CN107012200A - The anvil method for identifying molecules of pumpkin ' big anvil 1 ' cenospecies - Google Patents
The anvil method for identifying molecules of pumpkin ' big anvil 1 ' cenospecies Download PDFInfo
- Publication number
- CN107012200A CN107012200A CN201610677462.6A CN201610677462A CN107012200A CN 107012200 A CN107012200 A CN 107012200A CN 201610677462 A CN201610677462 A CN 201610677462A CN 107012200 A CN107012200 A CN 107012200A
- Authority
- CN
- China
- Prior art keywords
- anvil
- specific band
- pumpkin
- cenospecies
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 235000009854 Cucurbita moschata Nutrition 0.000 title claims abstract description 22
- 240000001980 Cucurbita pepo Species 0.000 title claims abstract description 22
- 235000000832 Ayote Nutrition 0.000 title claims abstract description 17
- 235000009804 Cucurbita pepo subsp pepo Nutrition 0.000 title claims abstract description 16
- 238000000034 method Methods 0.000 title claims abstract description 16
- 235000015136 pumpkin Nutrition 0.000 title claims abstract description 16
- 238000009396 hybridization Methods 0.000 claims abstract description 8
- 230000008774 maternal effect Effects 0.000 claims abstract description 7
- 238000001962 electrophoresis Methods 0.000 claims abstract description 4
- 238000002264 polyacrylamide gel electrophoresis Methods 0.000 claims abstract description 3
- 238000001514 detection method Methods 0.000 claims description 11
- 108020004414 DNA Proteins 0.000 claims description 8
- 102100039496 Choline transporter-like protein 4 Human genes 0.000 claims description 7
- 101000889282 Homo sapiens Choline transporter-like protein 4 Proteins 0.000 claims description 7
- 235000009852 Cucurbita pepo Nutrition 0.000 claims description 6
- 238000012408 PCR amplification Methods 0.000 claims description 5
- 239000003147 molecular marker Substances 0.000 claims description 5
- 235000020354 squash Nutrition 0.000 claims description 5
- 230000000692 anti-sense effect Effects 0.000 claims 2
- 108091028043 Nucleic acid sequence Proteins 0.000 claims 1
- 239000002773 nucleotide Substances 0.000 claims 1
- 125000003729 nucleotide group Chemical group 0.000 claims 1
- 238000011144 upstream manufacturing Methods 0.000 claims 1
- 238000004519 manufacturing process Methods 0.000 abstract description 7
- 238000005406 washing Methods 0.000 description 5
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 4
- 239000003550 marker Substances 0.000 description 4
- QTBSBXVTEAMEQO-UHFFFAOYSA-N Acetic acid Chemical compound CC(O)=O QTBSBXVTEAMEQO-UHFFFAOYSA-N 0.000 description 3
- 240000008067 Cucumis sativus Species 0.000 description 3
- 235000010799 Cucumis sativus var sativus Nutrition 0.000 description 3
- HEMHJVSKTPXQMS-UHFFFAOYSA-M Sodium hydroxide Chemical compound [OH-].[Na+] HEMHJVSKTPXQMS-UHFFFAOYSA-M 0.000 description 3
- 239000000463 material Substances 0.000 description 3
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 2
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 2
- 108091092878 Microsatellite Proteins 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 238000005119 centrifugation Methods 0.000 description 2
- 238000006243 chemical reaction Methods 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 238000004321 preservation Methods 0.000 description 2
- 239000000047 product Substances 0.000 description 2
- 108090000623 proteins and genes Proteins 0.000 description 2
- 238000012797 qualification Methods 0.000 description 2
- 238000012216 screening Methods 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 1
- 235000003949 Cucurbita mixta Nutrition 0.000 description 1
- 240000004244 Cucurbita moschata Species 0.000 description 1
- 241000196324 Embryophyta Species 0.000 description 1
- GRYLNZFGIOXLOG-UHFFFAOYSA-N Nitric acid Chemical compound O[N+]([O-])=O GRYLNZFGIOXLOG-UHFFFAOYSA-N 0.000 description 1
- 108091081062 Repeated sequence (DNA) Proteins 0.000 description 1
- 238000000246 agarose gel electrophoresis Methods 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 238000000137 annealing Methods 0.000 description 1
- 238000009395 breeding Methods 0.000 description 1
- 230000001488 breeding effect Effects 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 230000004087 circulation Effects 0.000 description 1
- 238000010367 cloning Methods 0.000 description 1
- 239000000084 colloidal system Substances 0.000 description 1
- 238000012258 culturing Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 230000007850 degeneration Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 238000001914 filtration Methods 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 238000003306 harvesting Methods 0.000 description 1
- 238000007689 inspection Methods 0.000 description 1
- 238000013507 mapping Methods 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000001426 native polyacrylamide gel electrophoresis Methods 0.000 description 1
- 229910017604 nitric acid Inorganic materials 0.000 description 1
- 238000001556 precipitation Methods 0.000 description 1
- 230000002035 prolonged effect Effects 0.000 description 1
- 238000003908 quality control method Methods 0.000 description 1
- 230000003252 repetitive effect Effects 0.000 description 1
- 238000010186 staining Methods 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- DGVVWUTYPXICAM-UHFFFAOYSA-N β‐Mercaptoethanol Chemical compound OCCS DGVVWUTYPXICAM-UHFFFAOYSA-N 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the SSR primers and method for anvil pumpkin ' big anvil 1 ' Hybridization identification.SSR primers used are：Forward primer：5 ' CAAATTCAGACGCTTCTTTTGG 3 ' and reverse primer：5 ' AGAATTGAGCAAAAAGGAGATGG 3 ', authentication method comprises the following steps：(1) extract for examination pumpkin seedling leaves genomic DNA；(2) using pumpkin genomic DNA as template, enter performing PCR using SSR primers and expand；(3) polyacrylamide gel electrophoresis is carried out to amplified production；(4) electrophoresis result is analyzed, the specific band expanded according to PCR, if male parent and maternal specific band, as real cenospecies occurs in filial generation simultaneously；It is false hybridization if the specific band of male parent or female parent only occurs in filial generation.This method has quick, accurate, low cost, simple operation and other advantages.
Description
Technical field
The present invention relates to Molecular Detection field, a kind of quick, detection anvil conveniently, accurate and effective is with pumpkin ' big anvil 1 '
The method for identifying molecules of cenospecies, belongs to biology field.
Background technology
Seed purity, is to ensure that kind merit is able to the key factor showed, is also most spine in seed quality control
The problem of hand.Traditional field ecology cenospecies method of inspection is easily influenceed by environmental condition and cultivation step, qualification cycle
Long, cost is high, and qualification result accuracy is poor.
With the fast development of marker assisted selection instrument, DNA molecular marker is better than traditional identification in terms of many
Method, can make up many defects and problem present in conventional identification method, be that quick, accurate mirror is carried out to seed cenospecies
Fixed developing direction and inevitable choice.At present, SSR molecular marker technology is the common method for being used to identify cenospecies at this stage.
SSR (Simple sequence repeat, SSR) is that simple repeated sequence is to be prevalent in eukaryotic gene
A kind of repetitive sequence in group.SSR marker belongs to microsatellite marker, has many good qualities, including polymorphism height, codominance, repetition
Property good, quantity is abundant, wide to genomic coverage and easy detection simple to operate, thus as build genetic linkage mapses,
Diversity Detection, carry out molecular mark, pedigree analysis, Variety fingerprinting draw, variety detection with
And the ideal tools of objective trait molecular marker screening, it has been widely used in gene mapping and cloning, cultivar identification, crops
The field such as breeding and Study on Evolution.
It is maternal with ' SF1 ' that anvil is with pumpkin ' big anvil 1 ', and ' S26 ' is the pumpkin first cross kind that male parent is bred as.Have
The characteristics of strong, the high resistance to wilt good with cucumber affinity, Grafted Cucumber Seedling increase sugar-preserved gourd brightness, the big face in cucumber in greenhouse production
Product application.In order to ensure the popularization of superior hybrid crosses and produce maximum economic benefit, filtering out can be to pumpkin ' big anvil 1
Number ' cenospecies carry out precise Identification SSR primers, with solve ' big anvil 1 ' cause seed production purity not high during the production of hybrid seeds
Problem, for seed production and operation enterprise provide one accurately, stably, quickly, the side of practical ' big anvil 1 ' Hybridization identification
Method.
The content of the invention
It is an object of the invention to provide a kind of primer sequence for being used to detect ' big anvil 1 ' squash hybridization kind.Mesh of the present invention
Also reside in a kind of method for identifying molecules using above-mentioned primer progress ' big anvil 1 ' squash hybridization kind be provided.
To achieve the above object, the present invention is adopted the following technical scheme that：
(1) genomic DNA of pumpkin seedling is extracted；
(2) using genomic DNA as template, enter from acquired SSR primers performing PCR amplification filter out male parent ' S26 ' with
The obvious primer NG22 of specific band difference between maternal ' SF1 '；
(3) genomic DNA using anvil squash hybridization kind ' big anvil 1 ' enters performing PCR as template using SSR primers NG22
Amplification, polyacrylamide gel electrophoresis detection is carried out to amplified production；
(4) electrophoresis detection result is analyzed：It is true if male parent and maternal specific band occurs in filial generation simultaneously
Positive cenospecies；It is false cenospecies if the specific band of male parent or female parent only occurs in filial generation；
Brief description of the drawings
Figure：Amplifications of the SSR marker NG22 in parent and filial generation, M is pBR322DNA/Msp I, and 1-6 is ' big anvil 1
Number ', 7-8 is male parent, and 9-10 is female parent.
Embodiment
Method in order to be able to more clearly illustrate the present invention, makees with specifically to test method of the invention below
Bright, need to be illustrated herein is：Reagent used in the present invention is commercially available.
(1) for examination pumpkin material
Material therefor includes anvil squash hybridization kind ' big anvil 1 ' and its male parent ' S26 ' and female parent ' SF1 '.
(2) for the extraction of examination pumpkin genomic DNA
(1) leaf harvest：To be seeded in for examination pumpkin material in culturing pot, and treat three leaves wholeheartedly period, take at the top of plant compared with
For tender blade, saved backup at -80 DEG C.
(2) take a piece of cushaw leaf in 1.5ml centrifuge tubes, be fully ground on ice chest, add 600 μ l preheating 2 ×
CTAB buffer solutions, 10 μ l beta -mercaptoethanol, are gently mixed, 65 DEG C of water-bath 1h (being jiggled once every 10min).
(3) add isometric chloroform, gently mix, 12000rpm centrifugation 10min take supernatant in another new centrifuge tube
In.
(4) ibid.
(5) what is added waits the product isopropanol of body precooling, gently mixes, -20 DEG C of preservation 30min, 12000rpm centrifugations
10min, abandons supernatant.
(6) 70% ethanol washing precipitation 2-3 times, is placed in superclean bench and air-dries.
(7) 50 μ l ddH is added2O dissolves.
(8) detection of DNA mass：1% agarose gel electrophoresis detection.
(3) screening of SSR molecular marker primer
Enter the specific band that filters out between male parent and female parent of performing PCR amplification from acquired 56 SSR primers poor
Different obvious primer, i.e. NG22.
PCR reaction systems and program
(1) PCR reaction systems
(2) PCR response procedures
PCR response procedures：
94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30s, 57 DEG C of annealing 30s, 72 DEG C of extension 1min, 30 circulations；72 DEG C are always prolonged
Stretch 10min.Preserved in 4 DEG C of refrigerators.
PCR primer is detected
(3) 12% native polyacrylamide gel electrophoresis is detected to PCR amplifications：
Gel component (15ml)：
150V electrophoresis 3h, close power supply, and to colloid washing twice, 10% ethanol fixes 10min, wash twice, 1% nitric acid
Be sensitized 5min, washing twice, 0.2% cma staining 30min, twice, 2% sodium hydroxide develops the color to there is clear purpose for washing
Band, twice, 10% acetic acid stops aobvious 2min for washing, washes twice, preservation of taking pictures.
As illustrated, 1-5：Anvil amplifies 107bp and the bands of 113bp two with pumpkin ' big anvil 1 '；6,7：Male parent ' S26 '
Amplify 113bp band；8,9：Maternal ' SF1 ' amplifies 107bp band.Specific band is reclaimed, is served
Marine growth engineering company is sequenced.The sequence of 113bp bands such as SEQ ID NO in cenospecies:Shown in 3,107bp bands
Sequence such as SEQ ID NO:Shown in 4, it is consistent with the sequence of male parent, maternal amplified production.
Claims (2)
1. one kind is used for the SSR primers NG22 of anvil pumpkin ' big anvil 1 ' cenospecies Molecular Identification, it is characterised in that draw upstream
Thing：5 '-CAAATTCAGACGCTTCTTTTGG-3 ', anti-sense primer：5 '-AGAATTGAGCAAAAAGGAGATGG-3 ', it is described on
Swim primer nucleotide sequences such as SEQ ID NO:Shown in 1, the anti-sense primer nucleotide sequence such as SEQ ID NO:Shown in 2.
2. using primer described in claim 1, detecting the method for identifying molecules of anvil squash hybridization kind ' big anvil 1 ', it is special
Levy and comprise the following steps：
(1) genomic DNA of pumpkin seedling is extracted；
(2) using genomic DNA as template, the NG22 primers of usage right requirement 1 enter PCR amplifications；
(3) polyacrylamide gel electrophoresis detection is carried out to pcr amplification product；
(4) electrophoresis detection result is analyzed：It is real if male parent and maternal specific band occurs in filial generation simultaneously
Cenospecies；If the specific band of male parent or female parent only occurs in filial generation, produced by being false cenospecies, SSR molecular marker primer
Specific band size it is as follows：Primer NG22 is 113bp to the specific band size produced by male parent, to produced by female parent
Specific band size be 107bp.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610677462.6A CN107012200B (en) | 2016-08-17 | 2016-08-17 | Anvil pumpkin ' the method for identifying molecules of big anvil 1 ' cenospecies |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610677462.6A CN107012200B (en) | 2016-08-17 | 2016-08-17 | Anvil pumpkin ' the method for identifying molecules of big anvil 1 ' cenospecies |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107012200A true CN107012200A (en) | 2017-08-04 |
| CN107012200B CN107012200B (en) | 2019-09-10 |
Family
ID=59439433
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610677462.6A Expired - Fee Related CN107012200B (en) | 2016-08-17 | 2016-08-17 | Anvil pumpkin ' the method for identifying molecules of big anvil 1 ' cenospecies |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107012200B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009029771A2 (en) * | 2007-08-29 | 2009-03-05 | Monsanto Technology Llc | Methods and compositions for breeding for preferred traits |
| US20120017291A1 (en) * | 2010-07-15 | 2012-01-19 | Vilmorin & Cie | Squash leaf curl virus (slcv) resistance in cucurbits |
| CN103088127A (en) * | 2013-01-05 | 2013-05-08 | 广东省农业科学院蔬菜研究所 | Primers and method for purity identification of hybrid seeds of Chinese pumpkin 'Guangmi NO.1' |
| WO2014200348A1 (en) * | 2013-06-14 | 2014-12-18 | Keygene N.V. | Directed strategies for improving phenotypic traits |
| CN104694642A (en) * | 2015-02-25 | 2015-06-10 | 华中农业大学 | Pumpkin SSR labeled primers applied to multiplex PCR reaction and application of pumpkin SSR labeled primers |
-
2016
- 2016-08-17 CN CN201610677462.6A patent/CN107012200B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009029771A2 (en) * | 2007-08-29 | 2009-03-05 | Monsanto Technology Llc | Methods and compositions for breeding for preferred traits |
| US20120017291A1 (en) * | 2010-07-15 | 2012-01-19 | Vilmorin & Cie | Squash leaf curl virus (slcv) resistance in cucurbits |
| CN103088127A (en) * | 2013-01-05 | 2013-05-08 | 广东省农业科学院蔬菜研究所 | Primers and method for purity identification of hybrid seeds of Chinese pumpkin 'Guangmi NO.1' |
| WO2014200348A1 (en) * | 2013-06-14 | 2014-12-18 | Keygene N.V. | Directed strategies for improving phenotypic traits |
| CN104694642A (en) * | 2015-02-25 | 2015-06-10 | 华中农业大学 | Pumpkin SSR labeled primers applied to multiplex PCR reaction and application of pumpkin SSR labeled primers |
Non-Patent Citations (3)
| Title |
|---|
| WATCHARAWONGPAIBOON, N. 等: "Development of microsatellite markers from an enriched genomic library of pumpkin (Cucurbita moschata L.)", 《SONGKLANAKARIN J. SCI. TECHNOL.》 * |
| 张国裕等: "南瓜属EST-SSR标记的开发及在杂种纯度鉴定中的应用", 《华北农学报》 * |
| 韩小霞: "利用SSR标记技术鉴定南瓜杂交种纯度的研究", 《分子植物育种》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107012200B (en) | 2019-09-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| TWI721708B (en) | A molecular marker related to papaya fruiting | |
| CN106755482B (en) | SSR molecular marker III for identifying progeny plants of Gala apples and application thereof | |
| CN106916897B (en) | Molecular marker for identifying purity of pumpkin hybrid seeds 'Yinhui No. three' of Indian pumpkin and application of molecular marker | |
| CN101492738B (en) | Onion cytoplasmic male sterility SCAR mark and uses thereof | |
| CN105483217B (en) | A kind of molecule labelling method for identifying rice east wild type cytoplasmic male sterility source | |
| CN106868135B (en) | Primer and method for identifying soybean male sterile line | |
| CN104004828B (en) | A kind of molecule marker and application thereof identifying onion cytoplasmic type | |
| CN104131012A (en) | Molecular marker for identifying soybean nucleus male sterility line and identification method thereof | |
| CN102304587A (en) | Method for rapidly identifying erect panicle of rice | |
| CN106434641B (en) | And cabbage purple leaf ball geneBrPurLinked molecular markers | |
| KR100842434B1 (en) | Ssr primer derived from ginseng and use thereof | |
| CN108239675B (en) | Molecular marker TJcM02 for identifying melon unisexual flower and application thereof | |
| CN108531636B (en) | Molecular marker TJcM01 for identifying melon unisexual flower and application thereof | |
| CN110331222B (en) | Molecular marker related to cotton fertility restoration and application thereof | |
| CN109234446B (en) | Cucumber female SNP molecular marker and application thereof | |
| CN106434930A (en) | Primer for purity identification of cucumber 'Yueqing 1' hybrid seed and method | |
| CN107012200B (en) | Anvil pumpkin ' the method for identifying molecules of big anvil 1 ' cenospecies | |
| CN106755387B (en) | Method for rapidly identifying cucumber rootstock joint strength secondary purity by using molecular marker | |
| CN109628636B (en) | SSR molecular marker for identifying hybrid of Xinjiang grape and Kyoho grape and application thereof | |
| CN106676171A (en) | Molecular detection method for multi-gene pyramiding breeding of cotton | |
| CN106011257A (en) | Molecular identification method for sitaris and raphanus distant-hybridization generation | |
| CN106636427B (en) | Microsatellite marker primer and method for identifying inbred families of exopalaemon carinicauda | |
| KR100769367B1 (en) | Ssr primer derived from common millet and use thereof | |
| CN108411029A (en) | Balsam pear grows green No. 2 hybrid seed purities identification specific marker and method | |
| CN104946633B (en) | A kind of dCAPS labels for identifying onion cytoplasm fertility and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190910 Termination date: 20200817 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |