CN105012951A - Method of linked adhesion molecule JAM-A in promotion of skin wound restoration, and application of linked adhesion molecule JAM-A - Google Patents

Abstract

The invention relates to the technical fields of gene engineering technologies and biomedicines, and concretely relates to a method of a linked adhesion molecule JAM-A in promotion of skin wound restoration, and an application of the linked adhesion molecule JAM-A. The invention provides a new use of the linked adhesion molecule JAM-A, that is an application in the preparation of skin wound restoration medicines or reagents, and also provides the skin wound restoration method, and an application of linked adhesion molecule JAM-A gene expression vector pGC-FU-JAM-A-GFP lentivirus particles in the preparation of skin wound restoration medicines or reagents.

Description

Link adhesion molecule JAM-A promotes the method that skin wound is repaired and application thereof

Technical field

The present invention relates to technique for gene engineering and bio-pharmaceutical technical field, particularly relate to the novelty teabag of link adhesion molecule JAM-A in promoting skin wound to repair, also be a kind of method promoting skin wound to repair, and link adhesion molecule JAM-A is preparing the application in skin wound repair medicine or reagent.

Background technology

Skin is the maximum organ of people's bulk area, is also one of fastest tissue of body self renewal, it is that body avoids dewatering, damage, the first line of defence that infects, be the barrier maintaining homeostasis and stop microorganism, chemical substance etc. to invade.Flap coverage as early as possible, recovers the barrier function of skin, very important.Conventional Therapeutic Method adopts autologous skin or allogeneic, the transplanting of xenogeneic skin and artificial substituent to cover, owing to also existing for skin limited source, allogeneic, xenograft have the danger of immunological rejection or communicate illness, the problems such as artificial skin somewhat expensive, the needs that conventional method is difficult to meet clinical practice (participate in document 1:Meier TO, Guggenheim M, Vetter ST, et al.Microvascular regeneration in meshed skin transplants after severe burns.Burns.2011; 37 (6): 1010-4.).Therefore, promote that skin ultrastructure has become one of tissue repair field difficult problem urgently to be resolved hurrily, the reparation of research skin wound healing has important theoretical and practical significance.

Link adhesion molecule JAM-A (NM_016946) is a transmembrane molecule, contactin.Can be combined with intracellular PDZ (PSD-95/Discs-large/ZO-1) domain after JAM-A homodimerization, and cell migration, born of the same parents' internal/external signal transmits, cell tight junction and correlation with angiogenesis (participate in document 2:Severson EA closely, Lee WY, Capaldo CT, Nusrat A, Parkos CA.Junctional adhesion molecule A interactswith Afadin and PDZ-GEF2to activate Rap1A, regulate beta1integrin levels, and enhance cell migration.Molecular Biology of the Cell, 2009Vol.20, 1916 – 1925.).In addition, JAM-A is at cell migration, the aspects such as allelotaxis and epithelial cell differentiation also play an important role (see document 3:Nava P, Capaldo CT, Koch S, et.al.JAM-Aregulates epithelial proliferation through Akt/ β-catenin signalling.EMBO Rep.2011Apr, 12 (4): 314-20) researcher is had to be proved by cell scratch test, JAM-A can promote that migration of epithelial cells is (see document 4:PorfirioNava, Christopher T.Capaldo, Stefan Koch, KeliKolegraff, Carl Robert Rankin, AttilaE.Farkas, Mattie E.Fease, LinhengLi, Caroline Addis, CharlesA.Parkos & AsmaNusrat.JAM-A regulates epithelialproliferation through Akt/b-catenin signalling EMBO reports (2011) 12, 314 – 320).

There is no bibliographical information at present about JAM-A gene is in the application of wound repair.

Summary of the invention

The object of the present invention is to provide the novelty teabag of link adhesion molecule JAM-A, specifically prepare the application in skin wound repair medicine or reagent; Another object of the present invention is to provide a kind of method promoting skin wound to repair; The third object of the present invention is to provide a kind of carrier (pGC-FU-JAM-A-GFP) and the application thereof that link adhesion molecule JAM-A gene expression.

The present invention confirms that in pre-stage test JAM-A raises rear fibroblastic migration and multiplication capacity increases, and the mescenchymal stem cell after JAM-A modification significantly promotes the reparation of skin wound compared with matched group.Can so JAM-A direct wound healing?

Puzzled in order to answer these, the present invention constructs the process LAN of JAM-A and the slow virus of interference further to adjust the expression of JAM-A in wound tissue more efficiently and stably, detects JAM-A and be used alone whether can promote wound repair in body.

The starting point that the present invention selects slow virus to carry out vector construction is that the efficiency of infection of slow virus is higher and have higher safety (see document 5:Madry H, Cucchiarini M.Clinical potentialand challenges of using genetically modified cells for articular cartilage repair.Croat Med J.2011Jun; 52 (3): 245-61).Lentiviral gene carrier is the novel viral vectors transformed by I type human immunodeficiency virus, more and more extensive as the application of one efficient Gene transfer vector, transforms its transduction efficiency and safety is obtained for guarantee through multi-time modification.

A first aspect of the present invention, provides the novelty teabag of link adhesion molecule JAM-A, is specifically preparing the application in skin wound repair medicine or reagent.

Described medicine or reagent, can improve the expression of link adhesion molecule JAM-A, include but not limited to following arbitrary:

A) JAM-A and encoding gene thereof;

B) recombinant vector containing JAM-A encoding gene;

C) recombinant virus containing JAM-A encoding gene;

D) recombinant viral vector containing JAM-A encoding gene.

Described link adhesion molecule JAM-A (NM_016946), its cDNA sequence is as shown in SEQ IDNO:1.

In a preferred embodiment of the invention, the medicine or the reagent that improve link adhesion molecule JAM-A expression refer to recombinant vector pGC-FU-JAM-A-GFP.

Described skin wound reparation, " wound surface " to be wherein normal skin (tissue) in the external world cause injury factor as surgical operation, external force, heat, electric current, chemical substance, low temperature and body intrinsic factor as under the effects such as local blood supply obstacle the infringement that causes; Normal with the destruction of skin integrity and the loss of a certain amount of normal structure, meanwhile, the normal function of skin is impaired; Also referred to as wound or wound.Wound repair is also referred to as wound repair, wound healing etc., refer to that skin (tissue) is by regeneration (Regeneration), reparation (Repair), reconstruction (Reconstruction), recovers its function to some extent.

A second aspect of the present invention, provides a kind of method promoting skin wound to repair.

A kind of method promoting skin wound to repair of the present invention adopts the medicine or reagent modification wound surface skin that improve link adhesion molecule JAM-A expression.

Described modification preferably, is, by hypodermic mode, the medicine or reagent that improve link adhesion molecule JAM-A expression are injected wound surface skin histology;

In a preferred embodiment of the invention, be, by hypodermic mode, recombinant vector pGC-FU-JAM-A-GFP is transplanted to all skin histologies of wound.

A kind of method promoting skin wound to repair of the present invention, the method comprises: the recombinant vector building a kind of JAM-A high expressed, includes but not limited to pGC-FU-JAM-A-GFP, is transplanted to skin wound surrounding by hypodermic mode.

The cell of the fibroblast in pGC-FU-JAM-A-GFP main infection wound surface skin of the present invention and the connective tissue sheath of hair follicle.

A third aspect of the present invention, provides a kind of carrier linking adhesion molecule JAM-A gene expression, and provides this carrier preparing the application in skin wound repair medicine or reagent.

A kind of carrier linking adhesion molecule JAM-A gene expression of the present invention can be a kind of recombinant vector, a kind of recombinant virus, a kind of recombinant viral vector etc. containing JAM-A encoding gene containing JAM-A encoding gene containing JAM-A encoding gene.

In a preferred embodiment of the invention, the carrier of described link adhesion molecule JAM-A gene expression is pGC-FU-JAM-A-GFP.

The invention provides a kind of recombinant vector pGC-FU-JAM-A-GFP, and have detected ability and biological safety etc. that this carrier urgees wound repair.The present invention also provides the method adopting pGC-FU-JAM-A-GFP to promote wound repair further, and the application of pGC-FU-JAM-A-GFP in wound repair.

The present invention is based on JAM-A in earlier stage and can promote cell migration, regulate the experimental basis such as epithelial cell rearrangement, build containing genes of interest JAM-A slow virus over-express vector, by its directed calibrated shot to creating week, to express ectogenic JAM-A with startup, obtain JAM-A high expressed wound surface group mice, be referred to as JAM-A ^ov-mice.By 5 × 10 ⁵the pGC-FU-JAM-A – GFP lentiviral particle mode that adopts wound to put intradermal injection Thursday be transplanted to the mice of full thickness dermal, inject time is after wound 24 hours.Observe and add up wound surface recovery situation after injection.

The invention provides a kind of method that JAM-A gene infects all skin of wound, particular content is the gene structure according to JAM-A, design pair of primers, with human epidermal cell total serum IgE for template, increased by RT-PCR, preparation JAM-A cDNA, then build recombined human peGFP-N1-JAM-A carrier for expression of eukaryon, for improving transfection efficiency, build slow virus process LAN plasmid pGC-FU-JAM-A-GFP.

The invention provides a kind of construction method linking adhesion molecule JAM-A process LAN plasmid, comprise the following steps (i.e. the construction method of pGC-FU-JAM-A-GFP):

A, design and synthesize primer P1 and P2, amplification JAM-A cDNA:

P1：CCTGAAGCTTATGGGGACAAAGGC(SEQ ID NO:2)

P2：ACCAGGATCCAACACCAGGAATGACGAGG(SEQ ID NO:3)

Person skin cell total RNA as template, by rt-pcr amplification, preparation of JAM - A cDNA sequence is as follows:atcgcgatggggacaaaggcgcaagtcgagaggaaactgttgtgcctcttcatattggcgatcctgttgtgctccctggcattgggcagtgttacagtgcactcttctgaacctgaagtcagaattcctgagaataatcctgtgaagttgtcctgtgcctactcgggcttttcttctccccgtgtggagtggaagtttgaccaaggagacaccaccagactcgtttgctataataacaagatcacagcttcctatgaggaccgggtgaccttcttgccaactggtatcaccttcaagtccgtgacacgggaagacactgggacatacacttgtatggtctctgaggaaggcggcaacagctatggggaggtcaaggtcaagctcatcgtgcttgtgcctccatccaagcctacagttaacatcccctcctctgccaccattgggaaccgggcagtgctgacatgctcagaacaagatggttccccaccttctgaatacacctggttcaaagatgggatagtgatgcctacgaatcccaaaagcacccgtgccttcagcaactcttcctatgtcctgaatcccacaacaggagagctggtctttgatcccctgtcagcctctgatactggagaatacagctgtgaggcacggaatgggtatgggacacccatgacttcaaatgctgtgcgcatggaagctgtggagcggaatgtgggggtcatcgtggcagccgtccttgtaaccctgattctcctgggaatcttggtttttggcatctggtttgcctatagccgaggccactttgacagaacaaagaaagggacttcgagtaagaaggtgatttacagccagcctagtgcccgaagtgaaggagaattcaaacagacctcgtcattcctggtgtgag ( SEQ IDNO:1 ) 。

B, structure slow virus process LAN plasmid pGC-FU-JAM-A-GFP.

In step B, used carrier is pGC-FU-GFP, and construction method is this area routine techniques, see the beautiful work of Marvin's, and " molecular biology experiment handbook ", People's Medical Officer Press.

Further, the invention provides above-mentioned a kind of carrier linking adhesion molecule JAM-A gene expression and prepare the application in skin wound repair medicine or reagent.

In a preferred embodiment of the invention, provide pGC-FU-JAM-A-GFP lentiviral particle and prepare the application in skin wound repair medicine or reagent.

Described application, particularly, by 5 × 10 ⁵pGC-FU-JAM-A-GFP be transplanted to wound surface surrounding by hypodermic mode.PGC-FU-JAM-A-GFP main infection is created the cell of the connective tissue sheath of fibroblast in all skin and hair follicle and is promoted the secretion of wound repair correlation factor, and then promotes the reparation of wound surface.

Study discovery by experiment, pGC-FU-JAM-A-GFP injection group comparatively pGC-FU-GFP injection group, wound repair speed significantly increases (Fig. 1).

According to the cell in the hair follicle connective tissue sheath in the location deducibility virus main infection wound week of GFP albumen in all skin flbroblast of wound and hair follicle connective tissue sheath and fibroblast (Fig. 2).

Western-blot result display pGC-FU-JAM-A-GFP injection form TGF-β, bFGF and EGF in all skin expression comparatively pGC-FU-GFP injection group significantly increase (Fig. 3).

After wound surface recovers completely, the skin fine structure of pGC-FU-JAM-A-GFP injection group that what hematoxylin-eosin (H-E) dyeed found that, compared with pGC-FU-GFP injection group, shows the appendages (Fig. 4) such as more as seen hair follicle.

The present invention tests proof, and JAM-A can promote the expression of wound surface TGF-β, bFGF and EGF, significantly improves the reparation speed of wound surface, and promotes the formation of newborn wound surface appendages.This illustrates, JAM-A repairs relevant with promotion skin wound.The present invention is that skin wound is repaired fast and in organization engineering skin, the formation of skin appendages provides new thinking and mode.

Accompanying drawing explanation

Fig. 1 be JAM-A process LAN slow virus pGC-FU-JAM-A-GFP inject after skin wound repair speed comparatively empty carrier injection group significantly accelerate.

Fig. 2 is the location after detection slow virus infection in wounds in mice surrounding skin tissue, and wherein ApGC-FU-JAM-A-GFP injection group, B pGC-FU-GFP injection group, arrow indication is the green fluorescent protein translated after viral infection organizes cell.

Fig. 3 be TGF-β, bFGF and EGF after western-blot detects pGC-FU-JAM-A-GFP injection in wound surface skin expression comparatively pGC-FU-GFP injection group significantly increase.

The change of cutaneous ultrastructure after Fig. 4 hematoxylin-eosin (HE) dyeing display pGC-FU-JAM-A-GFP injection, result display pGC-FU-JAM-A-GFP injection group comparatively pGC-FU-GFP injection group has more skin appendages to occur, wherein A pGC-FU-JAM-A-GFP injection group, BpGC-FU-GFP injection group, arrow indication is newborn skin appendages hair follicle.

Detailed description of the invention

Now in conjunction with the embodiments and accompanying drawing, the present invention is described in detail, but enforcement of the present invention is not limited only to this.

Agents useful for same of the present invention and raw material all commercially maybe can be prepared by literature method.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as the people such as Sambrook " molecular cloning: lab guide " (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or conveniently condition, or according to the condition that manufacturer advises.Unless otherwise indicated, otherwise percentage ratio and number calculate by weight.

Embodiment 1: build slow virus process LAN plasmid pGC-FU-JAM-A-GFP

1, human epidermal cell total serum IgE is prepared

Normal adult skin is from Changhai hospital plastic surgery.Original cuiture obtains epidermis cell.With Shanghai Hua Shun biological engineering company limited total serum IgE extraction agent box, guanidine isothiocyanate method routinely extracts and obtains total serum IgE.Method is as follows:

Get the epidermis cell of the monolayer growth of the culture dish of a ware diameter 3.5cm, directly discard culture medium, add the TRIzol dissolved cell of 1ml, after cell fully dissolves, with pipet, cell lysate is shifted out.Lysis sample is hatched 5 minutes under 15 ~ 30 DEG C of conditions, ribosome is decomposed completely.Every 1mlTRIzol adds 0.2ml chloroform, hatches 2 ~ 3 minutes with hands shaking test tube 15 seconds after covering tightly sample cell lid at 30 DEG C.To be no more than 12 under 2 ~ 8 DEG C of conditions, the centrifugal force frozen centrifugation of 000 × g 15 minutes.Mixture after centrifugal can be divided into three layers: lower floor is red phenol chloroform layer, the colourless water sample layer in intermediate layer and upper strata.RNA is present in the middle of the water sample layer of upper strata, and its capacity is approximately 60% of added TRIzol capacity.Water sample layer is transferred to one with DEPC process, without in the test tube of RNase, by carrying out precipitated rna with isopropyl alcohol mixing.Every 1ml TRIzol adds 0.5ml isopropyl alcohol.The sample of mixing is hatched under 15 ~ 30 DEG C of conditions 10 minutes then under 2 ~ 8 DEG C of conditions to be no more than 12, the centrifugal force high speed frozen centrifugation of 000 × g 10 minutes.RNA precipitation can form a gluey flaky precipitate after centrifugation and be attached at the bottom of test tube wall and pipe.Once, the TRIzol of every 1ml at least adds 75% ethanol of 1ml to ethanol (preparing with the ultra-pure water of DEPC process) washing RNA precipitation with 75%.Vortex vibration biased sample to be no more than 7 under 2 ~ 8 DEG C of conditions, the centrifugal force high speed frozen centrifugation of 500 × g 5 minutes.Air drying 5 ~ 10 minutes RNA precipitations.RNA can not be allowed to precipitate bone dry, its solubility can be reduced.RNA sample is dissolved with the ultra-pure water of DEPC process.

2, synthetic primer and structure peGFP-N1-JAM-A carrier for expression of eukaryon

[1]. design primer

Forward primer: CCTG aTGGGGACAAAGGC (SEQ ID NO:2)

Hind Ⅲ

Downstream primer: ACCA aACACCAGGAATGACGAGG (SEQ ID NO:3)

BamH Ⅰ

Restriction enzyme site is Hind III and BamH I, adds 5 ' end of primer respectively, and adds the protection base of restriction enzyme site.

[2] .RT-PCR amplification object fragment

The cDNA obtained with reverse transcription is template, fishes and gets genes of interest fragment.Method is as follows:

Get 5 μ lPCR products, do 1% agarose gel electrophoresis (containing EB 0.5 μ g/ml; Voltage: 80V) qualification; All the other are for recovery, purification object fragment.

[3]. reclaim purification object fragment

45 μ l PCR primer through 1% agarose gel electrophoresis (containing EB 0.5 μ g/ml; Voltage: 50V) isolate object band, uviol lamp cuts the gel containing object band, by middle Ke Yingda 3S DNA GelPurification Kit recovery, purification object fragment, operational approach is shown in description, finally dissolves target DNAs with 50 μ l ddH2O.Get 5 μ l and do 1% agarose gel electrophoresis (containing EB 0.5 μ g/ml; Voltage: 80V) qualification; All the other put-20 DEG C of preservations.Electrophoresis is shown in that clip size meets the requirements, and prepares enzyme action, connection.

[4]. the qualification of recombiant plasmid and preservation

Reclaim respectively, the carrier segments of purification after Hind III and BamH I double digestion and object fragment.Gained DNA is dissolved in 30 μ l ddH2O separately, and 1% agarose gel electrophoresis is (containing EB 0.5 μ g/ml; Voltage: 80V) qualification ,-20 DEG C of preservations.

Connect the carrier segments after enzyme action and object fragment with the restructuring of T4DNA ligase, form pEGFP-JAM-A recombiant plasmid.With above-mentioned recombinant plasmid transformed competence colibacillus bacillus coli DH 5 alpha, amplification antibacterial is also checked order.

3, slow virus process LAN plasmid pGC-FU-JAM-A-GFP

Design primer adopts PCR method to fish from JAM-A carrier for expression of eukaryon and gets genes of interest, method is as follows: reaction system: Primer (+) 0.4 μ L, Primer (-) 0.4 μ L, 10 × buffer 2.0 μ L, MgCl20.5 μ L, dNTPs (2.5mmol/L) 0.8 μ L, Taq polymerase 0.2 μ L, plasmid 1 μ L (negative control group does not add), is configured to 20 μ L by ddH2O.PCR reaction condition: DEG C DEG C renaturation 30s → 72, degeneration 30s → 60,94 DEG C of thermal starting 30s → 94 DEG C extend 30s, 30 circulations, last 72 DEG C of polymerization 6min.Selecting positive colony send Invitrogen company to carry out order-checking qualification.

Primer sequence is as follows:

JAM-A-Age I-F

GAGGATCCCCGGGTACCGGTCGCCACCATGGGGACAAAGGCGCAAG(SEQ ID NO:4)

JAM-A-Age I-R

TCACCATGGTGGCGACCGGCACCAGGAATGACGAGGTC(SEQ IDNO:5)

Ubi-F

GGGTCAATATGTAATTTTCAGTG(SEQ ID NO:6)

EGFP-N-R：

CGTCGCCGTCCAGCTCGACCAG(SEQ ID NO:7)

Age I is used to carry out enzyme action to obtain linearisation template to the JAM-A process LAN plasmid obtained and viral vector:

Endonuclease reaction system:

37 DEG C are reacted 2 hours.

PCR primer exchange enters linearisation slow virus carrier and prepares slow virus process LAN plasmid pGC-FU-JAM-A-GFP

In 25 DEG C of reactions 30 minutes, then exchange liquid in 42 DEG C of reactions preparation in 15 minutes, prepare conversion step as follows:

From every kind of competent cell suspension, getting 200 μ l with the sterile pipette tip of cooling transfers in aseptic microcentrifugal tube, and often pipe adds 10 μ l connecting fluids, rotates gently to mix content, places 30 minutes in ice.Pipe is put on the EP pipe support put well in pre-heating to the circulator bath of 42 DEG C, exactly places 90 seconds, do not shake EP pipe support.Fast pipe is transferred in ice bath, make cell cool l-2 minute.Often pipe adds 800 μ l LB culture medium.Heat to 37 DEG C with water-bath by culture medium, then transferred to by pipe on 37 DEG C of shaking tables, incubation makes bacteria resuscitation in 45 minutes.The competent cell that 150 μ l have transformed is transferred on the LB agar culture medium of AMP resistance (100ug/ml).

Flat board is placed in room temperature until liquid is absorbed.Be inverted plate, in 37 DEG C of cultivations, 16 hours.The clone grown carries out follow-up PCR qualification.

Embodiment 2: slow virus process LAN plasmid pGC-FU-JAM-A-GFP infective wound surface skin

1. the preparation of full thickness dermal wounds and virus injection

All zooperies are all in accordance with the requirement of NIH laboratory animal.Laboratory animal is BALB/c nude mice in 6 week age, and male and female are not limit, heavily about 30g, is provided by The 2nd Army Medical College Experimental Animal Center.Receptor is divided into 2 groups at random; often organize 12; lumbar injection 1% Nembutal sodium solution, makes a size at the other lower back card punch of nude mice spinal column after anesthesia and is about both sides, back and prepares the whole bark Wound Defect that diameter is 12cm, external kpetrolatum gauze covering protection wound surface.

Transplant through subcutaneous injection after 24 hours after modeling and get 5 × 10 ⁵pGC-FU-JAM-A-GFP and pGC-FU-GFP.Nude mice back wound is injected in right amount all subcutaneous with 1 microsyringe extraction viral suspension.Feed under SPF level condition, observe every day, transplanting rear 1,3,5,7, draws materials for 14 days.

2. wound surface resume speed and somatomedin detect

[1] healing speed measures

After virus injection, for determining wound surface area, digital camera is taken pictures wound surface and scale, application ImagePro Plus

Medical image analysis computed in software wound surface area.Unified scale, ratio and exposal model is selected when all pictures are taken pictures.Result shows, and pGC-FU-JAM-A-GFP injection is formed face and is significantly less than pGC-FU-GFP injection group, illustrates that pGC-FU-JAM-A-GFP injection group wound repair speed is significantly faster than pGC-FU-GFP injection group.As shown in Figure 1, * P<0.01.

[2] location of the rear slow virus of injection observed by frozen section

After virus injection, 4 days wound weeks located skin for each group to draw materials, conventional frozen section (thickness is 8 microns).The expression of green fluorescent protein GFP is detected with fluorescence microscope.

Result: GFP positive mark is more common in the granulation tissue around wound surface, and pGC-FU-JAM-A-GFP injection group fluorescence is spot distribution, the expression characteristic of compound JAM-A.These results represent that the virion with GFP spike moves in the histiocyte in wound week.As shown in Figure 2.

3.western-blot detects the expression in the short wound repair correlation factor (bFGF, TGF-β and EGF) of wound week tissue

[1]. within after collecting wound 5 days, be the lentiviral particle injection wound of latter 4 days week specimen, be all 0.5cm of wound, the collecting pipe being placed in 5mL adds, add the lysate+corresponding protease inhibitor (protease inhibitor) of appropriate tissue+appropriate in proportion, electric homogenate machine homogenate;

[2]. hatch 40min on ice after homogenate, during this period of time, interval rifle head piping and druming homogenate, ensures that lysate fully contacts with tissue, cracking;

[3] .4 DEG C, 13000 turns, centrifugal 30 ~ 40min;

[4]. get supernatant and be original total protein sample.

[5]. a part of albumen (10ul) is for measuring protein concentration, and BCA fado is used.

[6]. a part of albumen adds sample-loading buffer in addition, 100 DEG C of degeneration 5min, returns to after room temperature prepare loading until sample.

[7]. join glue, electrophoresis, transferring film.

[8]. the pvdf membrane of existing protein sample is immersed in room temperature in 5%BSA confining liquid and slowly sways one hour.Under primary antibodie room temperature, jog hatches one hour.

[9]. select suitable two to resist according to primary antibodie source, select the antibody of horseradish peroxidase HRP labelling according to authentication method, by corresponding proportion dilution (1:1000 ~ 1:10000), room temperature jog one hour.

[10]. washing, uses horseradish peroxidase HRP-ECL luminescence method.

Result is visible, compares with pGC-FU-GFP injection group, and GC-FU-JAM-A-GFP injection group bFGF, the expression of TGF-β and EGF significantly increases.As shown in Figure 3.

4) microstructure of wound surface neoplastic skin is observed in H-E dyeing

Within latter 14 days, draw materials in transplanting, get and respectively form face central diameter 1.5cm expanses of skin, 4% paraformaldehyde fixes 24 hours, paraffin embedding, serial section, and slice thickness is 5 μm.To the capable H-E dyeing of wound surface skin biopsy, basis of microscopic observation finds: after 14 days, face of respectively forming covers all, but the neoplastic skin of injection pGC-FU-JAM-A-GFP has a large amount of skin to follow closely and neoplastic skin appendages occurs, pGC-FU-GFP injection group occurs without appendages.As shown in Figure 4.

Below the preferred embodiment of the invention is illustrated, but the invention is not limited to described embodiment, those of ordinary skill in the art also can make all equivalent modification or replacement under the prerequisite without prejudice to the invention spirit, and these equivalent modification or replacement are all included in the application's claim limited range.

Claims (10)

1. link adhesion molecule JAM-A and prepare the application in skin wound repair medicine or reagent.

2. link adhesion molecule JAM-A according to claim 1 is preparing the application in skin wound repair medicine or reagent, it is characterized in that, described medicine or reagent are medicine or the reagent of the expression improving link adhesion molecule JAM-A.

3. link adhesion molecule JAM-A according to claim 2 is preparing the application in skin wound repair medicine or reagent, it is characterized in that, described medicine or pack are containing following arbitrary:

A) JAM-A and encoding gene thereof;

B) recombinant vector containing JAM-A encoding gene;

C) recombinant virus containing JAM-A encoding gene;

D) recombinant viral vector containing JAM-A encoding gene.

4. link adhesion molecule JAM-A according to claim 2 is preparing the application in skin wound repair medicine or reagent, it is characterized in that, described medicine or pack are containing recombinant vector pGC-FU-JAM-A-GFP.

5. promote to it is characterized in that the method that skin wound is repaired, the method adopts the medicine or reagent modification wound surface skin that improve link adhesion molecule JAM-A expression.

6. a kind of method promoting skin wound to repair according to claim 5, is characterized in that, described modification is, by hypodermic mode, the medicine or reagent that improve link adhesion molecule JAM-A expression are injected wound surface skin histology.

7. a kind of method promoting skin wound to repair according to claim 5, is characterized in that, described modification is, by hypodermic mode, recombinant vector pGC-FU-JAM-A-GFP is transplanted to all skin histologies of wound.

8. the carrier linking adhesion molecule JAM-A gene expression is preparing the application in skin wound repair medicine or reagent.

9. a kind of carrier linking adhesion molecule JAM-A gene expression according to claim 8 is preparing the application in skin wound repair medicine or reagent, it is characterized in that, described a kind of carrier linking adhesion molecule JAM-A gene expression is pGC-FU-JAM-A-GFP.

10. a kind of carrier linking adhesion molecule JAM-A gene expression according to claim 9 is preparing the application in skin wound repair medicine or reagent, and it is characterized in that, described application comprises the following steps:

A, design and synthesize primer P1 and P2, amplification JAM-A cDNA:

P1：CCTGAAGCTTATGGGGACAAAGGC(SEQ ID NO:2)

P2：ACCAGGATCCAACACCAGGAATGACGAGG(SEQ ID NO:3)

With human epidermal cell total serum IgE for template, increased by RT-PCR, preparation JAM-A cDNA, sequence is as shown in SEQ ID NO:1;

B, structure slow virus process LAN plasmid pGC-FU-JAM-A-GFP;

C, the pGC-FU-JAM-A-GFP obtained by step B are transplanted to wound surface surrounding by hypodermic mode.