Translation termination is the necessary step of albumen life cycle, is but easiest to be ignored.Scientific investigations showed that terminate efficiency Have a great impact to protein expression level, more effective translation termination can promote protein expression.Most biologies have partially The sequence frame around terminator codon of love, for example, the terminator codon of yeast and mammal preference be UAA respectively with UGA, monocotyledon most often utilizes UGA, and insect and Escherichia coli tend to use UAA.

Be to promote expression of the MG53 polymers in eukaryotic and facilitate its purifying, we to wild type MG53 genes into Row codon optimization.Specifically, we obtain 9 kinds of optimized MG53 genes.

In a preferred embodiment, MG53 is carried out according to Chinese hamster ovary cell (CHO) preference codon Codon optimization, Chinese hamster ovary cell (CHO) codon usage frequency refer to Codon Usage Database (http://www.kazusa.or.jp/codon/).Synthetic Gene are used on the basis of amino acid sequence is not changed Designer(http://www.evolvingcode.net/codon/sgd/index.php), codon uses optimal password Son, carries out local directed complete set, the especially more intensive place of secondary structure then referring to the secondary structure of mRNA, makes the freedom of mRNA Can be as high as possible, so that being easy to translation (is used for the wild type MG53 of eukaryotic cell expression and the ratio of optimized MG53 codons Compared with referring to Fig. 4).

Meanwhile be to promote expression of the MG53 polymers in eukaryotic and facilitate its purifying, we compare two kinds of letters Number peptide, i.e. signalase 11 and signal peptide 2, are suitable for the signal peptide of the high-yield expression MG53 polymers in eukaryotic with screening. In one embodiment, after MG53 genes are connected with the signal peptide used, MG53 genes are connected in cloning vector Expanded.

In order to screen the MG53 optimization genes and signal peptide that are best suited for expressing and purify in eukaryotic, we design Following gene order：

HindIII-Kozak sequences-signalase 11 or 2---MG53 optimization Codon sequences or wild-type sequence (sequence 1- 9 or natural MG53 sequences)-terminator codon-EcoRI.

Specific sequence see the table below

The optimization of signal peptide and Codon sequences in the structure of MG53 polymers

The optimization of table 1. signal peptide and Codon sequences in the structure of MG53 polymers

Gene Name	The signal peptide used	The MG53 sequences used
			TRIM72-S1-1	Signalase 11	The sequence 1 of optimization
TRIM72-S1-2	Signalase 11	The sequence 2 of optimization
			TRIM72-S1-3	Signalase 11	The sequence 3 of optimization
TRIM72-S1-4	Signalase 11	The sequence 4 of optimization
			TRIM72-S1-5	Signalase 11	The sequence 5 of optimization
TRIM72-S1-N	Signalase 11	MG53 native sequences
			TRIM72-S2-1	Signal peptide 2	The sequence 6 of optimization
TRIM72-S2-2	Signal peptide 2	The sequence 7 of optimization
			TRIM72-S2-3	Signal peptide 2	The sequence 8 of optimization
TRIM72-S2-4	Signal peptide 2	The sequence 9 of optimization
			TRIM72-S2-5	Signal peptide 2	The sequence 5 of optimization
TRIM72-S2-N	Signal peptide 2	MG53 native sequences

The clone of gene order：

According to the gene order of above-mentioned design, gene chemical synthesis is carried out.The gene of synthesis is connected to corresponding cloning vector In.The cloning vector of objective gene sequence is contained after competent cell is transformed into, under the conditions of suitable antibiotic resistance Culture, can obtain visible bacterium colony.Single bacterium colony therein is selected, the plasmid with correct gene sequence is obtained by being sequenced.

Suitable cloning vector is known in the art.Common cloning vector have M13mp18/19 (RF) carrier, PALTER-1 carriers, pALTER-Ex1 carriers, pGEM-3Z carriers, pGEM-3Zf (+/-) carrier, pGEM-4Z carriers, pGEM- 5Zf+/- carrier or pGEM-7Zf+/- carrier etc..The cloning vector used is not limited, it is only necessary to which it can be used for expanding this Shen Objective gene sequence please.In a preferred embodiment, using cloning vector pUC57, M13mp18/19 (RF) carrier, PALTER-1 carriers, pALTER-Ex1 carriers, pGEM-3Z carriers, pGEM-3Zf (+/-) carrier, pGEM-4Z carriers, pGEM- 5Zf+/- carrier or pGEM-7Zf+/- carrier.The plasmid map of pUC57 is shown in Fig. 6 A.

Gene order is connected in expression vector：

After the plasmid enzyme restriction with correct gene sequence, it is connected in expression vector.It is same to carry out and above-mentioned clone's class As conversion and bacterium colony screening.Screening obtains purpose bacterium colony after sequencing analysis and processing.Finally culture purpose bacterium colony is gone forward side by side Row plasmid extraction.The plasmid of extracting verifies (Fig. 7) by EcoRI and Hind III double digestions, will verify that correct plasmid is used for Cell transfecting expresses MG53 polymers.

Preferably expression vector is known in the art, such as Okayama-Berg cDNA expression vectors pcDV1 (Pharmacia), pCDM8, PET-22b, pRc/CMV, pcDNA1, pcDNA3 (Invitrogene) or pSPORT1 (GIBCO BRL).In a preferred embodiment, using expression vector pGen HT10 plasmids.PGen HT10 plasmid sizes are PGen HT10 plasmid maps are shown in 12.6KB, Fig. 6 A.From collection of illustrative plates, pGen HT10 have EcoR I and Hind III Multiple cloning sites.

2.MG53 the expression of multimeric protein

The method of marking protein be well known to a person skilled in the art.In order to express MG53 multimeric proteins, such as can MG53 concatemeric genes are loaded into suitable expression vector.Expressed by expression vector in suitable host cell.Place Chief cell is eukaryotic.Preferably eukaryotic is selected from protist cell, zooblast, plant cell and fungal cell. More preferably host cell is mammalian cell, include but not limited to, Chinese hamster ovary cell (CHO), COS or HEK293-F (HEK293-FreeStyle) cell；Or fungal cell such as Saccharomyces cerevisiae (Saccharomyces cerevisiae)；Or insect cell such as Sf9.

Preferably expression vector is known in the art, such as Okayama-Berg cDNA expression vectors pcDV1 (Pharmacia), pCDM8, pRc/CMV, pcDNA1, pcDNA3 (Invitrogene) or pSPORT1 (GIBCO BRL).Typical case Other examples of fusion expression vector be pGEX (Pharmacia Biotech Inc；Smith, D.B. and Johnson, K.S. (1988)Gene 67:31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ), wherein glutathione S-transferase (GST), maltose E binding protein and albumin A are respectively with recombinating target egg White fusion.The example in particular pTrc (Amann 1988, Gene 69 of suitable inducible non-fusion E. coli expression vector： 301-315) and pET 11d (Studier 1999, Methods in Enzymology 185,60-89).The target of pTrc carriers Gene expression is based upon the transcription of the hybrid trp-lac fusion promoter of host RNA polymerase progress.From pET 11d The expression of target gene of carrier is the transcription based on T7gn10-lac promoter, fusions, it is by the viral rna polymerase that co-expresses (T7gn1) mediate.The varial polymerases of λ-prophage from colonization are by host strain BL21 (DE3) or HMS174 (DE3) There is provided, the λ-prophage carries the T7gn1 genes controlled by 5 promoter transcriptions of lacUV.Suitable for prokaryotes Other carriers are known to the art, this kind of carrier be pLG338, pACYC184, pBR series in such as Escherichia coli such as PBR322, pUC series as pUC18 or pUC19, M113mp series, pKC30, pRep4, pHS1, pHS2, pPLc236, pMBL24, PLG200, pUR290, pIN-III113-B1, λ gt11 or pBdCI, pIJ101, pIJ364, pIJ702 in streptomyces or PIJ361, pUB110, pC194 or pBD214 in bacillus, pSA77 or pAJ667 in Corynebacterium.For making wine The example for the carrier expressed in yeast includes pYep Sec1, and (Baldari 1987, Embo are J.6：229-234)、pMFa (Kurjan 1982, Cell 30：933-943), pJRY88 (Schultz 1987, Gene 54：113-123) and pYES2 (Invitrogen Corporation, San Diego, CA).Suitable for the carrier and carrier of other fungies (such as filamentous fungi) Construction method, included in van den Hondel, C.A.M.J.J. ,s ＆Punt, P.J. (1991) " Gene transfer systems and vector development for filamentous fungi,in:Applied Molecular Genetics of fungi, J.F.Peberdy et al. write, the 1-28 pages, Cambridge University Press: In Cambridge, or More Gene Manipulations in Fungi (J.W.Bennet＆L.L.Lasure writes, The 396-428 pages:Academic Press:San Diego) in be described in detail those carriers and carrier construction method.Its Its suitable yeast vector is, such as pAG-1, YEp6, YEp13 or pEMBLYe23.In a preferred embodiment, make With expression vector pGen HT10.

In a preferred embodiment, in Chinese hamster ovary cell (CHO), COS or HEK293-F (HEK293- FreeStyle MG53 multimeric proteins) are expressed in cell.It is highly preferred that expression condition is in 5%CO₂, train in 37 DEG C of incubators Support -14 days 6 days.

The 6th day after transfection, the supernatant for collecting the various plasmid transfections of structure above carries out enzyme linked immunosorbent assay (ELISA) (ELISA) detected with polyacrylamide gel electrophoresis (SDS-PAGE), find TRIM72-S2-1 (nucleotide and amino acid sequence Correspond respectively to SEQ ID NO:19 and SEQ ID NO:25) expression quantity highest.At the same time in terms of expression quantity, signal peptide 2 (SEQ ID NO:12) it is better than signalase 11, (the SEQ ID NO of sequence 6 of optimization:7) it is optimal codon optimised sequence.

Therefore, in a preferred embodiment, optimized MG53 genes have such as SEQ ID NO:Core shown in 7 Nucleotide sequence.In another preferred embodiment, signal peptide has such as SEQ ID NO:Nucleotide sequence shown in 12. In another preferred embodiment, the MG53 expression plasmids have such as SEQ ID NO:Nucleotide sequence shown in 19. In one preferred embodiment, the polypeptide of MG53 expression plasmids coding has such as SEQ ID NO:Amino acid sequence shown in 25 Row.

The detection of the dimer form of 3.MG53 multimeric proteins

In order to detect expression status of the MG53 in eukaryotic, the plasmid that we pick high expression has carried out protein The detection of trace (Western Blot).It has been found that MG53 mainly exists (mainly with multimeric forms under non-reduced state It is the form presence of MG53 dimers), (destroy disulfide bond) in a reduction state, MG53 mainly has (figure with monomeric form 13).According to above-mentioned experiment, it is found by the applicant that in terms of expression quantity, signal peptide 2 is better than signalase 11, the sequence 6 of optimization be for The optimal codon optimised sequence of eukaryotic cell expression.Therefore, we select the highest TRIM72-S2-1 of expression quantity to carry out follow-up Experiment, with obtain express the highest MG53 polymers of yield.

4.MG53 the purifying of multimeric protein

As shown in figure 12, by using optimized MG53 expression plasmids, such as TRIM72-S2-1 transfecting eukaryotic cells are thin MG53 polymers can be expressed in born of the same parents' supernatant.However, in cell supernatant, in addition to MG53 multimeric proteins, also exist Many impurity proteins.Therefore, it is necessary to be purified to the MG53 multimeric proteins of expression, for follow-up functional study or It is used to prepare pharmaceutical composition.

Method for purifying proteins is that well known to a person skilled in the art and can use either alone or in combination. Such method is for example, using the affinity chromatography (such as A albumen or G-protein affinity chromatography) of microorganism derived protein, ion Displacement chromatography (such as displacement chromatography of cation exchange (carboxymethyl resin), anion (aminoethyl resin) and mixed mode), Close sulphur absorption (such as with beta -mercaptoethanol and other SH ligands), hydrophobic interaction or aromatics adsorption chromatography (such as with phenyl- The thermophilic sand of agarose, azepine (aza-arenophilic) resin or m- amino phenyl boric acid (m-aminophenyl boronic Acid), metal chelate affinity chromatography (such as with Ni (II)-and Cu (II)-affine material), size exclusion chromatography, it is and prefabricated Electrophoresis method (such as gel electrophoresis, Capillary Electrophoresis) (Vijayalakshmi, M.A., Appl.Biochem.Biotech.75(1998)93-102)。

In a preferred embodiment, produced using chromatography such as Q-HP column chromatographies and the purifying of Mono Q column chromatographies MG53 multimeric proteins.More than 90% purity can be obtained using Q-HP column chromatographies and the combination purifying of Mono Q column chromatographies in the application MG53 multimeric proteins (referring to Figure 14-15).The MG53 multimeric proteins of this purifying can be used for preparing dry powder formulations, spraying Preparation or gel preparation, pharmaceutical composition carry out various functions experiment.

In one embodiment, MG53 polies are included by what Q-HP column chromatography preliminary purifications were expressed in eukaryotic The cell supernatant of body protein, to remove partial impurities albumen.In a preferred embodiment, in Q-HP column chromatographies, It is 20mM Tris, pH 8.5 with reference to liquid A, eluent B is 20mM Tris and 1.0M NaCl, pH 8.5, optionally with A's and B Eluent B is solution and/or the eluent B elutions of 5% (volume ratio) in mixture.In one embodiment, GE is utilized The full-automatic tomographic systems of AKTA PURE 150M carry out Q-HP column chromatography purifying.

Preferably, be 20mM Tris, pH 8.5 with reference to liquid A in Q-HP column chromatographies, eluent B for 20mM Tris and 1.0M NaCl, pH 8.5, optionally with the solution and/or eluent B that eluent B in the mixture of A and B is 5% (volume ratio) Elution.

Carry out Q-HP column chromatographies after purification, eliminate the partial impurities albumen (figure included in MG53 multimeric proteins 14)。

In order to further improve the purity of MG53 multimeric proteins, in one embodiment, Q-HP column chromatographies are purified (eluent B is the solution of 5% (volume ratio) to obtained main eluting peak in the mixture of pH8.5, A and B, and eluent B is washed De- obtained eluting peak) carry out Mono Q column chromatographies.

In a preferred embodiment, it is 20mM phosphate buffers with reference to liquid A in Mono Q column chromatographies (PB), pH 7.0, eluent B are 20mM phosphate buffers (PB) and 1.0M NaCl, pH 7.0, optionally mixing with A and B Eluent B is that eluent B is 10%-30% (volumes in the solution of 10% (volume ratio) and/or the mixture of A and B in compound Than) gradient solution and/or eluent B elutions, be 20% (volume ratio) preferably with eluent B in the mixture of A and B Solution elutes..

The main eluting peak that Q-HP column chromatographies purify is carrying out Mono Q column chromatographies after purification, and obtained MG53 is more Glycoprotein polyprotein precursor can reach more than 90% purity (Figure 15).

In one embodiment, can by the MG53 multimeric proteins of Q-HP column chromatographies and Mono Q column chromatographies after purification It is used to prepare dry powder formulations and/or spray agent and/or gel preparation.In another embodiment, Q-HP column chromatographies are passed through It can be used for preparing with the MG53 multimeric proteins of Mono Q column chromatographies after purification and be used to preventing and/or treating heart ischemia/fill again The pharmaceutical composition of associated diseases is damaged, or for preventing and/or treating the pharmaceutical composition with ulcer relevant disease.

Expression of the 5.MG53 albumen in prokaryotic such as Escherichia coli

In order to compare MG53 in eucaryon and the expression-form of prokaryotic, we express MG53 eggs in prokaryotic In vain.Similarly, wild type MG53 genes are optimized in we.According to large intestine bar on the basis of amino acid sequence is not changed Bacterium preference codon carries out codon optimization to MG53.Codon uses optimal codon, then referring to the secondary structure of mRNA Local directed complete set, the especially more intensive place of secondary structure are carried out, makes the free energy of mRNA as high as possible, so as to be easy to translate. By optimized MG53 sequences (the SEQ ID NO for procaryotic cell expression:26) it is building up in expression vector PET-22b, and And in expression in escherichia coli MG53 albumen, expression condition is under aerobic conditions, when 37 DEG C of cultures to OD are about 6.5, is added 0.5mM IPTG are in 28 DEG C of induced expression 4h.

Afterwards, the table in prokaryotic using chromatography such as DEAE column chromatographies and CM column chromatographies (referring to Figure 10-11) purifying MG53 (the SEQ ID NO through codon optimization reached:26).Using DEAE column chromatographies and the combination purifying of CM column chromatographies in the application It can obtain the very high MG53 albumen expressed in prokaryotic of purity (referring to Figure 10-11).The MG53 albumen of this purifying Available for prepare dry powder formulations, spray agent or gel preparation, pharmaceutical composition or carry out various functions experiment.

In one embodiment, the bacterium for including MG53 albumen after DEAE column chromatography preliminary purification induced expressions is passed through Supernatant, to collect the MG53 albumen expressed in prokaryotic.In a preferred embodiment, in DEAE column chromatographies In, be 20mM Tris, pH 8.0 with reference to liquid A, eluent B is 20mM Tris and 1.0M NaCl, pH 8.0, optionally with A and The solution and/or eluent B elutions that eluent B is 5% in the mixture of B.In one embodiment, GE AKTA are utilized The full-automatic tomographic systems of PURE 150M carry out DEAE column chromatography purifying.

Carrying out DEAE column chromatographies after purification, the obtained MG53 albumen attainable 80% expressed in prokaryotic Purity.

, in one embodiment, will in order to further improve the purity for the MG53 albumen expressed in prokaryotic (eluent B is the molten of 5% (volume ratio) to the main eluting peak that DEAE column chromatographies purify in the mixture of pH8.0, A and B The eluting peak that liquid affords) carry out CM column chromatographies.

In a preferred embodiment, it is 20mM phosphate buffers (PB) with reference to liquid A in CM column chromatographies, pH 6.0, eluent B are 20mM phosphate buffers (PB) and 1.0M NaCl, pH6.0, are optionally eluted with the mixture of A and B The solution and/or eluent B for the gradient that eluent B is 10%-30% in solution and/or A and the mixture of B that liquid B is 10% Elution.

The main eluting peak that DEAE column chromatographies purify carry out CM column chromatographies after purification, obtain in prokaryotic The MG53 albumen of middle expression can reach more than 85% purity.

Expression-forms of the 6.MG53 in eukaryotic and prokaryotic

We compare expression of the MG53 in eukaryotic and prokaryotic by irreducibility polyacrylate hydrogel electrophoresis Form.Unexpectedly, the MG53 albumen expressed in prokaryotic exists with monomeric form, is expressed in eukaryotic There is (Figure 16) with multimeric forms, the mainly form of dimer in MG53 albumen.Therefore, by being expressed in eukaryotic MG53 genes, we successfully express the MG53 polymers of the application.

The pharmaceutical composition of multimeric protein comprising MG53 polymers or MG53 mutant

In one aspect, this application provides the MG53 polymers comprising the present invention or the multimeric protein of MG53 mutant Pharmaceutical composition.By pharmaceutical composition and suitable carrier, the excipient of the present invention and provide improved transfer, delivering, resistance to Prepared together by other reagents waited.A variety of suitable preparations can be found in prescription known to all pharmacists： Remington's Pharmaceutical Sciences,Mack Publishing Company,Easton,PA.These systems Agent includes such as pulvis, paste, ointment, gelling agent, wax, oil, lipid, contains vesicle (such as LIPOFECTIN^TM) lipid (sun It is ion or anion), DNA conjugates, anhydrous absorption paste, oil-in-water and water-in-oil emulsion, emulsion carbowax (different kinds of molecules The polyethylene glycol of amount), semi-solid gel and the semi-solid mixtures containing carbowax.Referring further to Powell et al., Compendium of excipients for parenteral formulations PDA(1998)J Pharm Sci Technol 52: 238-311。

The MG53 polymers or the dosage of the multimeric protein of MG53 mutant applied to patient can be according to the years of patient Age and size, target disease, situation, route of administration etc. and change.Preferable dosage is calculated generally according to weight or body surface area. According to the seriousness of illness, frequency and the duration for the treatment of can be adjusted.Using MG53 multimeric proteins or MG53 mutant Multimeric protein effective dose and timetable can rule of thumb determine；Suffer from for example, can be monitored by periodical evaluation Person's course of disease, and correspondingly adjust dosage.In addition it is possible to use method well known in the art carries out the interspecies scaling of dosage (such as Mordenti etc., 1991, Pharmaceut.Res.8:1351).

A variety of delivery systems are known and available for the pharmaceutical compositions for applying the present invention, for example, being sealed in liposome Dress, particulate, microcapsules, the recombinant cell that mutated viruses can be expressed, receptor mediated endocytosis (see, e.g., Wu etc., 1987,J.Biol.Chem.262:4429-4432).The method of importing includes but not limited to intradermal, intramuscular, peritonaeum is interior, vein Interior, subcutaneous, intranasal, Epidural cavity and oral route.Composition can be applied by any conventional route, such as by being transfused or rolling into a ball Note, applied by epithelium or mucocutaneous (for example, oral mucosa, mucous membrane of rectum and intestinal mucosa etc.), and can be with other biological Active reagent is together applied on.Using can be systemic or local.

The multimeric protein of MG53 multimeric proteins or MG53 mutant is used to prevent or treat in preparation and cell membrane damages Hinder the purposes in the pharmaceutical composition of relevant disease

As described above, MG53 has cell membrane repair function, available for prevention or treatment and cell membrane damage relevant disease, Such as leaked with myocardial cell injury relevant disease, with ulcer relevant disease, the wound with wound particularly Hard agglut wound, intestines With kidney injury etc..Wherein, may include with the relevant disease of myocardial cell injury selected from in the relevant disease of following symptom It is one or more：Myocardial ischemia, heart ischemia/reperfusion injury, miocardial infarction, heart failure, arrhythmia cordis and cardiac rupture etc.. Meanwhile include the one or more selected from following disease with ulcer relevant disease：Chronic ulcer, peptic ulcer, diabetes Ulcer, diabetic foot ulcers, diabetic foot gangrene and chronic gastric ulcer etc..

It is found by the applicant that compared to natural MG53, the polymer of MG53 polymers or MG53 mutant has stronger cell Film repair ability and Ischemic myocardium reperfusion injury ability, while insulin resistance, fertilizer caused by avoiding natural MG53 The side effect of fat, diabetes and metabolic syndrome.And compared to natural MG53, the poly of MG53 polymers or MG53 mutant Body can be treated more effectively and ulcer relevant disease.Accordingly, with respect to natural MG53, the MG53 polymers or MG53 of the application are dashed forward The polymer of variation has the function of more excellent prevention or treats above-mentioned and cell membrane damage relevant disease.

Compared to natural MG53, the MG53 polymers of the application or the polymer of MG53 mutant have stronger cell membrane Repair ability

MG53 albumen participates in protection cardiac muscle cell and/or tissue, avoid angiocardiopathy, heart ischemia/reperfusion injury, Hypoxia injury, have repair to heart failure.It has been found that the MG53 provided compared to natural MG53, the application Polymer has the repair of the cell membrane of the stronger 293T cells to mechanical damage (referring to embodiment 8, Figure 17).It is similar Ground, compared to natural MG53, the polymer for the MG53 mutant that the application provides also has the stronger 293T to mechanical damage The repair of the cell membrane of cell.

The polymer of MG53 polymers or MG53 mutant is being prepared for preventing and/or treating and myocardial cell injury phase Purposes in the pharmaceutical composition of related disorders

Due to many document reports, MG53 to heart ischemia/reperfusion injury has protective effect, we are to the application's Effect of the MG53 polymers in heart ischemia/reperfusion injury is studied.The results show that compared to MG53 native proteins (monomer), the MG53 polymers of the application are capable of the myocardial ischemia Infarct area bigger of reduction, fill before myocardial ischemia or again Preceding apply can more effectively Ischemic myocardium/reperfusion injury (referring to embodiment 9).

The polymer of the MG53 mutant of the application also play the role of it is similar, compared to MG53 native proteins (monomer), this The poly physical efficiency of the MG53 mutant of application more effectively Ischemic myocardium/reperfusion injury.

Therefore, in another aspect, the MG53 polymers or the polymer of MG53 mutant that the application provides can be used for making It is ready for use on prevention and/or treatment and the medicine of myocardial cell injury relevant disease.In a preferred embodiment, with cardiac muscle The relevant disease of cellular damage includes the one or more selected from following disease：Myocardial ischemia, heart ischemia/reperfusion injury, the heart Muscle infarction, heart failure, arrhythmia cordis, cardiac rupture.

The polymer of MG53 polymers or MG53 mutant does not cause the side effects such as insulin resistance

As described above, MG53 can produce protective effect to heart, that is to say, that can be protected by increasing the content of MG53 Protect heart injury.But find afterwards, the MG53 of incrementss while cardioprotection, insulin resistance, obesity, sugar can be caused Urine disease and metabolic syndrome.Therefore, MG53 is comprehensive with insulin resistance, obesity, diabetes and metabolism while cardioprotection The side effect of simulator sickness.This area is intended to that function of the MG53 albumen in terms of cardioprotection can be retained, but does not cause pancreas islet at the same time The side effect of element resistance, fat, diabetes and metabolic syndrome.

In this regard, applicant is investigated whether MG53 polymers are similar to natural MG53 monomeric proteins, also cause insulin The side effect of resistance, fat, diabetes and metabolic syndrome.

Especially, it is found by the applicant that compared to natural MG53 monomeric proteins, there is MG53 polymers stronger cell membrane to repair Reactivation power and Ischemic myocardium reperfusion injury ability, while insulin resistance, obesity, sugar caused by avoiding natural MG53 The side effect of urine disease and metabolic syndrome.

It has been found that compared to wild type MG53, the MG53 polymers of the application will not cause the rise of blood glucose (referring to Embodiment 10, Figure 18).Similar to MG53 polymers, compared to natural MG53 monomeric proteins, the MG53 mutant of the application it is more Aggressiveness has stronger cell membrane repair ability and Ischemic myocardium reperfusion injury ability, while avoids natural MG53 and lead The side effect of the insulin resistance of cause, obesity, diabetes and metabolic syndrome.

It follows that the MG53 polymers of the application or the polymer of MG53 mutant are exercising the same of Cardioprotective function When, the side effect of insulin resistance, obesity, diabetes and metabolic syndrome will not be caused.

The polymer of MG53 polymers or MG53 mutant prepare be used for prevent and/or treat with ulcer relevant disease Pharmaceutical composition in purposes

As described above, skin ulcer is the local organization defect as caused by a variety of causes.Suffer from more than the 2 weeks surface of a wound of ulcer not to be cured Conjunction person, is chronic ulcer of skin.The usual course of disease of chronic ulcer of skin is longer, and therapeutic advance is slow, to the body and spirit of patient Very big pain is all brought, very big influence is caused to the quality of life of patient.Diabetic and lower limb vascular disease are suffered from Person is the group of people at high risk of chronic ulcer of skin.Skin ulcer can be divided into wound infection ulcer, repressive by different pathogenic factors Ulcer, venous ulcer, diabetes and leg ulcer etc..

The main method of chronic ulcer of skin treatment is to carry out systemic drug treatment (as using antibiotic and using Chinese medicine Deng), the surgery of surface of a wound processing (such as part debridement and anti-infective medication) and locally accelerate wound healing measure.Promote body surface wound The method of face healing is more, local using external application of Chinese medicine etc. such as physical therapies such as the use of growth-factor medication, laser, but now The clinical efficacy of some treatment methods is unsatisfactory.

The cause of disease of diabetic foot gangrene is complicated, it can be caused by malnutritive, atherosclerosis and wound.Diabetes Although vascular lesion is extensive, pathological development is slow, is conducive to the formation with Doppler flow mapping, if early stage progress can be formed in gangrene Active treatment, promotes the new life of blood vessel and epidermal cell, can effectively alleviate or cure gangrene.Topica used at present Thing, such as gentamicin, can suppress local bacterial growth, but cannot promote wound healing very well, and Chinese medicine promoting muscle growth functions week Phase is grown, less effective.Although epidermal growth factor has certain effect, but many patients use, and clinical manifestation is still invalid.

The effect of existing medicine currently used for treating ulcer, especially chronic ulcer of skin is not ideal.Although It is routed to be possibly used for treatment for composition of the prompting comprising MG53 in some documents, such as CN103275980A and CN101511181B Ulcer, but do not carry out the experimental study of MG53 treatment ulcer in the prior art.

It has been found that compared to MG53 monomers, the MG53 polymers that the application provides are to ulcer especially chronic ulcer There is more significant therapeutic effect (Figure 19-20) with peptic ulcer.For example, MG53 polymers have the effect that：

1) fibroblast proliferation at diabetic foot ulcer can be effectively facilitated, is conducive to diabetic foot ulcer and leg is burst Ulcer heals；

2) compared to MG53 monomers, diabetic foot ulcer wound healing is more effectively promoted；

2) compared to MG53 monomers, chronic gastric ulcer wound healing is more effectively promoted；

3) compared to MG53 monomers, people's diabetic foot ulcers and gangrene are more effectively treated.

Similar to MG53 polymers, the polymer of the MG53 mutant that the application provides to ulcer especially chronic ulcer and Peptic ulcer such as diabetic foot ulcer, diabetic foot ulcers, diabetic foot ulcers, diabetic foot gangrene and chronic stomach Ulcer has more significant therapeutic effect.

Therefore, the application provide MG53 polymers or MG53 mutant polymer can be used for prepare be used for prevent and/ Or treatment and the pharmaceutical composition in ulcer relevant disease.In a preferred embodiment, it is slow with ulcer relevant disease Property ulcer and peptic ulcer.In a preferred embodiment, chronic ulcer and peptic ulcer include being selected from following disease The one or more of disease：Diabetic foot ulcer, diabetic foot ulcers, diabetic foot ulcers, diabetic foot gangrene and chronic Gastric ulcer etc..

In addition, the application provide MG53 polymers or MG53 mutant polymer can be used for prepare be used for prevent and/ Or treatment and cell membrane damage relevant disease, such as the leakage of the wound with wound particularly Hard agglut wound, intestines and kidney injury Deng pharmaceutical composition.

The dry powder formulations of the polymer of MG53 polymers or MG53 mutant, spray agent, the system of coacervate formulation and emulsion It is standby

Present invention also provides MG53 monomers (such as the MG53 monomeric proteins expressed in prokaryotic) or the application Dry powder formulations, spray agent, coacervate formulation and the emulsion of the polymer of MG53 polymers or MG53 mutant.Meanwhile also provide The preparation methods of these preparations.These protein formulation forms more easily can be transported and preserved.

The common auxiliary material known in the art for stablizing protein solution.Specifically there are following a few classes：

1. polyol

The mechanism of action：Make protein surface formed water membrane, protected protein matter from external hydrophobic invasion, from And achieve the purpose that to protect Proteins In Aqueous Solutions.

Specific auxiliary material is for example：Glycerine, mannitol, sorbierite, inositol, polyethylene glycol.

2. carbohydrate

The mechanism of action：The change of secondary protein structure is prevented, stretching, extension and aggregation to polypeptide chain shield.

Specific auxiliary material is for example：Sucrose, glucose, lactose, trehalose, mannose, maltose etc..

3. surfactant

The mechanism of action：Ionic surfactant (such as lauryl sodium sulfate) can influence the denaturation of protein；But right and wrong Ionic surfactant (such as Tween 80) can prevent protein to be adsorbed in surface, thus can suppress the cohesion of protein and sink Form sediment.

Specific auxiliary material is for example：Tween 80, lauryl sodium sulfate.

4. polymer

The mechanism of action：Prevent protein or other auxiliary materials from crystallizing and separating out, the diffusion of restriction molecule

Specific auxiliary material：Polyethylene glycol, polyvinylpyrrolidone.

Therefore, these common auxiliary materials can be used as preparing MG53 polymers or the MG53 mutation comprising MG53 monomers or the application The auxiliary material of the dry powder formulations of the polymer of body.

In a preferred embodiment, suitable freeze-drying condition is：

(1) pre-freeze is kept for 2 hours to -45 DEG C, forvacuum to 12 ± 2Pa,

- 6 DEG C are warming up within (2) 90 minutes, is kept for 10 hours,

(3) 1 are warming up to 15 DEG C, when holding 5 is small when small,

(4) it is further dried.

Hydro-acupuncture preparation, refers to the parenteral solution for having dissolved medicine.It is one kind of injection, is generally housed within container for example In ampoule bottle, in use, knocking container open into row vein or intramuscular injection.

(2) pH value is adjusted, and is filtered,

Sequence information used in this application is as follows：

SEQ ID NO:1.MG53 native codon sequences

SEQ ID NO:2. the MG53 codon optimised sequences 1 for eukaryotic cell expression

SEQ ID NO:3. the MG53 codon optimised sequences 2 for eukaryotic cell expression

SEQ ID NO:4. the MG53 codon optimised sequences 3 for eukaryotic cell expression

SEQ ID NO:5. the MG53 codon optimised sequences 4 for eukaryotic cell expression

SEQ ID NO:6. the MG53 codon optimised sequences 5 for eukaryotic cell expression

SEQ ID NO:7. the MG53 codon optimised sequences 6 for eukaryotic cell expression

SEQ ID NO:8. the MG53 codon optimised sequences 7 for eukaryotic cell expression

SEQ ID NO:9. the MG53 codon optimised sequences 8 for eukaryotic cell expression

SEQ ID NO:10. the MG53 codon optimised sequences 9 for eukaryotic cell expression

SEQ ID NO:11. signalase 11

SEQ ID NO:12. signal peptide 2

SEQ ID NO:The nucleotide sequence of 13.TRIM72-S1-1

SEQ ID NO:The nucleotide sequence of 14.TRIM72-S1-2

SEQ ID NO:The nucleotide sequence of 15.TRIM72-S1-3

SEQ ID NO:The nucleotide sequence of 16.TRIM72-S1-4

SEQ ID NO:The nucleotide sequence of 17.TRIM72-S1-5

SEQ ID NO:The nucleotide sequence of 18.TRIM72-S1-N

SEQ ID NO:The nucleotide sequence of 19.TRIM72-S2-1

SEQ ID NO:The nucleotide sequence of 20.TRIM72-S2-2

SEQ ID NO:The nucleotide sequence of 21.TRIM72-S2-3

SEQ ID NO:The nucleotide sequence of 22.TRIM72-S2-4

SEQ ID NO:The nucleotide sequence of 23.TRIM72-S2-5

SEQ ID NO:The nucleotide sequence of 24.TRIM72-S2-N

SEQ ID NO:The amino acid sequence of 25.TRIM72-S2-1

SEQ ID NO:26. the MG53 codon optimised sequences for procaryotic cell expression.

Embodiment

Following embodiments are provided, to help to understand the present invention, give the real of the present invention in the following claims Scope.It should be appreciated that without departing from the spirit of the invention, it can modify to the method provided.

Embodiment 1：For expressing the optimization of MG53 genes and the selection of signal peptide of MG53 polymers

It is the reagent and its source used in MG53 plasmids are built below：

Experiment reagent：

PBO enzyme sources：Genscript lot numbers：C20041502

Taq enzyme source：Genscript lot numbers：C20091508

DNTP sources：Genscript lot numbers：C51081507

T4DNA connection enzyme sources：Thermo scientific lot numbers：00309971

Recombinase (Clone EZ Enzyme) source：Genscript lot numbers：10/15/2015

Competent cell source：Genscript lot numbers：20150921

Experimental water source：DdH2O lot numbers：10/13/2015

Restriction endonuclease EcoRI-HF sources：NEB lot numbers：0101504

Restriction endonuclease Hind III-HF sources：NEB lot numbers：0061504

The equipment used in MG53 plasmids are built and its source are listed in following table

The equipment and its source that table 2. uses in MG53 plasmids are built

1.1 are used for the structure of the MG53 plasmids through codon optimization of eukaryotic CHO expression

The codon optimization of 1.11 wild type MG53 plasmids

It is to promote expression of the MG53 polymers in eukaryotic CHO and facilitate its purifying, we are to wild type MG53 bases Because carrying out codon optimization.Specifically, we obtain 9 kinds of optimized MG53 genes.

1.MG53 gene optimizations, synthesis and the preparation of MG53 subclones and plasmid：

MG53 is carried out by codon optimization, Chinese hamster ovary according to Chinese hamster ovary cell (CHO) preference codon Cell (CHO) codon usage frequency refers to Codon Usage Database (http://www.kazusa.or.jp/ codon/).Synthetic Gene Designer (http are used on the basis of amino acid sequence is not changed:// Www.evolvingcode.net/codon/sgd/index.php), codon uses optimal codon, then referring to mRNA's Secondary structure carries out local directed complete set, the especially more intensive place of secondary structure, makes the free energy of mRNA as high as possible, so that easily In translation.

Meanwhile be to promote expression of the MG53 polymers in eukaryotic CHO and facilitate its purifying, we compare two kinds Signal peptide, i.e. signalase 11 and signal peptide 2, is suitable for the letter of the high-yield expression MG53 polymers in eukaryotic CHO with screening Number peptide.

In order to screen the MG53 optimization genes and signal peptide that are best suited for expressing and purify in eukaryotic CHO, we Devise following gene order：

HindIII-Kozak sequences-signalase 11 or 2---MG53 optimization Codon sequences or wild-type sequence (sequence 1- 9 or natural MG53 sequences)-terminator codon-EcoRI.Kozak sequences are GCCGCCACC.

Detailed cloning approach and the gene order of optimization are as follows：

MG53 native codon sequences：

ATGTCGGCTGCGCCCGGCCTCCTGCACCAGGAGCTGTCCTGCCCGCTGTGCCTGCAGCTGTTCGACGCG CCCGTGACAGCCGAGTGCGGCCACAGTTTCTGCCGCGCCTGCCTAGGCCGCGTGGCCGGGGAGCCGGCGGCGGATGG CACCGTTCTCTGCCCCTGCTGCCAGGCCCCCACGCGGCCGCAGGCACTCAGCACCAACCTGCAGCTGGCGCGCCTGG TGGAGGGGCTGGCCCAGGTGCCGCAGGGCCACTGCGAGGAGCACCTGGACCCGCTGAGCATCTACTGCGAGCAGGAC CGCGCGCTGGTGTGCGGAGTGTGCGCCTCACTCGGCTCGCACCGCGGTCATCGCCTCCTGCCTGCCGCCGAGGCCCA CGCACGCCTCAAGACACAGCTGCCACAGCAGAAACTGCAGCTGCAGGAGGCATGCATGCGCAAGGAGAAGAGTGTGG CTGTGCTGGAGCATCAGCTGGTGGAGGTGGAGGAGACAGTGCGTCAGTTCCGGGGGGCCGTGGGGGAGCAGCTGGGC AAGATGCGGGTGTTCCTGGCTGCACTGGAGGGCTCCTTGGACCGCGAGGCAGAGCGTGTACGGGGTGAGGCAGGGGT CGCCTTGCGCCGGGAGCTGGGGAGCCTGAACTCTTACCTGGAGCAGCTGCGGCAGATGGAGAAGGTCCTGGAGGAGG TGGCGGACAAGCCGCAGACTGAGTTCCTCATGAAATACTGCCTGGTGACCAGCAGGCTGCAGAAGATCCTGGCAGAG TCTCCCCCACCCGCCCGTCTGGACATCCAGCTGCCAATTATCTCAGATGACTTCAAATTCCAGGTGTGGAGGAAGAT GTTCCGGGCTCTGATGCCAGCGCTGGAGGAGCTGACCTTTGACCCGAGCTCTGCGCACCCGAGCCTGGTGGTGTCTT CCTCTGGCCGCCGCGTGGAGTGCTCGGAGCAGAAGGCGCCGCCGGCCGGGGAGGACCCGCGCCAGTTCGACAAGGCG GTGGCGGTGGTGGCGCACCAGCAGCTCTCCGAGGGCGAGCACTACTGGGAGGTGGATGTTGGCGACAAGCCGCGCTG GGCGCTGGGCGTGATCGCGGCCGAGGCCCCCCGCCGCGGGCGCCTGCACGCGGTGCCCTCGCAGGGCCTGTGGCTGC TGGGGCTGCGCGAGGGCAAGATCCTGGAGGCACACGTGGAGGCCAAGGAGCCGCGCGCTCTGCGCAGCCCCGAGAGG CGGCCCACGCGCATTGGCCTTTACCTGAGCTTCGGCGACGGCGTCCTCTCCTTCTACGATGCCAGCGACGCCGACGC GCTCGTGCCGCTTTTTGCCTTCCACGAGCGCCTGCCCAGGCCCGTGTACCCCTTCTTCGACGTGTGCTGGCACGACA AGGGCAAGAATGCCCAGCCGCTGCTGCTCGTGGGTCCCGAAGGCGCCGAGGCCTGA

Using the MG53 optimizations of signalase 11：

HindIII-Kozak sequences-signalase 11 --- MG53 optimizes Codon sequences or natural MG53 sequences (sequence 1-5 Or natural MG53 sequences)-terminator codon-EcoRI

The native sequences of MG53 are used in wherein TRIM-SI-N (see Fig. 2).

Using the MG53 optimizations of signal peptide 2：

HindIII-Kozak sequences-signal peptide 2---MG53 optimization Codon sequences or natural MG53 sequences (sequence 6-9 With 5 or natural MG53 sequences)-terminator codon-EcoRI

The native sequences of MG53 are used in wherein TRIM-S2-N (see Fig. 3).

According to the gene order of above-mentioned design, trust money Si Rui biotechnologies company carries out full genome synthesis.For eucaryon The comparison of the wild type MG53 and optimized MG53 codons of cell CHO expression are found in Fig. 4.

1.12 are used for the clone of the MG53 through codon optimization of eukaryotic CHO expression

By the MG53 genes through codon optimization for being used for eukaryotic CHO expression of synthesis

It is connected to corresponding cloning vector pUC57.Using pUC57 plasmids as carrier into the MG53 for codon optimization of passing through With the clone of wild type MG53 plasmids.PUC57 plasmids size is 4.3KB, and the plasmid map of pUC57 is shown in Fig. 6 A.By scheming Spectrum understands that pUC57 plasmids have EcoRI and Hind III multiple cloning sites.

PUC57 plasmids are bought from Jin Sirui biotechnologies company.

PUC57 plasmids and the optimized MG53 sequences of synthesis are subjected to EcoRI and Hind III double digestions at the same time, then With reference to Shanghai life work plastic recovery kit (article No. SK8131 100BP-10KB) specification recycling digestion after MG53 sequences and PUC57 plasmids.Glue reclaim step is as follows：

1) purpose fragment of 5.5kb and 1.47kb or so is cut off from agarose gel, weigh about 0.2g；

2) 3 times of Buffer B2,50 DEG C water-bath 5min colloidal sols are added；.

3) sol solutions are moved into adsorption column, 8,000 × g is centrifuged 30 seconds, outwells liquid in collecting pipe；

4) 500ul wash solution 9 are added, 000 × g is centrifuged 30 seconds, outwells liquid in collecting pipe；

5) suction attached column centrifuges 1min in 9,000 × g；

6) adsorption column is put in the 1.5ml centrifuge tubes of a sterilizing, adds 50ul Elution buffer, room temperature is quiet 1min is put, is preserved stand-by.

The optimized MG53 and pUC57 after digestion is connected with T4 ligases.It is afterwards that connection product transformed competence colibacillus is thin Born of the same parents XL10-Gold.

Finally, the MG53 through codon optimization for being used for eukaryotic CHO expression that is built by sequencing identification and wild Type MG53 plasmids.Specifically, MG53 plasmids are coated on second day picking individual colonies after amicillin resistance LB tablets, shaken Bacterium, extraction plasmid send Beijing three to win polygala biotech firm and are sequenced.As a result the plasmid proved be optimized MG53 and Wild type MG53 plasmids.So far the clone of optimized MG53 and wild type MG53 gene orders is completed.

1.13 are used for the codon optimization of the MG53 of prokaryotic Bacillus coli expression

In order to which preferably in prokaryotic such as expression in escherichia coli MG53 albumen, it is excellent that we have carried out codon to MG53 Change.MG53 is carried out by codon optimization according to Escherichia coli preference codon, e. coli codon frequency of use refers to Codon Usage Database(http://www.kazusa.or.jp/codon/).Used on the basis of amino acid sequence is not changed Synthetic Gene Designer(http://www.evolvingcode.net/codon/sgd/index.php), password Son uses optimal codon, and local directed complete set, the especially more intensive ground of secondary structure are carried out then referring to the secondary structure of mRNA Side, makes the free energy of mRNA as high as possible, so as to be easy to translate.

Detailed cloning approach and the gene order of optimization are as follows：

NdeI---- codon optimised sequences-XhoI

MG53 native codons sequence (SEQ ID NO:1)：

MG53 codon optimised sequences (SEQ ID NO for procaryotic cell expression:26)：

ATGAGCGCAGCACCGGGTCTGCTGCATCAAGAACTGAGCTGTCCGCTGTGTCTGCAGCTGTTTGATGCA CCGGTTACCGCAGAATGTGGTCATAGCTTTTGTCGTGCATGTCTGGGTCGTGTTGCCGGTGAACCGGCAGCAGATGG CACCGTTCTGTGTCCGTGTTGTCAGGCACCGACCCGTCCGCAGGCACTGAGCACCAATCTGCAGCTGGCACGTCTGG TTGAAGGTCTGGCACAGGTTCCGCAGGGTCATTGTGAAGAACATCTGGACCCGCTGAGCATTTATTGTGAACAGGAT CGTGCACTGGTTTGTGGTGTTTGTGCAAGCCTGGGTAGCCATCGTGGTCATCGTCTGCTGCCTGCAGCCGAAGCACA TGCACGTCTGAAAACCCAGCTGCCGCAGCAGAAACTGCAGCTGCAAGAAGCATGTATGCGTAAAGAAAAAAGCGTTG CAGTTCTGGAACATCAGCTGGTTGAAGTTGAAGAAACCGTTCGTCAGTTTCGTGGTGCAGTTGGTGAACAGCTGGGT AAAATGCGTGTTTTTCTGGCAGCACTGGAAGGTAGCCTGGATCGTGAAGCAGAACGTGTTCGTGGTGAAGCCGGTGT TGCACTGCGTCGTGAACTGGGTAGCCTGAATAGCTATCTGGAACAGCTGCGTCAGATGGAAAAAGTTCTGGAAGAAG TTGCAGATAAACCGCAGACCGAATTTCTGATGAAATATTGTCTGGTTACCAGCCGTCTGCAGAAAATTCTGGCAGAA AGTCCGCCTCCGGCACGTCTGGATATTCAGCTGCCGATTATTAGTGATGATTTTAAATTTCAGGTGTGGCGCAAAAT GTTTCGTGCACTGATGCCTGCACTGGAAGAACTGACCTTTGATCCGAGCAGCGCACATCCGAGCCTGGTTGTTAGCT CTAGCGGTCGTCGTGTTGAATGTAGCGAACAGAAAGCACCTCCGGCAGGCGAAGATCCGCGTCAGTTTGATAAAGCA GTTGCAGTTGTTGCCCATCAGCAGCTGAGCGAAGGTGAACATTATTGGGAAGTTGATGTTGGTGATAAACCGCGTTG GGCACTGGGTGTTATTGCAGCGGAAGCACCGCGTCGTGGTCGTCTGCATGCAGTTCCGAGCCAGGGTCTGTGGCTGC TGGGTCTGCGTGAAGGTAAAATTCTGGAAGCCCATGTTGAAGCAAAAGAACCGCGTGCACTGCGTAGTCCGGAACGT CGTCCGACCCGTATTGGTCTGTATCTGAGCTTTGGTGATGGTGTTCTGAGCTTTTATGATGCAAGTGATGCAGATGC ATTAGTACCGCTGTTTGCATTTCATGAACGTCTGCCTCGTCCGGTTTATCCGTTTTTTGATGTTTGCTGGCATGATA AAGGCAAAAATGCACAGCCGCTGCTGCTGGTTGGTCCGGAAGGTGCAGAAGCATAA

According to above-mentioned MG53 codon optimised sequences, commission Nanjing Jin Sirui biotech firms carry out being used for procaryotic cell expression (the SEQ ID NO of the MG53 sequences after codon optimization:26) _ fully synthetic.Wild type MG53 and optimized to be used for protokaryon thin The comparison of the MG53 codons of cellular expression is found in Fig. 5.

1.14 will connect for the MG53 through codon optimization that eukaryotic CHO is expressed with wild type MG53 gene orders Into carrier for expression of eukaryon pGen HT10

PGen HT10 plasmids size is 12.6KB, and pGen HT10 plasmid maps are shown in Fig. 6 A.From collection of illustrative plates, PGen HT10 have EcoR I and Hind III multiple cloning sites.

By plasmid and expression vector with the correct MG53 through codon optimization for eukaryotic CHO expression PGen HT10 EcoRI and Hind III double digestions.PGenHT10 carriers are bought from Jin Sirui biotechnologies company.Return afterwards Receive MG53 sequences and pGen HT10 plasmids through digestion.The MG53 through digestion is connected (including for eukaryotic with T4 ligases The optimized MG53 and wild type MG53 of CHO expression) and pGen HT10.It is same carry out the conversion similar with above-mentioned clone and Bacterium colony screens.Screening obtains purpose bacterium colony after sequencing analysis and processing.Finally cultivate purpose bacterium colony and carry out plasmid extraction. The plasmid of extracting verifies (Fig. 7) by EcoRI and Hind III double digestions, will verify that correct plasmid is expressed for cell transfecting MG53 polymers.

1.15 MG53 (the SEQ ID NO through codon optimization that will be expressed for prokaryotic Escherichia coli BL-21:26) It is connected in prokaryotic expression carrier PET-22b plasmids

Using PET-22b plasmids as prokaryotic expression carrier into MG53 (the SEQ ID NO for codon optimization of passing through:26) matter The structure of grain.PET-22b plasmids size is 5.5KB, and PET-22b plasmid maps are shown in Fig. 6 B.From collection of illustrative plates, PET- 22b has NdeI and XhoI multiple cloning sites.

The purchase of PET-22b plasmids is transformed into from after Novagen companies, purchase in BL-21 competent cells, applies tablet (ammonia Parasiticin resistance), monoclonal is selected, plasmid is extracted according to Tiangeng plasmid extraction specification step.With NotI single endonuclease digestions PET- 22b plasmids, carry out 0.8% Ago-Gel afterwards, verify that the size of PET-22b plasmids is correct, are 5.5KB (Fig. 8 A).

At the same time by PET-22b plasmids and synthesis be used for prokaryotic Escherichia coli BL-21 expression through codon optimization MG53 (SEQ ID NO:26) sequence carries out NdeI and XhoI double digestions, is then used for protokaryon after recycling digestion as described above MG53 (the SEQ ID NO through codon optimization of cell E. coli BL-21 expression:26) sequence and PET-22b plasmids (figure 8).MG53 (the SEQ ID NO through codon optimization after digestion are connected with T4 ligases:26) and PET-22b, by connection product Conversion and bacterium colony screening are carried out, and the bacterium colony to screening carries out NdeI and XhoI double digestions and sequencing analysis, it is determined whether be MG53 (SEQ ID NO through codon optimization:26) sequence.

Send Beijing three to win polygala biotech firm the plasmid built to be sequenced, the plasmid as a result proved is through close MG53 (the SEQ ID NO of numeral optimization:26) sequence plasmid.So far complete in prokaryotic Escherichia coli BL-21 MG53 (the SEQ ID NO through codon optimization of expression:26) structure.

Embodiment 2：Expression and purifying and warp of the optimized MG53 plasmids and wild type MG53 in eukaryotic CHO MG53 (the SEQ ID NO of codon optimization:26) expression in prokaryotic Escherichia coli BL-21

2.1 MG53 (the SEQ ID NO through codon optimization:26) expression in prokaryotic Escherichia coli BL-21

We have detected MG53 (the SEQ ID NO through codon optimization:26) in prokaryotic Escherichia coli BL-21 Expression.

The culture medium used during expression is as follows：

1) shaking table culture base (400ml)：LB culture mediums (tryptone 2%；Dusty yeast 1%；Sodium chloride 2%；100μg/ml Amp 1%)；

2) fermentation medium (5L)：(tryptone 12%；Dusty yeast 24%；Glycerine 4ml/L；Dipotassium hydrogen phosphate 16.4%； Potassium dihydrogen phosphate 2.32%；100 μ g/ml Amp 1%).

3) supplemented medium：50% glycerine.Supplemented medium is used for the required carbon source of afterfermentation later stage thalline and energy Source.

In the middle and later periods of fermentation process, mended after carbon source and energy consumption in the fermentation medium are complete using supplemented medium Fill the required carbon source of thalline and the energy.

MG53 (the SEQ ID through codon optimization are expressed in prokaryotic Escherichia coli BL-21 according to following steps NO:26)：

1) activation is used for MG53 (the SEQ ID NO through codon optimization of prokaryotic Escherichia coli BL-21 expression:26) Strain

With 0.2% inoculum concentration by MG53 (the SEQ ID NO through codon optimization:26) plasmid is inoculated into shaking table culture base, In 160rpm, 36 DEG C are incubated overnight to OD about 0.6 or so.Obtained bacterium solution is seeded to fermentation tank afterwards.

2) (the SEQ ID NO of the MG53 through codon optimization:26) expression

Cultivate MG53 (the SEQ ID NO through codon optimization under the following conditions in fermentation tank:26) bacterium solution：Rotating speed 300rpm, 37 DEG C of cultivation temperature, originates air mass flow 2L/min, maintains dissolved oxygen amount (DO) more than 20%, pH7.0 or so.When The OD values of bacterium solution reach about 6.5 or so, are cooled to 28 DEG C；Add 0.5mM IPTG inductions 4h.

3) using sds page (SDS PAGE) electrophoresis detection MG53 albumen in prokaryotic Escherichia coli Expression in BL-21

Prepare the sample of SDS-PAGE loadings：

Bacterium solution before inducing, the bacterium solution of 2h and 4h after induction are taken, and by centrifuging, obtains bacterial sediment.With 20~40 μ L PBS (pH=8.0) are resuspended, and add isometric 2 × SDS sample-loading buffers, boil heating 5min；

Carry out sds page (SDS-PAGE) electrophoretic separation；

After when coomassie brilliant blue staining 3 is small, decoloration observation result.The results are shown in Figure 9.From SDS-PAGE, in 5L Fermentation volume under, MG53 albumen expression in prokaryotic Escherichia coli BL-21 is higher, the bacterium after induced expression There is the expression of very high level in supernatant and bacterial cell (inclusion body).

The purifying of the 2.2 MG53 albumen expressed in prokaryotic e. coli bl21

From the foregoing, it will be observed that MG53 (the SEQ ID NO through codon optimization:26) in Escherichia coli BL-21 bacterial supernatants and There is the expression of very high level in bacterial cell.But no matter in supernatant and bacterial cell, in addition to MG53 albumen, also exist Many impurity proteins.Therefore, it is necessary to be purified to the MG53 albumen of expression, for follow-up functional study.

The 2.21 MG53 albumen expressed by the purifying of DEAE column chromatographies in prokaryotic Escherichia coli BL-21

The MG53 albumen purified first with DEAE column chromatographies after the induced expression in prokaryotic Escherichia coli BL-21 is thin Bacterium supernatant.DEAE column chromatographies are carried out using the full-automatic tomographic systems of GE AKTA PURE 150M and carry out preliminary purification, to collect The MG53 albumen expressed in prokaryotic Escherichia coli BL-21.

The reagent and device used in DEAE column chromatographies：

Chromatographic column：Volume 50ml (prepacked column 26*20cm)

Chromatography buffer：

With reference to liquid A：20mM Tris, pH 8.0

Eluent B：20mM Tris+1.0M NaCl, pH 8.0

DEAE column chromatography purifying is carried out by following steps：

Prepare sample：

The MG53 albumen thalline 189g after above-mentioned induced expression are taken to be mixed in 1900ml combination liquid A.Every glass adds combination Liquid A 370ml, 8 DEG C with 10000rpm centrifuge 15min, altogether centrifuge 5 times, take supernatant to prepare sample；

DEAE column chromatographies：

Sample loading after 0.45um membrane filtrations, loading flow velocity 2ml/min.It is with eluent B in the mixture of A and B The solution of 5% (volume ratio), eluent B elutions, obtain the solution that eluent B in the mixture of A and B is 5% (volume ratio) The eluting peak of pH8.0 is respectively 380ml and 190ml；

SDS-PAGE

Polyacrylamide gel (SDS-PAGE) electrophoresis is carried out to the eluting peak that DEAE column chromatographies obtain as described above, with mirror Determine the purity of MG53 albumen expressed after DEAE column chromatographies in prokaryotic Escherichia coli BL-21.

As shown in Figure 10, purified by DEAE column chromatographies, eliminate most impurity protein, obtain in prokaryotic The MG53 albumen expressed in Escherichia coli BL-21 can reach 80% purity.

The 2.22 MG53 albumen expressed by the purifying of CM column chromatographies in prokaryotic Escherichia coli BL-21

In order to further improve the purity of MG53 albumen, main eluting peak that DEAE column chromatographies are purified (eluting peak that eluent B affords for the solution of 5% (volume ratio) in the mixture of pH8.0, A and B) carries out CM column chromatographies.

The reagent and device used in CM column chromatographies：

Chromatographic column：Volume 25ml (prepacked column 26*20cm)

Chromatography buffer：

With reference to liquid A：20mM phosphate buffers (PB), pH 6.0

Eluent B：20mM phosphate buffers (PB)+1.0M NaCl, pH 6.0

CM column chromatography purifying is carried out by following steps：

CM column chromatographies：

It is 5% (volume ratio) by eluent B in the mixture of pH8.0, A and B for being obtained in the purifying of DEAE column chromatographies Loading after solution eluting peak merges, loading and/or elution are carried out with the flow velocity of 8ml/min.With eluent B in the mixture of A and B Rinsed for 10% solution, the solution using eluent B in the mixture of A and B as the gradient of 10%-30% elutes 6 columns afterwards Volume (6CV) common 300ml, is finally eluted with eluent B.It is the molten of 20% (volume ratio) with eluent B in the mixture of A and B The volume of eluting peak A, B that liquid elution obtains are respectively 42ml and 51ml.

SDS-PAGE

Polyacrylamide gel (SDS-PAGE) electrophoresis is carried out to the eluting peak that CM column chromatographies obtain as described above, with identification The purity of the MG53 albumen of procaryotic cell expression after CM column chromatographies.

As shown in figure 11, it is further purified by CM column chromatographies, the MG53 expressed in prokaryotic Escherichia coli BL-21 The purity of albumen further improves, and can reach 85% purity.Using the purified MG53 albumen from procaryotic cell expression as MG53 standard items, the positive control of the MG53 polymers as eukaryotic cell expression.It is pure by DEAE column chromatographies and CM column chromatographies The MG53 albumen expressed in prokaryotic Escherichia coli BL-21 after change can be used for preparing dry powder formulations and/or spray agent And/or gel preparation, it can also be used to prepare the medicine group for being used for preventing and/or treat heart ischemia/reperfusion injury associated diseases Compound, or for preventing and/or treating the pharmaceutical composition with ulcer relevant disease.

Expression of the 2.3 optimized MG53 and wild type MG53 in Chinese hamster ovary cell (CHO) cell

In order to express MG53 albumen, we express the optimized MG53 and wild type of structure in eukaryotic example CHO MG53 plasmids.

Experiment consumptive material used in 2.31

15ml centrifuge tubes (Corning, Cat#：430790, Lot#：13215601)

100mm × 20mm culture dishes (10cm dish) (Corning, Cat#：430167, Lot#：10315601)

1ml pipettes (Corning, Cat#：4485,Lot#：04415014)

5ml pipettes (Corning, Cat#：4487,Lot#：31614013)

10ml pipettes (Corning, Cat#：4488,Lot#：16114013)

500ml filters (Corning, Cat#：431097,Lot#：06315002)

125ml shaking flasks (Corning, Cat#：431143,Lot#：02115001)

6 orifice plate (Corning, Cat#：3516,Lot#：0411560103)

Electric revolving cup (BIO-RAD, Cat#：165-2088,Lot#：14038996)

96 hole elisa Plates (Corning, Cat#：9018, Lot#：20512006)

Domestic 1.5mlEP manages (Haimen City three and Jian Hua Bo Su instrument plants)

Domestic 15mlEP manages (Haimen City three and Jian Hua Bo Su instrument plants)

Domestic 50ml conical centrifuge tubes (Haimen City three and Jian Hua Bo Su instrument plants)

2.32 experiment reagent

CD CHO(GIBCO,Cat#：10743-029,Lot#：1663125)

Opti-MEM I(GIBCO,Cat#：31985,Lot#：1627186)

L-Glutamine 200mM solution (L-Glutamine 200mM solution) (HYCLONE, Cat#： SH30034.02,Lot#：AZM197309)

Anti-coagulants (Anti-Clumping Agent) (Invitrogen, Cat#：0010057DG Lot#：1676315)

ELISA reagents (CUSABIO, cat#：CSB-EL024511HU)

BSA (Shanghai pool weighing apparatus)

0.1%PBST：1000ml PBS+1ml Tween-20

5 × sample-loading buffer (5 × loading buffer) (hereinafter referred to as R):0.1g SDS, 0.78gDTT, 0.05g bromines Phenol is blue, and 5.0ml glycerine, 2.5ml 1mol/L Tris-HCl PH 6.8, add deionized water constant volume to 10ml

5 × sample-loading buffer (5 × loading buffer (hereinafter referred to as N):0.1g SDS, 0.05g bromophenol blues, 5.0ml Glycerine, 2.5ml 1mol/L Tris-HCl PH 6.8, adds deionized water constant volume to 10ml

10×MOPS:104.6g MOPS, 60.6g Tris, 10g SDS, 3g EDTA, add deionized water to be settled to 1L

10×PBS:320g NaCl,8g KCl,8g KH₂PO₄,61.536g Na₂HPO₄.12H₂O, PH 7~7.2, adds Ionized water is settled to 4L suction filtrations

1×PBS：10 × PBS of 100ml add deionized water to be settled to 1000ml

Pre-prepared colloid：4~12% gel (Genscript, Cat#:M41212)

PAGE-MASTER Protein Standard(for SDS-PAGE)(Genscript,Cat#:M00516)

Easy western protein labelings (Easy western protein marker) (Genscript, Cat#: MM0908)

Transferring film liquid (Transbuffer)：150ml absolute ethyl alcohols, 5 × Transbuffer of 200ml, add deionized water constant volume To 1L

0.1%PBST：1 × PBS of 1000ml add 1ml Tween-20

Goat anti-rabbit igg (Goat Anti Rabbit IgG) (H＆L) [HRP] (polyclonal) (Genscript, Cat#: A00098)

ECL Western Blotting Substrates (ECL Western Blotting Substrate) (A, B liquid) (Promega, Cat#:W1015)

X-ray room temperature hand shows concentrate (Nanjing Lan Ge shadows System Co., Ltd, Cat#:IG-Ⅱ)

Blue lattice IG-1 A liquid alternating temperatures rapid fixing solution (Nanjing Lan Ge shadows System Co., Ltd, Cat#:IG-1 A

2.33 experimental facilities

Centrifuge (Eppendorf, 5804R)

Biohazard Safety Equipment (Thermo Scientific, Forma Class II, A2)

Electronic suction assisting device (Drummond, Easypet 3)

4 DEG C of refrigerators (Haier, BC-117FC)

- 20 DEG C of refrigerators (Haier, BD-226W)

Microscope (Shanghai optical instrument, 37XC)

Electroporation (Drummond, Pipet-aid)

Pipettor (Eppendorf, 20-200 μ l, 100-1000 μ l)

Cell culture table (VWR, 3500)

CO2gas incubator (Thermo, 3111)

Board-washing machine (opens up general, model in Beijing：DEM-3)

Microplate reader (Molecular Devecies, model:M2)

Eddy mixer (its woods Bell's instrument manufacturing Co., Ltd of Haimen City, model:VORTEX-5)

(upper Nereid is grand, model for electric heating constant temperature sink:DK-420)

Dry bath thermostat (its woods Bell's instrument manufacturing Co., Ltd of Haimen City, model:GL-1800)

Electrophoretic blotting instrument (Nan Da biotechnologys development company, model:DYY-7B)

Vertial electrophorestic tank (Bio-Rad, Cat.NO.165-8004)

Small-sized transfer groove (Bio-Rad, Cat.NO.170-3930)

CD CHO(GIBCO,Cat#：10743-029,Lot#：1663125)

Opti-MEM I(GIBCO,Cat#：31985,Lot#：1627186)

2.34 experimental cell prepares

Cell thaws

Addition 9ml CHO culture mediums (the CD CHO+6mM L-Glutamine+Anti- in 10cm cell dish (dish) clumping agent(200x)).Freeze-stored cell is taken out from liquid nitrogen, 37 DEG C of water-baths is quickly put into and is dissolved, by cell It is transferred in 10cm cell dish, is put into 37 DEG C, 5%CO₂Incubator in culture 24 it is small when after, cell count：1.22x 10⁶Carefully Born of the same parents/ml, vigor 96%.

Cell culture

Cell suspension is transferred to 15ml centrifuge tubes to be centrifuged (700rpm, 5min).With fresh growth medium Opti- Cell is resuspended in 125ml shaking flasks by MEM I to be grown.When cell density is 3.0x10⁵Cell/ml, volume 20ml, by cell 37 DEG C are placed in, 5%CO₂Incubator in cultivate, rotating speed 120rpm.48 it is small when after, by volume 30ml, density 3.0x10⁵Carefully Born of the same parents/mL is passed on, it is every 48 it is small when passage once.Day before transfection cell is expanded to 400ml, density 5.0x10⁵Cell/ ml。

2.35 electrotransfection

Cell count, count results 1.24x10 are carried out before transfection⁶Cell/ml, vigor 99.2%.Transfection needs thin Born of the same parents' sum is 1x10⁷8.5ml cell suspensions, are transferred in 15ml sterile centrifugation tubes by cell according to calculating, totally 28 pipe, room temperature 800rmp centrifuges 5min.Supernatant is abandoned, cleaning cell is resuspended once with 5mlOpti-MEMI culture mediums.Room temperature 800rmp is centrifuged 5min, abandons supernatant.Each group of electrotransfection：Cell is resuspended with 0.76mlOpti-MEMI, electric Pignus pignoris grain is 40 μ g.

Each group of mixture is added in electric revolving cup, sets shock parameters as follows：Voltage:240V, time 30msec, arteries and veins Punching:Exponential decay (ExponentialDecay).After electric shock, electric revolving cup is placed into 4 DEG C of common 5min.Carry out two groups of (A Group, B groups) parallel test, every group of 14 transfections.In the process, prepare a 10cm cell dish, add 7ml growth mediums. Cell in electric revolving cup is transferred in 10cm cell dish, is cultivated in 5%CO2,37 DEG C of incubators.Draw within the 2nd day after transfection 2ml cell suspensions continue to cultivate to 6 orifice plates, and remaining cell suspension is used for the cell pool (cell pool) for establishing stable cell line Screening.

2.36 Chinese hamster ovary cells (CHO) expression assessment detection

The 6th day after transfection, the Chinese hamster ovary celI supernatant of transfection is collected, and use ELISA reagents (CUSABIO, cat#：CSB- EL024511HU) supernatant ELISA is detected to specifications, testing result is as follows.

The expression of table 3. optimized MG53 and wild type MG53 in Chinese hamster ovary celI supernatant

TRIM72S1-N, TRIM72S1-5 are different from TRIM72S2-N, TRIM72S2-5 signal sequence respectively, codon sequence Row are consistent.It can be seen that from result, for the expression yield in Chinese hamster ovary celI, the expression of MG53 caused by the signal peptide 2 used Amount is higher than signalase 11.At the same time in 9 kinds of codons, the expression quantity highest of MG53 caused by optimized sequence 6.Therefore, signal Peptide 2 is Optimal Signals peptide, and sequence 6 is optimal codon optimised sequence.

In addition, we also carry out polyacrylamide gel (SDS-PAGE) electrophoresis to the Chinese hamster ovary celI supernatant of transfection, with inspection Survey the expression of MG53 therein.As shown in figure 12, using the expression yield highest of the TRIM72-S2-1 MG53 obtained.Together When in terms of expression quantity, signal peptide 2 is better than signalase 11, and the sequence 6 of optimization is optimal codon optimised sequence.

2.37MG53 the expression status in eukaryotic CHO

In order to detect expression status of the MG53 in eukaryotic CHO, the MG53 plasmids that we pick high expression carry out The detection of Western Blot (Western blotting).

Experiment process is as follows

1) sample is handled

The supernatant (sample) obtained after different plasmid transfection Chinese hamster ovary celIs is vibrated first and is mixed, with 5 × sample-loading buffer 5 × R and 5 × sample-loading buffer, 5 × N handles sample, i.e. volume ratio=1 of 5 × R (N) and sample respectively:4, vibration is mixed in proportion It is even, it is put into 95 DEG C of degree dry bath thermostats and heats 7min, it is stand-by that taking-up afterwards is put into the cooling of EP pipe supports.1 × PBS of positive control 20 times of dilution, i.e. volume ratio=1 of sample and 1 × PBS：19.

2) point sample

Take out pre-prepared colloid (4~12%) from 4 DEG C to be fitted into electrophoresis tank, inside groove will fill it up with MOPS buffer solutions, and water jacket will It is poor that liquid level is formed with inside groove.The comb on glue hole is pulled out, is blown and beaten by using the pipettor of 20ul~200ul by the storage in glue hole Buffer solution is changed into MOPS.Sample after processing is added in glue hole in sequence, protein labeling (Mark) applied sample amount is 1.8 μ l, positive control MG53 standard items applied sample amount are 3 μ l, and various sample applied sample amounts are 30 μ l.

3) electrophoresis

The voltage 60v of electrophoresis apparatus is set, runs 50min, 40min is run with 70v afterwards, 60min is finally run with 90v.

4) transfer

Prepare transferring film liquid in advance first, then PVDF membrane (pvdf membrane) be put into absolute ethyl alcohol and soaks 30s, Place into transferring film liquid and balance.

Glue is taken out with stripping offset plate.Transfer folder is opened, using black flour as bottom surface, foam-rubber cushion is first placed, spreads three layers of filter paper, use glass Glass rod drives the bubble in filter paper away, then glue is put into above filter paper.Drive the bubble between glue and filter paper out of with glass bar.From transferring film Take out film in liquid to be taped against on glue, the place that pvdf membrane is in contact with glue there cannot be bubble, otherwise can influence experimental result.It is then covered with Three layers of filter paper simultaneously drive the bubble in filter paper away；Foam-rubber cushion is finally placed, closes up transfer folder.Transfer is folded up in groove, is connected just Anode, is put into ice bank, plugs in, arrange parameter 90v transfers 2h.

5) close

The positive and negative of the good film of marking transfer (one side being in contact with glue is front).Take out film to be put into bellows, use PBST is cleaned 2 times, each 5min.Add 5% milk prepared in advance, room temperature closing 1h.

6) with detection antibody incubation

Cleaned 4 times with PBST after closing, each 5min.With 5% milk according to 1:1000 dilution proportions detect antibody, At room temperature with detection antibody incubation film about 10min, it is incubated overnight afterwards in 4 DEG C.

7) HRP antibody incubations are used

Film is taken out from 4 DEG C, recovers room temperature, cleans film 4 times with PBST, each 5min.The HRP prepared is added afterwards to resist Body, i.e. goat antirabbit-HRP (Goat anti Rabbit-HRP Cat.NO.:A00098, use ratio 1:5000) it is warm at room temperature Educate film 2h.After HRP antibody incubations terminate, film is cleaned 4 times with PBST, each 5min.

8) expose

Prepare exposure substrate (PromegaA：PromegaB=1:1) every film needs 2ml.By the pvdf membrane after cleaning just Up, it is placed in exposure holder, wipes unnecessary PBST.Prepared exposure substrate and pvdf membrane are brought into dark place, with shifting 2ml exposure substrates are equably added dropwise on pvdf membrane liquid device.After substrate to be exposed diffuses to whole film, unnecessary exposure is wiped Substrate, photographic film is placed after covering plastic film.It is strong and weak according to fluorescence, select the suitable tabletting time.Wait suitable tabletting After time, photographic film is placed in developer solution, treats that band occurs, photographic film is taken out to be placed in fixing solution and is led to film Untill thoroughly.

9) experimental result

According to Figure 16, it has been found that the MG53 expressed under non-reduced state in eukaryotic CHO is mainly with polymer There is (mainly dimer) in form, in a reduction state (in the case of destroying disulfide bond), MG53 is mainly with monomeric form In the presence of.Therefore, by being expressed in eukaryotic CHO, we successfully obtain MG53 polymers.

The purifying of 2.4MG53 polymers

As shown in figure 12, by using MG53 genes, such as TRIM72-S2-1 transfecting eukaryotic cells CHO can be on cell MG53 polymers are expressed in clear liquid.However, in cell supernatant, in addition to MG53 multimeric proteins, also there is the miscellaneous of many Matter albumen.Therefore, it is necessary to be purified to the MG53 multimeric proteins of expression, for follow-up functional study or it is used to prepare Pharmaceutical composition.

2.41 purify MG53 polymers by Q-HP column chromatographies

First MG53 polymer eggs are included with what is expressed by Q-HP ion exchange columns preliminary purification in eukaryotic CHO White cell supernatant, to remove partial impurities albumen.Q-HP is carried out using the full-automatic tomographic systems of GE AKTA PURE 150M Preliminary purification is carried out, to collect MG53 multimeric proteins.

The reagent and device used in Q-HP chromatographies：

Chromatographic column：Volume 50ml (prepacked column 26*20cm)

Chromatography buffer：

With reference to liquid A：20mM Tris, pH 8.5

Eluent B：20mM Tris+1.0M NaCl, pH 8.5

Q-HP column chromatography purifying is carried out by following steps：

Prepare sample：

The cell supernatant for including MG53 multimeric proteins expressed in eukaryotic CHO is taken, at 8 DEG C with 10000rpm 15min is centrifuged, centrifuges 5 times altogether, takes supernatant to prepare sample.

Q-HP column chromatographies：

With loading after 0.45um membrane filtration samples, loading flow velocity 2ml/min.With the mixture for combining liquid A and eluent B Middle eluent B is the solution of 5% (volume ratio), eluent B elutions, obtains component C and D (corresponding to swimming lane 4 and 5) (figure 14).Partial impurities albumen is eliminated in C and D.

SDS-PAGE

SDS-PAGE electrophoresis is carried out to the eluting peak that Q-HP column chromatographies obtain, to identify M53 polymers after Q-HP column chromatographies The purity of albumen.

As shown in figure 14, purified by Q-HP column chromatographies, eliminate the impurity protein of part.

2.42 MG53 multimeric proteins are purified by Mono Q column chromatographies

In order to further improve the purity of MG53 multimeric proteins, main eluting peak that Q-HP column chromatographies are purified (eluent B is the solution of 5% (volume ratio) in the mixture of pH8.5, A and B, and the eluting peaks that afford of eluent B) into Row Mono Q column chromatographies.

The reagent and device used in Mono Q column column chromatographies：

Chromatographic column：Volume 25ml (prepacked column 26*20cm)

Chromatography buffer：

With reference to liquid A：20mM phosphate buffers (PB) are (with 0.21g NaH during preparation₂PO4 and 6.78gNa₂HPO4, adds Ionized water is dissolved to 1000ml, 7.0) adjustment pH is

Eluent B：20mM phosphate buffers (PB)+1.0M NaCl, pH 7.0

Mono Q column chromatographies are carried out by following steps to purify：

Mono Q column chromatographies：

By the main eluting peak obtained in the purifying of Q-HP column chromatographies, (eluent B is in the mixture of pH8.5, A and B The solution of 5% (volume ratio), and the eluting peaks that afford of eluent B) i.e. C and D merge after loading, with the flow velocity of 8ml/min Carry out loading and/or elution.Rinsed first by 10% solution of eluent B in the mixture of A and B, afterwards with the mixed of A and B Eluent B is that the solution of the gradient of 10%-30% elutes 6 column volumes (6CV) in compound, is finally eluted with eluent B.Use A With eluent B in the mixture of B eluting peak C, D, E are obtained for the solution elution of 20% (volume ratio).

SDS-PAGE

Polyacrylamide gel (SDS-PAGE) electrophoresis is carried out to the eluting peak that Mono Q column chromatographies obtain as described above, with The purity of identification of M ono Q column chromatographies MG53 polymers after purification.

As shown in figure 15, it is further purified by Mono Q column chromatographies, the purity of MG53 multimeric proteins further improves, More than 90% purity can be reached.

In fig.15, C, D, E are the MG53 polymers under reducing condition, and F, G, H is that the MG53 under non-reduced state is more Aggressiveness.Under non-reduced state, MG53 multimeric molecule amounts are mainly 110KD and 160KD or so.Due to natural MG53 monomers Molecular weight is about 53KD, therefore the MG53 polymers that we obtain mainly exist in the form of dimer.Under reproducibility state MG53 exist with monomeric form.

From the foregoing, it will be observed that 90% can be reached by the MG53 multimeric proteins of Q-HP column chromatographies and Mono Q column chromatographies after purification More than purity, available for preparing dry powder formulations and/or spray agent and/or gel preparation, it can also be used to prepare and be used to prevent And/or the pharmaceutical composition for the treatment of heart ischemia/reperfusion injury associated diseases, or it is related to ulcer for preventing and/or treating The pharmaceutical composition of disease.

The comparison that 2.5MG53 albumen is expressed in prokaryotic Escherichia coli BL-21 and eukaryotic CHO

We compare MG53 in prokaryotic Escherichia coli BL-21 and eucaryon by irreducibility polyacrylate hydrogel electrophoresis Expression-form in cell CHO.Unexpectedly, the MG53 albumen expressed in prokaryotic Escherichia coli BL-21 is with monomer Form exists, and the MG53 albumen expressed in eukaryotic CHO has (figure with multimeric forms, the mainly form of dimer 16).Therefore, by expressing MG53 genes in eukaryotic CHO, the MG53 polymers of the application are successfully expressed.

Pass through detectable substance heat source substance and biological activity determination, it was demonstrated that the MG53 multimeric proteins of the application meet national note Penetrate the quality standard with albumen.

The preparation of the dry powder formulations of embodiment 3.MG53 monomeric proteins or MG53 multimeric proteins

3.1 prepare the dry powder formulations of MG53 monomeric proteins or MG53 multimeric proteins using mannitol, histidine, sucrose etc.

Auxiliary material：Mannitol, histidine, sucrose etc..

Preparation method：

Auxiliary material is dissolved, at the same the auxiliary material of dissolving and the MG53 monomeric proteins according to the method acquisition in embodiment 1-2 is former Liquid (by Escherichia coli BL-21 expression and purifications obtain) or MG53 multimeric proteins stoste (by CHO expression and purification obtain ) mixing, adjustment pH value to 6.5 so that obtain comprising the MG53 multimeric proteins of 0.5mg/ml, 50mg/ml mannitol, The solution of 25mg/ml sucrose, 25mg/ml histidines.The solution filtration sterilization that will be obtained, freezes dry under following lyophilisation conditions It is dry, it is lyophilized formulations, determines packing specification as required.

Lyophilisation condition：

1) pre-freeze is kept for 2 hours to -45 DEG C, forvacuum to 12 ± 2Pa,

2) -6 DEG C are warming up within 90 minutes, is kept for 10 hours,

3) 15 DEG C, when holding 5 is small are warming up to when 1 is small,

4) it is further dried, is freeze-dried products.

3.2 prepare the dry powder system of MG53 monomeric proteins or MG53 multimeric proteins using mannitol, sucrose, Tween-80 etc. Agent

In addition, we also using other auxiliary materials such as mannitol, sucrose, Tween-80 to have obtained stability more preferable The dry powder formulations of MG53 monomeric proteins or MG53 multimeric proteins.

Auxiliary material：Mannitol, sucrose, Tween-80 etc..

Preparation method：

In the MG53 monomeric protein stostes that 200ml 2mg/ml are obtained according to the method in embodiment 1-2 (by big Enterobacteria BL-21 expression and purifications obtain) or MG53 multimeric proteins stoste (passing through the expression and purification acquisition in CHO) middle addition 2g Sucrose, 6g mannitol, 10mg Tween-80, after fully mixing, adjustment pH value to 7.4.It is filtered degerming, it is dry in following freezings It is freeze-dried under the conditions of dry, is lyophilized formulations, determines packing specification as required.

Freeze-drying condition：

1) pre-freeze is kept for 2 hours to -45 DEG C, forvacuum to 12 ± 2Pa,

2) -6 DEG C are warming up within 90 minutes, is kept for 10 hours,

3) 15 DEG C, when holding 5 is small are warming up to when 1 is small,

4) it is further dried, is freeze-dried products.

The stability of 3.3 different auxiliary material formulas compares

To compare different auxiliary material formula to the MG53 monomeric proteins or MG53 polymers according to the method acquisition in embodiment 3 The influence of the solubility of protein dry powder compositions, We conducted following experiment.Instrument and equipment：System of Dry-out Test Machine, 10ml bottles, plug, Lid, balance

Experiment process：Prepare 4ml/ bottles of sample, 8 kinds of accessory formulas, 8 bottles of samples.

Following each group accessory formula is used respectively, and MG53 monomeric proteins or MG53 polymer eggs are freezed according to 3.2 method In vain.

Formula 1：Contain only sucrose 0.5%20mg

Formula 2：Contain only sucrose 1%40mg

Formula 3：Contain only mannitol 0.5%20mg

Formula 4：Contain only mannitol 1%40mg

Formula 5：Contain only mannitol 0.25%10mg

Formula 6：0.005%0.2mg containing Tween-80, sucrose 1%40mg, mannitol 3%120mg

Formula 7：Sucrose 1%40mg is contained only, but is not added with sample

Formula 8：Mannitol 1%40mg is contained only, but is not added with sample

Afterwards, the lyophilized formulations that physiological saline solution obtains are added.It is filtered shake after, formula No. 1-5 have cotton-shaped, pin Shape material separates out, the solution that formula 6 is clarified.This description of test, the MG53 monomeric proteins prepared using accessory formula 6 or The solubility and stability of MG53 multimeric protein lyophilized formulations are optimal.

The preparation of the spray agent of embodiment 4.MG53 monomeric proteins or MG53 multimeric proteins

The MG53 monomeric proteins or the dry powder formulations of MG53 multimeric proteins that are obtained according to the method in embodiment 3 are given birth to Manage brine or the dissolving of medicine common solvent.Dissolved MG53 monomeric proteins or MG53 multimeric proteins concentration for 50ng~ 100ug/ml, is loaded into satisfactory sprayer, you can spraying uses.

The preparation of the gel preparation of embodiment 5.MG53 monomeric proteins or MG53 multimeric proteins

5.1 prepare MG53 monomeric proteins or MG53 multimeric proteins using polyox-yethylene-polyoxypropylene block copolymers Gel preparation

It is in a liquid state using the low temperature of polyox-yethylene-polyoxypropylene block copolymer (Pluronic), body temperature cohesion plastic Feature, is configured to the gel companion of the dry powder formulations of MG53 monomeric proteins or MG53 multimeric proteins.

The gel preparation of MG53 monomeric proteins or MG53 multimeric proteins is prepared by following steps：

1) by the MG53 monomeric proteins stoste obtained according to the method in embodiment 1-2 (by Escherichia coli BL-21 tables Obtained up to purifying) or MG53 multimeric proteins stoste (by the expression and purification acquisition in CHO), the method system according to embodiment 3 Into dry powder formulations.

2) the MG53 monomers are dissolved with the polyox-yethylene-polyoxypropylene block copolymer of preferably 4-8 DEG C preservation of low temperature Albumen or MG53 multimeric protein dry powder formulations, are configured to the gel solvent of MG53 monomeric proteins or MG53 multimeric proteins.

In use, syringe, which suctions out gel solvent, smears affected part, body temperature effect forms gel overlay affected part, and discharges MG53 polymers produce therapeutic effect.

Gel companion and MG53 monomeric proteins or MG53 multimeric protein dry powder formulations dissolution preparation methods and above-mentioned spraying The preparation method of physiological saline solution dry powder formulations is identical in preparation.

5.2 prepare the gel of MG53 monomeric proteins or MG53 multimeric proteins using carbomer, glycerine and chitosan solution Solvent

Afterwards, our formulas to gel solvent are optimized to have obtained the more preferable MG53 monomeric proteins of performance or MG53 The gel preparation of multimeric protein.

Specific preparation method is as follows：

1) add the carbomer 934 of the water-swellable 0.5g of 50g, pH to 7.0 adjusted with 10%NaOH,

2) adds 10g glycerine, is uniformly mixed, as gel-type vehicle；

3) the MG53 monomeric proteins or MG53 polies prepared with the chitosan solution stirring and dissolving such as embodiment 3 of 5ml 2% After the lyophilized formulations 1.83g and ethylparaben 0.12g of body protein, add it in gel-type vehicle, be uniformly mixed, that is, obtain The gel preparation of MG53 monomeric proteins or MG53 multimeric proteins.

The preparation of the hydro-acupuncture preparation of embodiment 6.MG53 monomeric proteins or MG53 multimeric proteins

We are also prepared for the hydro-acupuncture preparation of MG53 monomeric proteins or MG53 multimeric proteins.

The reagent used during preparation is as follows：

It is 1g according to the MG53 monomeric proteins of the acquisition in embodiment 3 or the dry powder formulations of MG53 multimeric proteins

Water for injection 2000ml

It is made 1000

Specific preparation method is as follows：

1) under cleaning condition, 1g MG53 monomeric proteins or MG53 multimeric proteins are all dissolved with appropriate water for injection,

2) being handled with a small amount of activated carbon, filtering, injects water to 2000ml, adjusts pH value,

3) refined filtration, it is filling, seal and sterilize, so that it is 2ml that specification, which is made,：The MG53 monomeric proteins or MG53 polies of 2mg Body protein low capacity hydro-acupuncture preparation.

The preparation of embodiment 7.MG53 monomeric proteins or MG53 multimeric protein emulsions

We are also prepared for MG53 monomeric proteins or MG53 multimeric protein emulsions.

Specific preparation method is as follows：

1. take stearic acid 15g, glycerin monostearate 8.5g and albolene 10g to be heated to 80 DEG C of mixings in a water bath, Obtain oil phase；

2. 3g Tween-80,7.5g glycerine and 90g water are separately heated to 80 DEG C, water phase is obtained；

3. oil phase is slowly added into water phase, stirring stirring while adding, condenses, obtain emulsion bases (pH6.9)；

4. with the chitosan solution dissolving embodiment 3 acquisition MG53 monomeric proteins of 5ml2% or doing for MG53 multimeric proteins Powder preparation 1.125g is (equivalent to 36mg according to the MG53 monomeric protein stostes of the method acquisition in embodiment 1-2 (by large intestine Bacillus BL-21 expression and purifications obtain) or MG53 multimeric proteins stoste (passing through the expression and purification acquisition in CHO)), add emulsion Matrix 30g, 5g glycerine is simultaneously uniformly mixed, so as to obtain MG53 monomeric proteins or MG53 multimeric protein emulsions.

Repair of the embodiment 8.MG53 multimeric proteins to the cell membrane of the 293T cells of mechanical damage

Experimental principle：Appropriate bead is added in the cell cultivated in vitro, is shaken on shaking table, bead can be to cell Cell membrane cause physical damnification, discharge intracellular lactic dehydrogenase (LDH).MG53 can be with repair cell film.Therefore can root Judge the repair function of MG53 monomers and MG53 multimeric proteins to cell membrane according to LDH emission levels.

Experiment material：Bead (400 mesh)；293T cells；LDH kits (TaKaRa-MK401)；DPBS；DMEM is cultivated Base；Pancreatin；96 orifice plates；Board-like centrifuge；Liquid-transfering gun (100 μ L, 1000 μ L)；The volley of rifle fire (100 μ l)；Microplate reader；Shaking table.

Experimental method

1) 293T cell culture 30h.

2) 96 orifice plates are spread

A. experimental group added per hole the serial dilution of DPBS and 20 μ ls of the 30 μ l containing bead according to embodiment 1-2 The MG53 monomers or MG53 multimeric protein solution of acquisition, the concentration of protein serial dilution is 200ug/ml, 100ug/ ml、50ug/ml、25ug/ml、12.5ug/ml、6.75ug/ml；

B. background group adds the MG53 monomers or MG53 polymers of the serial dilution of the DPBS and 20 μ l of 30 μ l per hole Protein solution, the concentration of protein serial dilution is 200ug/ml, 100ug/ml, 50ug/ml, 25ug/ml, 12.5ug/ ml、6.75ug/ml。

C. digest 293T cells and count (density 1.2-1.5*10⁶Cell/ml), 50 μ l cell suspensions are added per hole.

3) 96 orifice plates are placed on the shaking table of 120rpm at room temperature and acted on 15 minutes.

4) centrifuged 5 minutes under 4400rpm immediately after shaking.

5) 50 μ l supernatants are transferred in new 96 orifice plate after centrifuging；

6) LDH reagents are configured according to LDH kit specifications, 50 μ lLDH reagents is added per hole.

7) centrifuged under room temperature 4400rpm 1 minute (remove bubble, in order to avoid influence reading).

8) lucifuge reaction 15min, using microplate reader under 490nm, detects OD values.

As a result it is as shown in figure 17.These in the 293T cells in exponential phase the results show that add various concentrations MG53 monomers and MG53 multimeric proteins, the LDH activities of MG53 polymers is apparently higher than no significant difference.Therefore, compared to Natural MG53 monomers, MG53 polymers have the repair of the cell membrane of the mechanical damage to 293T cells significantly increased.

Protective effect of the embodiment 9.MG53 multimeric proteins to myocardial ischemia-reperfusion injury

Due to many document reports, MG53 to heart ischemia/reperfusion injury has protective effect, we are to the application's Effect of the MG53 polymers in heart ischemia/reperfusion injury is studied.

1. medicine：The MG53 polymers obtained according to embodiment 3,2mg/ bottles；The MG53 monomers obtained according to embodiment 3, 2mg/ bottles；Freeze dried powder, 4 DEG C of refrigerators preserve.

2. packet and administration

Animal is divided into sham-operation group (NS 1ml/ are only), model group.By in different time through intravenous administration MG53 polymers Animal is divided into 3 subgroups, i.e. 1 group of MG53 multimeric proteins (30 minutes administration groups before ischemic), and 2 groups of MG53 multimeric proteins are (again 30 minutes administration groups before perfusion), 3 groups of MG53 multimeric proteins when small (after Reperfu- sion 1 administration group), every group 6 (24 survive when small Number of animals).

Model group 2 (before coronary ligation 30min to NS 1ml/ only).By in different time through intravenous administration MG53 monomers Animal is divided into 3 subgroups, i.e. 1 group of MG53 monomeric proteins (30 minutes administration groups before ischemic), 2 groups of (Reperfu- sions of MG53 monomeric proteins Preceding 30 minutes administration groups), 3 groups of MG53 monomeric proteins when small (after Reperfu- sion 1 administration group), every group 6 (24 it is small when surviving animals Number).

The animal used：SD rats, i.e. Sprague Dawley) outbreeding group rat.SD rats are by the U.S. The R.W.Dawley on Sprague＆Dawley farms is white with being bred as after male rat and Wistar the female rats hybridization of heterozygosis Change closed colony rat.

3. experimental method

Acute myocardial injury is prepared by ligaturing the coronary artery left anterior descending branch (LAD) of male SD rat (220-260g) Model, each rat of chloraldurate intraperitoneal injection of anesthesia.Rectum monitors body temperature and the body temperature of the palmula holding rat using thermal conditioning For 37 DEG C.After open chest surgery, 6-0 silk threads ligation arteria coroaria sinistra causes myocardial ischemia in 45 minutes, then opens and carries out Reperfu- sion. Thoracic cavity is closed, rat is recovered clear-headed.24 it is small when after, open chest again along the notch of last time, same position ligatures left hat again Shape artery, cuts heart, carries out aortic cannulation, and 1% evans blue solution 3ml is slowly injected into sustainer, remove atrium dextrum and Right ventricle, is cut into 5, every thickness is 2mm by left ventricle from apex coronal section.Think the region dyed through evans blue For non-ischemic region, the region do not dyed by evans blue is hazardous area (AAR).After being dyed using digital camera to evans blue Take pictures on myocardium two sides.Heart is placed in 1.5%TTC solution after taking pictures, 37 DEG C of 8~10min of incubation are thin to cardiac muscle living in AAR Born of the same parents region dyeing (after TTC dyeing, infarcted region is canescence, and cardiac muscle living is red).Again using digital camera to every The two sides for opening myocardial slices is taken pictures, and is analyzed using 3.2 Image softwares of Motic images advanced.Calculate infarct Region, AAR, non-ischemic account for left ventricle percentage, assess MG53 monomers and MG53 multimeric proteins apply within 30 minutes before ischemic, Apply within 15 minutes before Reperfu- sion, after Reperfu- sion 1 it is small when using the protective effect to myocardial ischemia/reperfusion injury in rats.

Before ischemic, 6h, 24h collect serum after Reperfu- sion, detect the level of lactic dehydrogenase (LDH) in serum.

4. experimental result

As shown in table 4 below, model group Infarct area (%) and dangerous area (%) are substantially close, and MG53 polymers B30min groups, L45min groups, R60min groups Infarct area (%) are significantly less than corresponding group of dangerous area (%), wherein B30min, L45min group Infarct area (%) are substantially less than model control group (p<0.01, p<0.05).

Table 4, influence of the MG53 polymers to myocardial ischemia-reperfusion injury

Note：B30min is applied for 30 minutes before representing ischemic

L45min is applied for 45 minutes before representing perfusion

R60min is applied for 60 minutes after representing Reperfu- sion

From above experimental data, compared to MG53 monomers, MG53 polymers can significantly decrease myocardial ischemia stalk Dead zone area, being applied before applying before myocardial ischemia or filling again more effectively Ischemic myocardium reperfusion injury to act on.

Embodiment 10.MG53 multimeric proteins will not cause rat blood sugar to raise

Previous studies find that MG53, can be with insulin resistance, obesity, diabetes and metabolism while cardioprotection The side effect of syndrome.Meanwhile we have also carried out the intravenous injection of MG53 multimeric proteins and have been explored in fact to the blood glucose in SD rats Test, whether pathological criteria is reached with blood glucose rise level caused by assessing MG53 multimeric proteins.

Test sample:

Title：MG53 multimeric proteins

Lot number：2014-5-16

Packaging：Cillin bottle

Specification：2.0mg/ bottle

Character：The dry powder formulations of the MG53 multimeric proteins prepared according to embodiment 3

Preservation condition：It is 2~8 DEG C, dry.

Reference substance

Title：Bovine serum albumin(BSA)

Lot number：201421

Specification：20.5mg/ bottles

Character：White dry powder formulations

Preservation condition：-20℃

Solvent 1

Title：Sodium chloride injection (physiological saline)

Production unit：Shangdong Hualu Pharmaceutical Co., Ltd.

Lot number：D13102301

Concentration：0.9%

Specification：100mL:0.9g, 100mL/ bottles

Character：Colourless clear liquid, taste are micro- salty.

Preservation condition：Closed preservation

Solvent 2

Title：Hydrochloric acid

Production unit：Beijing Chemical Plant

Lot number：20140311

Concentration：36%~38%

Specification：100mL, 0.9g, 100mL/ bottles

Character：Colourless clear liquid

Preservation condition：The closed preservation of room temperature

Bovine insulin

Title：Bovine insulin

Lot number：I5500

Production unit：SIGMA

Specification：25mg/ bottles

Character：White or cream-coloured powder

Preservation condition：-20℃

Solution is prepared and analysis

MG53 multimeric protein solution：The MG53 multimeric protein dry powder prepared according to embodiment 3 is put to room temperature, with injection Device draws physiological saline 2.0mL and directly squeezes into cillin bottle and (not open bottle stopper), gently vortex mixed, to be completely dissolved. The MG53 multimeric protein solution that final compound concentration is 1mg/mL, after the completion of preparation, using 0.22 μm of membrane filtration.

Bovine serum albumin solution compares：Put after bovine serum albumin(BSA) dry powder is taken out to room temperature, use disposable syringe It is appropriate to draw sodium chloride injection, directly squeezes into cillin bottle and (not open bottle stopper).Gently vortex mixed, so that ox blood is pure Albumen is dissolved completely in sodium chloride injection.After dissolving the bovine serum albumin that concentration is 1mg/mL is diluted to sodium chloride injection White solution, after the completion of preparation, using 0.22 μm of membrane filtration.

Insulin：First with ultra-pure water dilute hydrochloric acid to pH=2~3, with 0.22 μm of membrane filtration.It is again 2~3 with pH The dry powder insulin put to room temperature is diluted to 2mg/mL by sterile dilute hydrochloric acid.With sodium chloride injection by the 2mg/mL's of a part Insulin solutions are diluted to 0.01mg/mL (sterile preparation).The insulin solutions of remaining 2mg/mL be stored in -20 DEG C it is spare.

Solution is prepared to preserve and dispose：MG53 multimeric proteins solution and bovine serum albumin solution control before administration in Transport is preserved in 2~8 DEG C or ice chest.After remaining MG53 multimeric proteins solution, reference substance and insulin according to Medical waste is handled.

Experimental system：

Experimental animal

Kind ＆ strains：Jugular vein is intubated SD rats and normal SD rats

Grade：SPF grades

Experimental animal source：Beijing Vital River Experimental Animals Technology Co., Ltd.

Plan, which is applied, starts week old：6~8 week old

Number of animals and gender：It is expected that ordering jugular vein intubation SD rats buys 17, male, experiment uses 15, male. It is expected that ordering normal SD rats 17, male, experiment uses 15, male.

Unnecessary animal processing：The unused animal of purchase delivers animal doctor in 2 days after application and is uniformly processed.

Select reason

The reasons why experimental animal selects：This experiment is without the method that living animal experiment can be substituted known to other；This examination Test and select SD rats, be the generally acknowledged at present medicine progress toxicologic study experiment that can be used as and have been used for or be envisaged for the mankind Standard animal model, it possesses and has substantial amounts of background data, and is the discovery that suitably when studying same or like test sample Animal model.

The reasons why size of animal selects：On the premise of research purpose, scientific and standard and laws and regulations requirement is met, using to the greatest extent may be used The few animal of energy.

Principal indication：Acute myocardial infarction

Route of administration：Intravenous injection

The clinical plan course for the treatment of：Single administration

Animal packet and application dosage

Using randomized blocks, every animal being intubated with Excel softwares to 15 jugular veins in SD rats distributes one Random number, sorts according to the order of random number from small to large, animal is divided into 2 groups (1~2 groups), every group of 5 animals.By same Method 15 normal SD rats are randomly divided into 3 groups (4~6 groups), every group of 5 animals.

Animal number after table 5, each group animal application dosage and packet

Note：* application dosage is 12mg/kg first for 1~2 group of expression, and after applying about 24h first, application dosage is again 6mg/kg。

^#It is first 12mL/kg using capacity to represent 1~2 group, is again 6mL/ using capacity after applying about 24h first kg。

Using

Route of administration：Tail vein injection, is injected according to the speed of about 2~3ml/min.

Application dosage and capacity：Carried out according to upper table information

Application process：Preceding weight is applied according to animal, determines amount of application.Use the disposable sterilized injector of appropriate size Test sample or reference substance are drawn, the test sample or reference substance of corresponding dosage are given in animal tail vein injection.

Frequency of administration and cycle：1~3 component 2 times is applied, administration interval about 24h；4~6 groups of single administrations.

Injection of insulin：1~3 group of all animal last, which is applied all animals of 10min and 4~6 group of end and applied, to be terminated After 10min, insulin is injected intraperitoneally, application concentration 0.01mg/mL, application dosage 0.037mg/kg, is using volume 3.7ml/kg。

Route of administration selects reason：The information and related guidance principle provided according to client, selects tail vein injection Using being approached with clinical plan with approach.

Weight

Detect animal：1~6 group of all animal

Detection time：After animal receives, before packet, preceding measure weight is applied first.Animal is weighed before applying for applying The calculating of amount.

Fasting

First and last applies preceding overnight fasting, 1~3 group of animal is applied in rear 2h first to be prohibited 1~3 group of all animal Food.4~6 groups of animals apply overnight fasting before preceding and collection heart.

Blood sugar test

Detect animal：1~3 group of all animal

Detection time：0min (before applying first), apply rear 15min, 30min, 1h, 2h, 8h, 24h first.

Assay method：Test paper is inserted into measurement mouth, it is ensured that for three bow strips towards operator, test strips will shift bottom onto, note Meaning cannot be bent.Instrument automatically opens up at this time.Press ▲ or ▼ buttons change the code that blood glucose meter is shown, make its with test paper bottle Code match.Blood is taken by jugular vein intubation.When flickering drop of blood symbol on display screen, test paper is alignd with drop of blood, is made Catwalk at the top of test paper almost touches drop of blood edge.After passage gently touches drop of blood edge, blood will be inhaled into narrow and small logical In road.When acknowledgement window becomes full, after 5 are changed into 1, blood glucose measurement will be displayed on the screen the reading of blood glucose meter.Screen On will also be shown that blood glucose measurement unit, measurement date and time.

Detecting instrument：The ONETOUCH Ultra Easy of blood glucose meter, its producer and the production of model Johnson Co. are steady Person of outstanding talent times easily type blood glucose meter.

The animal blood glucose data detected are as shown in table 4

Table 6, the animal blood glucose data detected

Meanwhile the animal blood glucose data to obtaining are analyzed, the results show is in Figure 18.Table 6 and Figure 18 show, phase For bovine serum albumin(BSA) control group, the blood glucose Each point in time in the animal of injection MG53 multimeric proteins is without significance difference It is different.These as shown by data have stronger cell membrane repair ability and guarantor compared to natural MG53 monomeric proteins, MG53 polymers Protect myocardial ischemia-reperfusion injury ability, while insulin resistance, obesity, diabetes and metabolism caused by avoiding natural MG53 The side effect of syndrome.

Embodiment 11：MG53 multimeric proteins promote fibroblast proliferation at diabetic foot ulcer, are conducive to diabetes Ulcer of foot and leg ulcer healing

We have studied effect of the MG53 multimeric proteins in ulcer, especially chronic ulcer and peptic ulcer.

First, we make use of at diabetic foot ulcer fibroblasts model to have studied MG53 multimeric proteins and are treating Effect in diabetic ulcer.

Material and method：It is with the RPMI1640 culture mediums containing 10% newborn calf serum that the individual layer of exponential phase is sugared Urine foot disease ulcer fibroblast is configured to single cell suspension.Afterwards with every hole 2*10⁵A 96 orifice plate of cell inoculation, per pore volume 200ul.5 groups of experiment point, wherein first group of blank control group, second group of negative control group, 3-5 groups are respectively 0.1,1,10 μ The MG53 multimeric proteins that g/ml is obtained according to embodiment 1-2, the material in every group is added in fibroblast.Culture 7 My god, every group sets two repeating holes, measures each hole absorbance value in 490nm, is averaged；Draw growth curve.

Result of the test is as shown in figure 19.As knowen from these results, fibroblastic life of MG53 multimeric proteins is added Long curve highest, its growth are remarkably reinforced compared with blank control group.It follows that MG53 multimeric proteins promote diabetic foot ulcer Fibroblast proliferation, is conducive to diabetic foot ulcer and leg ulcer healing.

Embodiment 12：MG53 multimeric proteins promote wound healing at rat diabetes ulcer of foot

We have studied MG53 multimeric proteins in diabetic foot ulcer is treated using rat diabetes Ulcer Models Effect.

Build rat diabetes Ulcer Models

Using the method for magnetic sheet circulation compressing, rat diabetes Ulcer Models are built.First with 2% yellow Jackets with 30mg/kg intraperitoneal anesthesia rats, then lose hair or feathers rat, then carried out disinfection with the tincture of iodine and alcohol to hair removal section.It is every big Mouse before surgery intramuscular injection 8-10IU penicillin carry out prophylactic treatment, then do one in rat back front end and be deep to fascia Notch, insert magnetic sheet in the subcutaneous of rat left fore or right fore, the second notch is located at back rear end median line.Magnetic sheet is implanted into Random point 5 groups of rat afterwards, blank control group, false model group, the MG53 multimeric protein low dosages obtained according to embodiment 1-2 Group, middle dosage, high dose group, the MG53 monomeric proteins low dose group obtained according to embodiment 1-2, middle dosage, high dose group.It is logical Cross external source magnetic sheet to attract each other in inner body transplanting magnetic sheet, form pressure, cause skin surface ischaemic, when each ischemic 2 is small Afterwards, then by external source magnetic sheet take down, allow regional flow to recover 30min, so carry out a circulation.Every rat carries out 3 daily Continuous circulation, is carried out continuously 4 days.The standard for judging ulcer is skin darkening, is hardened, acupuncture not bleeding.

Using MG53 multimeric proteins and monomeric protein

The MG53 multimeric proteins obtained according to embodiment 3 or MG53 monomeric protein dry powder formulations are accompanied by into gel companion's system The form of agent applies MG53 multimeric proteins or MG53 monomeric proteins.MG53 multimeric protein low dose groups are mixed with syringe (0.02mg/ml MG53 multimeric proteins), middle dosage (0.1mg/ml MG53 multimeric proteins), high dose group (1mg/ml MG53 multimeric proteins) or MG53 monomeric proteins low dose group (0.1mg/ml MG53 monomeric proteins), middle dosage (0.5mg/ml MG53 monomeric proteins), high dose group (5mg/ml MG53 monomeric proteins) be applied to ulcer spot.It is administered once a day, the course for the treatment of 1 Month, evaluate curative effect after one month.Ulcerous skin and control skin are taken, 10% formaldehyde is fixed, paraffin embedding, and HE dyeing, optics is shown Micro- Microscopic observation.

The results show that using the MG53 multimeric proteins and MG53 monomeric proteins of various dose, can cause to suffer from diabetes The recovery of ulcer rat, effective percentage 100%.Ulcer is clearly better within all cases 1 week, in applying 10 days to 1 month, ulcer It is almost recovered.MG53 multimeric proteins promote wound healing at diabetic foot ulcer, and the drug effect of MG53 multimeric proteins is shown Work is better than MG53 monomeric proteins.These experiments are proved can be more effective compared to natural MG53 monomeric proteins, MG53 multimeric proteins Ground promotes wound healing at diabetic foot ulcer.

Embodiment 13：MG53 multimeric proteins promote the wound healing of rat chronic gastric ulcer

In order to study effect of the MG53 multimeric proteins in other kinds of chronic ulcer is treated, we are slow using rat Gastric ulcer scale-model investigation effect of the MG53 multimeric proteins in chronic gastric ulcer is treated.

Build rat chronic gastric ulcer model

20% acetums of 0.05ml are drawn with micro syringe, through antrum antetheca through muscle layer injection gastric mucosa.Injection 3-4 days afterwards, the ulcer of boundary clear can be formed.Ulcer is as deep as muscle layer, and bottom layering is similar to human digestive ulcer, so that structure Rat chronic gastric ulcer model is built.Points 8 groups at random of chronic gastric ulcer model rat, blank control group, false model group, according to reality Apply MG53 multimeric proteins low dose group, middle dosage, high dose group and monomer low dose group, middle dose group, height that a 1-2 is obtained Dosage group.

Using MG53 multimeric proteins or MG53 monomeric proteins

Divide chronic gastric ulcer model rat to 5 groups, respectively blank control group, false model group, MG53 polymer eggs at random White low dose group, middle dosage and high dose group, MG53 monomeric proteins low dose group, middle dosage and high dose group.Use syringe Low dosage (0.02mg/ml), the MG53 polymers egg of middle dosage (0.1mg/ml) and high dose (1mg/ml) and MG53 is mono- Body protein low dose group (0.1mg/ml), middle dosage (0.5mg/ml), high dose group (5mg/ml) are filled into the rat of corresponding group In stomach.Gavage 1 time daily, continues 2 months.Curative effect is evaluated after 2 months.The gastric mucosa of each group rat is taken, 10% formaldehyde is fixed, stone Wax embeds, HE dyeing, optical microphotograph Microscopic observation.

The results show that using the MG53 multimeric proteins and monomeric protein of various dose (high, in, priming agent amount), can lead Cause the recovery for suffering from chronic gastric ulcer rat, effective percentage 100%.However, the content of the MG53 multimeric proteins used is significantly lower than MG53 monomeric proteins (be its 1/5), while drug effect is significantly better than MG53 monomeric proteins.These experiments are proved compared to natural MG53 Monomeric protein, MG53 multimeric proteins can more effectively promote gastric ulcer healing.

Embodiment 14：MG53 multimeric proteins promote the wound healing of people's diabetic foot ulcers and gangrene

We have studied MG53 multimeric proteins in people's chronic ulcer, such as diabetic foot and leg ulcer is treated Effect.

The diagnostic criteria of diabetes

The diagnostic criteria of diabetes, according to first whole nation sugar of classification and nineteen ninety-five Chinese Medical Association of international wagner The grade scale that foot disease Symposium Held is formulated is urinated, is divided into 0-V grades.0 grade：Acra blood supply insufficiency；I grades：Skin has open lesion； II grades：Infection focus have invaded deep muscle tissue；III level：Tendon ligament damage；IV grades：Bony defect；V grades：It is most of or The full foot gangrene of person, or even accumulative ankle-joint and shank.

Patient profiles

5 patients be that route dressing change method is invalid and application epidermal growth factor is invalid or the case of allergy.Male 3 Example, women 2；The oldest 75 years old, minimum 50 years old；Diabetic history is most 26 years long, most 4 years short, is diabetes B.Diagnosis It is classified case：I levels 3, II levels 1, III level 1.

Using MG53 multimeric proteins or MG53 monomeric proteins

Local treatment, it is all have focus of infection, gangrenous person of festering, surgical debridement, which removes, to fester gangrene, then on the surface of a wound uniformly The MG53 that the MG53 polymer gels preparation or 1mg/ml that smearing 0.2mg/ml is obtained according to embodiment 5 are obtained according to embodiment 5 Monomer gel preparation, can also use the dry powder formulations (preparation method and user of dry powder and gel preparation according to same dose Method is shown in embodiment 3,5), and then sterile gauze covers, and is administered once a day, the course for the treatment of one month, a month evaluation curative effect.

Curative effect determinate standard

It is effective：7-15 days festering wounds improve and healing；

Effectively：10-20 days wounds improve and healing；

It is invalid：The state of an illness is without improvement in treatment 30 days, continue to aggravate and deteriorate on the contrary or more than 15 days local wounds without Change.

The results show is in Figure 20.These experiments show that after using MG53 multimeric protein gel preparations, all cases foot Portion's gangrene improving situation, effective percentage 100%, wherein significantly effective percentage 95%.And using MG53 multimeric protein gel systems After agent, patient does not occur obvious adverse reaction, well-tolerated.

MG53 multimeric proteins can effectively treat diabetic foot ulcers and gangrene as from the foregoing, and without any pair Effect.

The cause of disease of diabetic foot gangrene is complicated, can be caused by malnutritive, atherosclerosis and wound.Diabetes blood Although pipe lesion is extensive, pathological development is slow, is conducive to the formation with Doppler flow mapping, is accumulated in early days if can be formed in gangrene Pole is treated, and is promoted the new life of blood vessel and epidermal cell, can effectively be alleviated or cure gangrene.Topical remedy used at present, Such as gentamicin, who, which allows, can suppress local bacterial growth, but cannot promote wound healing very well, and Chinese medicine promoting muscle growth functions week Phase is grown, less effective.Although epidermal growth factor has certain effect, but many patients use, and clinical manifestation is still invalid.

MG53 albumen is itself secretory protein in human body, is specifically present in skeletal muscle and cardiac muscle, and there is very strong cell to repair Multiple function.MG53 multimeric proteins can reach the therapeutic effect similar with its using only the 1/5 of MG53 monomeric protein dosage. Therefore, diabetic foot ulcers and gangrene can more effectively be treated compared to MG53 monomeric proteins, MG53 multimeric proteins.

Bibliography：

1.S.Matthaei, M.Stumvoll, M.Kellerer, H.U.Haring, Endocr Rev 21,585 (Dec, 2000).

2.C.M.Taniguchi, B.Emanuelli, C.R.Kahn, Nat Rev Mol Cell Biol 7,85 (Feb, 2006).

3.X.J.Sun et al., Nature 352,73 (Jul 4,1991)

4.A.R.Saltiel, C.R.Kahn, Nature 414,799 (Dec 13,2001)

5.C.X.Cai et al., Nature Cell Biology 11,56 (Jan, 2009)

Claims

1. mitsugumin 53 (MG53) polymer expressed by eukaryotic cells.

2. the MG53 polymers of claim 1, it is mainly made of MG53 dimeric forms.

3. the polymer of mitsugumin 53 (MG53) mutant expressed by eukaryotic cells, it is characterised in that should The polymer of MG53 mutant be any one or two or two in 7 cysteines of RING domains of the N-terminal of MG53 with On cysteine mutation be nonpolar amino acid mutant；7 cysteines are the 14th of RING domains respectively Site, the 17th site, the 29th site, the 34th site, the 37th site, the 53rd site, the 56th site.

4. the mutant of mitsugumin 53 (MG53) polymer expressed by eukaryotic cells, it is characterised in that MG53 Coiled-coil domains in serine sites sport amino acid in addition to threonine and tyrosine.

5. preparing the method for the MG53 polymers of claim 1 or 2, it comprises the following steps：

A. MG53 genes are connected to acquisition MG53 expression plasmids in expression vector, are preferably connected to table in the MG53 genes The MG53 genes are connected with signal peptide before up to carrier；

B. expression connects the MG53 expression plasmids of acquisition to produce MG53 polymer eggs in the step a in eukaryotic In vain.

6. preparing the method for the polymer of the MG53 mutant of claim 3 or 4, it comprises the following steps：

A. MG53 genes are mutated, obtain MG53 mutant genes；

B. MG53 mutant genes are connected to acquisition MG53 mutant expression plasmids in expression vector, preferably in the MG53 The MG53 mutant genes are connected by mutant gene before being connected to expression vector with signal peptide；

C. the MG53 mutant expression plasmid for connecting acquisition in the step b is expressed in eukaryotic to be mutated to obtain MG53 The multimeric protein of body.

7. pharmaceutical composition, it includes the MG53 polymers of claim 1 or 2 or the MG53 of any one of claim 3-12 to dash forward The polymer of variation.

8. the polymer of the MG53 polymers of claim 1 or 2 or the MG53 mutant of claim 3 or 4 is being prepared for pre- Anti- and/or treatment and the purposes in the pharmaceutical composition of cell membrane damage relevant disease.

9. the purposes of claim 8, wherein described include one kind or more selected from following disease with cell membrane damage relevant disease Kind：Leaked with myocardial cell injury relevant disease, with ulcer relevant disease, the wound with wound particularly Hard agglut wound, intestines And kidney injury.

10. the purposes of claim 9, wherein described include selected from related with following symptom to the relevant disease of myocardial cell injury Disease in one or more：Myocardial ischemia, heart ischemia/reperfusion injury, miocardial infarction, heart failure, arrhythmia cordis and Cardiac rupture, and described pharmaceutical composition will not cause the secondary work of insulin resistance, obesity, diabetes and metabolic syndrome With.